Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

בידוד וטיפוח של תאי גזע מסנכימליים במח עצם מנדיבול בחולדות

doi: 10.3791/61532 Published: August 25, 2020
* These authors contributed equally

Summary

מאמר זה מציג שיטה המשלבת דבקות של מח עצם שלם ומיון ציטומטריה זרימה לבידוד, טיפוח, מיון וזיהוי תאי גזע מזנכימליים של מח עצם מלסת חולדה.

Abstract

כאן אנו מציגים שיטה יעילה לבידוד ו culturing תאי גזע mesenchymal מח עצם mandibular (mBMSCs) במבחנה כדי להשיג במהירות תאים באיכות גבוהה רבים לדרישות ניסיוניות. mBMSCs יכול להיות בשימוש נרחב ביישומים טיפוליים כתאים הנדסת רקמות במקרה של מחלות craniofacial והתחדשות cranio-maxillofacial בעתיד בשל יכולת התחדשות עצמית מעולה ופוטנציאל בידול רב שושלת. לכן, חשוב להשיג mBMSCs במספרים גדולים.

במחקר זה, מח עצם היה סמוקה מן הלסת התחתונה mBMSCs העיקרי היו מבודדים באמצעות טיפוח מח עצם שלם דבק. יתר על כן, CD29+CD90+CD45- mBMSCs טוהרו באמצעות מיון תאים פלואורסצנטיים. הדור השני של mBMSCs מטוהרים שימשו למחקר נוסף והפגינו פוטנציאל להבדיל לתוך osteoblasts, adipocytes, וכונדרוציטים. ניצול מודל זה במבחנה, ניתן להשיג מספר גבוה של mBMSCs שגשוג, אשר עשוי להקל על חקר המאפיינים הביולוגיים, התגובה הבאה microenvironment, ויישומים אחרים של mBMSCs.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

תאי גזע mesenchymal מח עצם (BMSCs) הם תאי גזע שאינם hematopoietic נגזר מח עצם המניפסט יכולת התפשטות חזקה ובידול רבשושלתפוטנציאל 1,2,3,4. ואכן, BMSCs נחשבו כמועמד אידיאלי להנדסת רקמת עצם והתחדשות מאז שהתגלו. במשך שנים, סמל האיליאק או עצמות ארוכות כגון השוקה ועצם הירך היו המקור הנפוץ ביותר של BMSCs להתחדשות craniofacial. עם זאת, בקרי BMSC של Orofacial, כגון BMSCs מנדיבולריים (mBMSCs), מציגים כמה הבדלים מ- BMSCs של עצם ארוכה, כגון מקור עוברי שונה ותבנית פיתוח. הלסת התחתונה נובעת מתאי ציצה עצביים של שכבת הנבט הנוירוקטודרם ועוברת תולדות תוך-ממברניות, בעוד שלדים ציריים ונספחיים הם מהמסודרם ועוברים אוססיפיקציה אנדוכונדרית. יתר על כן, תצפיות קליניות ומחקרים ניסיוניים בבעלי חיים הראו באופן עקבי כי ישנם הבדלים תפקודיים בין פסגת orofacial ו iliac BMSCs5,6,7,8. דיווחים הראו כי BMSCs נגזר עצם craniofacial כגון עצם הלסת התחתונה, עצם maxillary, ועצם מכתשית הציג התפשטות מעולה, תוחלת חיים, ויכולת בידול מאלה של עצמות ציריות ונספח9. mBMSCs, אם כן, נחשבים המשאבים המועדפים עבור יישומים טיפוליים עתידיים של מחלות craniofacial כגון כרוביזם, גידול בלסת, אוסטאופורוזיס של עצם הלסת, ומפגם רקמת חניכיים10,11,12. כדי להבין את פוטנציאל הטיפול בניסויים פרה-קוליניים, חיוני לקבוע שיטה לבידוד מהיר ולבידוד mBMSCs במבחנה.

במחקר זה, המטרה הייתה להשיג mBMSCs מטוהרים על ידי דבקות מח עצם שלם ומיון cytometry זרימה. המורפולוגיה האנטומית של הלסת התחתונה של החולדה, שנצפתה בבירור באמצעות טומוגרפיה ממוחשבת מיקרו (Micro-CT) ומקטעים היסטולוגיים, הראתה כי עצם הלסת התחתונה הייתה בין החלל הטחון החותך לבין עצם מכתשית. מח העצם מעצם trabecular היה סמוק כדי להשיג תאי מח עצם, אבל התאים מתורבתים בדרך זו לא היו mBMSCs טהורים היו עשויים להיות מורכבים סוגים רבים של תאים עם עוצמות לא בטוחות ושושלת מגוונת כגון תאים מעצם, שומן ותאי אנדותל13,14. השלב הבא של טיהור התאים היה חשוב במיוחד. זרימה cytometry מסנן תאים על ידי זיהוי שילוב של חלבונים משטח התא אומץ נרחב בהעשרה של תאי גזע mesenchymal. הומוגניות התא הוא היתרון העיקרי של cytometry זרימה, אבל התהליך אינו קובע את הכדאיות של התא יכול לגרום לתפוקת תא מוגבלת. במחקר זה, P0 mBMSCs שהתקבלו הדבקות מח עצם שלם מוינו לפי cytometry זרימה כדי להשיג mBMSCs עם טוהר גבוה ויכולת התפשטות חזקה.

מחקר זה מציג פרוטוקול לשחזור ואמין לבידוד, תרבות, ובידול של BMSCs גברי עכברוש באמצעות שילוב של דבקות מח עצם שלם מיון cytometry זרימה. זוהי שיטה אמינה ונוחה לחוקרים בתחומים קשורים לשימוש.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

כל ההליכים הניסיוניים בבעלי חיים במאמר זה אושרו על ידי הוועדה לטיפול בבעלי חיים של בית החולים העממי התשיעי של שנגחאי, בית הספר לרפואה של אוניברסיטת ג'יאו טונג בשנגחאי.

1. הכנה

  1. השתמש בשני עכברושים זכרים בני 5 שבועות ספראג דולי לניסוי.
  2. לעקר את כל המכשירים, כולל מחזיקי מחט, פינצטה ומספריים בטמפרטורה גבוהה או שקוע 75% אתנול במשך 10 דקות.
    הערה: טבילה אתנול לא צריך להיות ארוך מדי כדי למנוע נזק לתאים.
  3. הכינו מראש את מדיית התרבות, שהרכבה ניתן בטבלה 1. יש להשלים כל מדיום כמתואר להלן.
    1. הכנת מדיום תרבות α-MEM (עם 10% FBS): יש להשלים לפחות אלפא בינוני חיוני (α-MEM) עם 10% סרום בקר עוברי ו-1% פניצילין וסטרפטומיצין.
    2. הכנת מדיום בידול אוסטאוגני: תוספת בידול אוסטאוגני בינוני בסיסי עם 10% סרום שור עוברי, 1% גלוטמין, 1% פניצילין-סטרפטומיצין, 0.20% חומצה אסקורבית, 1% β-גליצרוזפט ו-0.01% דקסמתזון.
    3. הכנת מדיום אינדוקציה אוסטאוגני: יש לערבב 70% α-MEM בינוני (עם 10% FBS) ובינוני בידול אוסטאוגני של 30%.
    4. הכנת מדיום בידול אדיפוגני A: תוספת בינונית בזלית דיפופוגנית עם 10% סרום שור עוברי, 1% גלוטמין, 1% פניצילין-סטרפטומיצין, 0.20% אינסולין, 0.10% IBMX, 0.10% רוזיגליטזון ו-0.01% Dexamethasone.
    5. הכנת מדיום בידול אדיפוגני B: תוספת מדיום בזל בידול אדיפוגני עם 10% סרום שור עוברי, 1% גלוטמין, 1% פניצילין-סטרפטומיצין ו-0.20% אינסולין.
    6. הכנת מדיום בידול כונדרוגני: תוספת ביונדרוגנית בידול בסיסי בינוני עם 0.01% Dexamethasone, 0.30% חומצה אסקורבית, 1% שלה, 0.10% נתרן פירובט, 0.10% פרולין ו 1% TGF-β3.
      הערה: יש להשתמש במדיום הבידול האוסטיאוגני תוך חודש לאחר קביעת התצורה. התקופה האפקטיבית של מדיום הבידול כונדרוגני מוגדר הוא 12 שעות.

2. בידוד וטיפוח של mBMSCs עכברוש

הערה: כל הניתוחים הניסיוניים צריכים להתבצע על קרח ככל האפשר כדי לשמור על הכדאיות של התא.

  1. קצירת לסתות עכברוש
    1. המתת חסד לשני עכברושים זכרים בני 5 שבועות ספראג דולי על ידי חנק CO2. ודאו שנשימת החיה נעצרת לפני שתמשיך בניסוי.
    2. לשטוף את החולדות האלה בכומתה המכילה 75% אתנול במשך 3 דקות.
    3. מניחים את החולדה בתוך מכסה המנוע אדים נקי לקצור mandibles.
      הערה: לעקר את מכסה המנוע אדים על ידי קרינת אור אולטרה סגול במשך 30 דקות לפני השימוש.
    4. מניחים את החולדה בתנוחה על-חושית. להסית את העורות ואת שרירי buccinator מן אנגולוס דו צדדית oris לאזור האחורי של הלסת התחתונה, שהיא העצם היחידה מטלטלין עם חותך נמוך יותר.
      הערה: מומלץ לבצע חתך של 2 ס"מ בכל צד של אנגולוס אוריס כדי לקבל שדה פעולה ברור.
    5. פתח את הפה של החולדה על ידי דחיפת החותכות maxillary ו mandibular לכיוון ההפוך עם שני האגודלים כדי לחשוף את השיניים הלסת התחתונה, אשר מחוברים הלסת התחתונה.
    6. נתק לחלוטין את שרירי הבוקאל ואת הגידים המחוברים לקוראקואידים ואת הגבול הנחות של הלסת התחתונה.
      הערה: ניידות מוגברת של הלסת התחתונה נצפתה במהלך שלב זה בגלל חוסר מתח שרירים.
    7. לחץ על השיניים האחוריות הלסת התחתונה ולסובב אחורה ולמטה עד condyles משני הצדדים נחשפים בבירור.
      הערה: שלב זה מבוצע כדי לפתוח באופן מלאכותי את הפה של החולדה במידה המרבית האפשרית כדי לפרוק את הקונדיל. הלסת התחתונה מחוברת לגולגולת דרך קונדילים דו-צדדיים, כך שחשיפת הקונדילים מובילה לניתוק בין הגולגולת ללסת התחתונה.
    8. הפרד את הגוף הלסת התחתונה מהגולגולת.
    9. נקה את הרקמה הרכה החסידה על משטח העצם באמצעות גזה רטובה.
    10. מניחים את העצם בצלחת זכוכית סטרילית 10 ס"מ מלא α בינונית חיונית (α-MEM) או מלוחים חיץ פוספט (PBS) על הקרח כדי לשמור על הכדאיות.
  2. בידוד וטיפוח של mBMSCs
    1. חותכים את העצם הקדמונית לאורך הקצה mesial של הטוחנת הראשונה מהגוף הלסת התחתונה. הסר את ראמוס הנדיבולרי כולל coracoid ו condyle לאורך הקצה הדיסטלי של הטוחנת השלישית כדי לחשוף את חלל מח העצם.
    2. ממלאים צלחת זכוכית סטרילית 10 ס"מ עם 10 מ"ל של α-MEM (עם 10% FBS).
    3. השתמש במזרק של 1 מ"ל כדי לשאוף את מדיום התרבות α-MEM. עם מחט המזרק מוכנס לתוך חלל מח העצם, שוב ושוב לשטוף את מח העצם לתוך המנה. לשטוף את חלל העצם לפחות 3 פעמים משני הצדדים mesial ו distal של העצם, בהתאמה, עד העצם הפך לבן.
      הערה: זהו הצעד הקריטי ביותר, כמו חלל מח העצם של הלסת התחתונה חולדה אינו ברור כמו עצם ארוכה ואת הנקודה הנכונה כדי להכניס את המחט צריך להיקבע באופן אמפירי. כל הדגימות הניסיוניות לעיל צריך להיות מאוחסן על קרח כדי לשמור על הכדאיות של התא ולכן זמן הפעולה חייב להיות לא יותר מ 2 שעות.
    4. להעביר את המדיה המכילה את התאים סמוקים לתוך צינור צנטריפוגה 15 מ"ל וצנטריפוגה ב 800 x g ב 4 מעלות צלזיוס במשך 5 דקות. השלך את הסופרנט.
    5. התחדשו בתאים עם 3 מ"ל של α-MEM (עם 10% FBS). צלחת התאים בצלחת תרבות חדשה 10 ס"מ דגירה ב 37 °C (69 °F) ב 5% CO2 אינקובטור.
    6. בדוק את השינויים המורפולוגיים ואת הצמיחה של תאים אלה ביום השלישי של התרבות. הסר את מדיום התרבות עם תאים לא מתים ושברי רקמות. הוסיפו בעדינות 10 מ"ל של α-MEM טרי (עם 10% FBS).
    7. לאחר 7 ימים של תרבות, P0 mBMSCs הגיע 70% כדי 80% מפגש.
  3. מיון תאי זרימה
    הערה: מחשבי P0 mBMSCs זוהו פנוטיפיים ומטוהרים בעיקר באמצעות מיון תאי זרימה.
    1. לשאוף ולהשליך את מדיום התרבות ולאחר מכן לשטוף את המנה עם PBS. השלך את PBS.
    2. הוסף 1 מ"ל של 0.25% טריפסין עם 0.02% EDTA בצלחת. לעכל את התאים ב 37 °C במשך 5 דקות, ולאחר מכן להוסיף 2 מ"ל של α-MEM (עם 10% FBS) כדי לעצור את התגובה.
    3. להעביר את התאים השעיה לתוך צינור צנטריפוגה 15 מ"ל וצנטריפוגה ב 800 x g במשך 5 דקות.
    4. Resuspend התאים ב 120 μL של PBS (עם 10% FBS) לאחר צנטריפוגה.
    5. חסום את המתלי התאים האלה עם μL אחד של נוגדן נגד CD16/CD32 ב 4 מעלות צלזיוס במשך 15 דקות.
    6. העבר 100 μL של השעיית התא לצינור מיקרוצנטריפוגה חדש, הכתים את התאים עם נוגדן Phycoerythrin (PE) מצומד נגד CD45, נוגדן פלואורסצנטין-isothiocyanate (FITC)-מצומד נגד CD90 ו Allophycocyanin (APC)-נוגדן נגד CD29 ב 4 °C (70 °F) עבור 1 שעות בחושך13,15. ריכוז הנוגדנים המשמשים בניסוי זה מוצג בטבלה 2. השתמש 20 μL האחרים של השעיית התא כמו שליטה שלילית מוכתמת.
    7. לאחר מכן צנטריפוגה הצינורות ב 800 x g במשך 5 דקות, להשליך את ההשעיה, ו resuspend התאים ב 0.5 מ"ל של PBS (עם 10% FBS).
    8. הוסף 10 μL של 0.01 מ"ג / מ"ל DAPI במשך 10 דקות לפני הניתוח.
    9. השתמש במסנני 40 ננומטר הממוקמים על צינורות צנטריפוגה כדי לסנן את התאים.
    10. נתח את התאים בסדרן התאים המופעל על-ידי פלואורסצנטיות. הגדר את הלוחות באופן הבא. ראשית, הסר תאים מתים מספירת תאים כוללת על-ידי גיטינג DAPI- תאים ולאחר מכן שער CD29+CD90+CD45- בתאים שנבחרו כ- mBMSCs ייעודיים.
    11. לאסוף את CD29ממוין +CD90+CD45- תאים לתוך צינור צנטריפוגה 15 מ"ל עם 3 מ"ל של α-MEM (עם 10% FBS) מוכן מראש.
    12. צנטריפוגה הצינורות ב 800 x g במשך 5 דקות. הסר את מאגר האוסף והוסף 1 מ"ל של α-MEM טרי (עם 10% FBS) כדי לשימוש חוזר בתאים. ואז צלחת אותם בצלחת תרבות 6 ס"מ.

3. יכולת היווצרות מושבה

הערה: שלב זה בוצע כדי לבדוק את יכולת החלוקה של mBMSCs. 15 (15)

  1. בחר mBMSCs של מעבר שני (P2) עבור ניסוי זה. כאשר מפגש התא הגיע 80% עד 90%, reseed התאים במעבר צבע טורי בצלחת 6 גם כדי להעריך את יכולת התפשטות השיבוט שלהם.
    הערה: מומלץ להגדיר את השיפוע מ 1 x 102 כדי 1 x 103 תאים לכל באר, אבל הדילול הסופי של קווי תאים שונים ממוצא אנושי או מן החי נקבעו באופן אמפירי.
  2. תרבית התאים α-MEM (עם 10% FBS) במשך כשבועיים עד מספר לא מבוטל של יחידות להרכיב המושבה ניתן לראות תחת מיקרוסקופ אור. רענן את מדיום התרבות כל 3 ימים.
  3. לשאוף ולהשליך את מדיום התרבות, לשטוף את הבארות עם PBS פעמיים במשך 5 דקות בכל פעם. לאחר מכן להוסיף 4% פתרון paraformaldehyde לכל באר ולתקן לפחות 10 דקות.
  4. הסר את paraformaldehyde ולשטוף את הבארות פעמיים עם PBS.
  5. הכתים את התאים בתמיסת כתמים סגולה קריסטלית ודגר אותם ב 37 מעלות צלזיוס במשך כ 10 דקות.
    הערה: זמן הכתם מותאם כראוי עד להשגת הגוון הרצוי.
  6. הסר את פתרון הכתמים ולשטוף את הדגימות עם מים מזוקקים כדי לעצור את התגובה.
  7. תמונה תחת סטריאומיקרוסקופ וספירת מושבות תאים מפוזרות שכללו לפחות 50 תאים.

4. בידול רב-לשוני של MBMSCs

הערה: מחשבי ה- MBMSCs של P2 שימשו לניסויים הבאים, אלא אם כן תואר אחרת.

  1. אינדוקציה אוסטאוגנית של mBMSCs
    1. לעכל את mBMSCs כמתואר לעיל. תאי זרע בצפיפות של 2.5 x 105/cm2 בצלחת 12 היטב בתוספת 1 מ"ל α-MEM (עם 10% FBS).
    2. כאשר המפגש התא הגיע 60-70%, לשנות את המדיום לתוך 30% אוסטאוגנית אינדוקציה מדיה. תרבית את התאים עם α-MEM (עם 10% FBS) כפקד שלילי ולשנות את המדיום כל 2 ימים.
      הערה: לאחר מספר רב של גושי סידן מופיעים במהלך osteogenesis, מומלץ לשנות את דפוס ההחלפה הבינונית להחלפה בינונית של חצי נפח כל יומיים, כדי למנוע osteoblasts לצוף.
    3. לאחר culturing במשך שבעה ימים, להעריך את הסתיידות של תאים אלה על ידי מכתים phosphatase אלקליין16,17.
    4. הסר את מדיום התרבות ולתקן את התאים עם 4% paraformaldehyde במשך 10 דקות. לשטוף את התאים באמצעות 1 מ"ל של PBS לבאר במשך 3 דקות פעמיים.
    5. לאחר מכן הכתימו את התאים בתמיסת כתמי פוספטאז אלקליין ודגרו ב-37 מעלות צלזיוס למשך 10-30 דקות.
      הערה: הדגירה יכולה להתבצע לילה בטמפרטורת החדר כדי לקבל את הצבע הנדרש.
    6. לשטוף את הבארות עם מים מזוקקים כדי לעצור את התגובה. צלם תחת מיקרוסקופ אור. גרגירים פיגמנטיים אדומים מייצגים פעילות פוספטאז אלקליין (ALP).
    7. לאחר culturing התאים הנותרים במשך 7 ימים נוספים, לבצע כתמים אדומים alizarin כדי להעריך את יכולת מינרליזציה של התאים.
    8. הכתים את התאים עם 0.5% פתרון כתמים אדומים alizarin לאחר קיבוע התא במשך 10 דקות16,18. לעצור את התגובה הכרומוגנית עם מים מזוקקים לאחר 3-5 דקות.
      הערה: ניתן להאריך את זמן התגובה בהתאם לצבע שפותח.
    9. לבסוף, מניחים את צלחת התרבות מתחת למיקרוסקופ האור כדי לבחון את ההשפעה של כתמים אוסטאוגניים; גושים אדומים מצביעים על משקעי סידן של תאים אלה.
  2. אינדוקציה אדיפוגנית של mBMSCs
    1. זרעי P2 mBMSCs בצלחת 12 באר כמתואר לעיל.
    2. לאחר בבאר להיות 90% confluent, תרבות התאים עם מדיום בידול adipogenic A. השתמש בתאים בתרבית מדיום תרבות α-MEM (עם 10% FBS) כשליטה שלילית.
    3. לאחר 2 ימים של אינדוקציה, לשאוף את המדיום A מהבאר ולהוסיף 1 מ"ל של דיפרנציאציה אדיפוגנית בינוני B בכל באר.
    4. לאחר יום אחד, להסיר בינוני B ולהתחיל את המחזור שוב עם בינוני A הוסיף בחזרה לתוך הבאר. תרבית את התאים לסירוגין באמצעות בינוני A ו- B.
    5. החל את מדיום הבידול A ו- B לסירוגין במשך שלושה מחזורים ולזהות את adipogenesis של תאים אלה על ידי שמן אדום O מכתים16,18.
      הערה: הרבה טיפות שומנים עגולים וגדולים ניתן לראות על ידי culturing תאים אלה עם מדיום בידול B במשך 2 עד 3 ימים נוספים.
    6. הסר את המדיום ולתקן את התאים עם 4% paraformaldehyde במשך 10 דקות. לשטוף את התאים עם PBS.
    7. הכתים את התאים בתמיסת כתמי O אדומה בשמן ודגר ב-37 מעלות צלזיוס למשך כ-3 דקות.
    8. הסר את פתרון הכתמים ולשטוף את הבארות עם מים מזוקקים.
    9. שימו לב לאדיפוגנזה תחת מיקרוסקופ אור.
  3. אינדוקציה של כונדרוגנסיס של mBMSCs
    1. זרעי P2 mBMSCs בצינור צנטריפוגה 15 מ"ל בצפיפות של 5 x 105/ ס"מ2.
    2. צנטריפוגה הצינורות ב 300 x g במשך 5 דקות. השלך את הסופרנט.
    3. Resuspend התאים עם 0.5 מ"ל של מדיום בידול כונדרוגני. צנטריפוגה התאים ב 300 x g במשך 5 דקות.
    4. שחרר את המכסה של צינור הצנטריפוגה ודגר אותו ב 37 °C (69 °F) באינקובטור CO2 5%. לחדש את המדיום כל יומיים.
      הערה: תאים מתחילים גלולות לאחר 24 שעות. מומלץ לא להזיז את צינור הצנטריפוגה במשך 48 שעות. היזהר לא לשאוף את גלולת התא בעת שינוי המדיום.
    5. לאחר 21 ימים של אינדוקציה, לתקן את כדורי התא עם 4% paraformaldehyde, ואחריו התייבשות, הטמעת פרפין וקטעים.
    6. לאחר deparaffinization והידרציה, כתם את המגלשות בתמיסה כחולה אלסית לפחות 15 דקות18,19,20,21, ואז לשטוף עם מים מזוקקים כדי לעצור את התגובה. לכוד את התצלומים תחת מיקרוסקופ אור.
    7. עבור כתמים אימונופלואורסצנטיים מסוג קולגן II, בצע את השלבים הבאים.
      1. דגירה שקופיות עם 5 מיקרוגרם / מ"ל proteinase K במשך 15 דקות ב 37 מעלות צלזיוס לאחר שלב deparaffinization והידרציה.
      2. דגירה השקופיות במאגר חסימה במשך 1 שעה ב 37 °C (69 °F).
      3. החל 1 μL של נוגדן קולגן מסוג II ב 200 μL של חיץ חסימה על שקופיות דגירה לילה ב 4 מעלות צלזיוס.
      4. למחרת, לשטוף את השקופיות עם PBS פעמיים דגירה עם נוגדנים משניים ב 37 מעלות צלזיוס במשך 1 שעות.
      5. דגירה את הפרוסות עם 40,6-diamidino-2-פנילינדול (DAPI) במשך 10 דקות.
    8. צלם כל שקופית תחת מיקרוסקופיה פלואורסצנטית.

5. PCR בזמן אמת

  1. לחלץ RNA סה"כ מ mBMSCs באמצעות guanidium isothiocyanate מבוסס מסחרית זמין ריאגנט.
  2. בצע שעתוק הפוך של RNA לדנ"א משלים באמצעות ערכה מסחרית זמינה. תנאי התגובה של שעתוק הפוך היו כדלקמן: 65 °C (65 °F) במשך 5 דקות, 37 °C (67 °F) במשך 15 דקות, 85 °C (65 °F) עבור 15 s.
  3. בצע PCR בזמן אמת כדי לזהות אוסטאוגנזה וגנים ספציפיים adipogenesis באמצעות פריימרים המפורטים בטבלה 3. הליך הגברה PCR היה כדלקמן: 95 °C (70 °F) במשך 5 דקות.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

באמצעות פרוטוקול זה, חלק גדול מהתאים דבקו בצלחת ביום השלישי לאחר התרבות הראשונית. בדרך כלל, לאחר 3-4 ימים נוספים של תרבות, מפגש התאים הגיע ל-70 עד 80%(איור 1B). עם מיון תאים פלואורסצנטי, DAPI-CD29+CD90+CD45- mBMSCsטוהרו 18,22, אשר היוו כ 81.1% בתאי P0 (איור 1C).

לאחר זריעת P2 mBMSCs ב 100 תאים בכל באר של צלחת 6 באר במשך שבוע, כמות משמעותית של יחידות יוצרות מושבה נצפו, אשר הציע את המושבה המשמעותית להרכיב יכולת של mBMSCs (איור 1D).

כדי להעריך את יכולת הבידול מרובה שושלת, mBMSCs נגרמו לתוך אוסטאו, כונדרו- ו אדיפו שושלת, בהתאמה, ב 12 צלחות היטב. ה- mBMSCs הציגו יכולת בידול אוסטאוגנית חזקה. פעילות מוגברת של ALP, גושים מסוידים אדומים מופצים באופן ספורדי תחת כתמים אדומים alizarin, וביטוי מוגבר של גנים ספציפיים osteogenic Runx2 , Alp, Bsp ו Ocn (איור 2) הצביע על אינדוקציה אסטוגנית. עבור adipogenesis, זוהה על ידי שמן אדום-O כתמים, vacuoles עשירים בשומנים רבים ניכרו לאחר 9 ימים של אינדוקציה. כמו כן, הביטוי של גנים ספציפיים אדיפוגניים Pparγ1 ו Cebpa הראה עלייה משמעותית (איור 3). לתצפית מיקרוסקופית של שקופיות בידול כונדרוגניות, הדגימות הראו כתמים חיוביים לכחול אלסיאני. בנוסף, חיסון עם נוגדן קולגן מסוג II הראה הצטברות משופרת של מטריצת סחוס (איור 4).

תרבות בינונית רכיב ריכוז סופי
מדיום תרבות α-MEM (עם 10%FBS) מדיום חיוני מינימלי α
סרום שור עוברי 10%
פניצילין וסטרפטומיצין 1%
2.מדיום אינדוקציה אוסטאוגני מדיום תרבות α-MEM (עם 10%FBS) 70%
מדיום בידול בידול אוסטאוגני 30%
3.מדיום בידול אוסטאוגני מדיום בזל בידול אוסטאוגני
סרום שור עוברי 10%
גלוטמין 1%
פניצילין-סטרפטומיצין 1%
חומצה אסקורבית 0.20%
β-גליצרוזפט 1%
דקסמתזון (פירושונים) 0.01%
4.מדיום בידול אדיפוגני A מדיום בזל בידול אדיפוגני
סרום שור עוברי 10%
גלוטמין 1%
פניצילין-סטרפטומיצין 1%
אינסולין 0.20%
IBMX 0.10%
רוזיגליטזון 0.10%
דקסמתזון (פירושונים) 0.01%
5.דיפרנציאציה אדיפוגנית בינוני B: מדיום בזל בידול אדיפוגני
סרום שור עוברי 10%
גלוטמין 1%
פניצילין-סטרפטומיצין 1%
אינסולין 0.20%
6.מדיום בידול כונדרוגני: מדיום בזלת בידול כונדרוגנסיס
דקסמתזון (פירושונים) 0.01%
חומצה אסקורבית 0.30%
שלה 1%
נתרן פירובט 0.10%
פרולין 0.10%
TGF-β3 1%

טבלה 1: מרכיבי מדיום תרבות ובינוני בידול.

נוגדן ריכוז
CD90.1 (Thy-1.1) נוגדן חד שבטי 0.5 מ"ג/מ"ל
נוגדן חד שבטי CD45 0.2 מ"ג/מ"ל
נוגדן CD29 0.2 מ"ג/מ"ל
נוגדן פוליקלונלי של ארנב קולגן 5 מ"ג/מ"ל
עז נגד ארנב IgG H&L (אלקסה פלואור® 488) 1 מ"ג/מ"ל

טבלה 2: ריכוז נוגדנים המשמש במחקר זה.

תחל רצף(5' עד 3')
גאפ-די פווורד: צ'גאגאטקאגאקגקאגקאטג
הפוך: אקטגקטקאגקאקאץ'
Runx2 פווורד: GCCTTCAAGGTTGTAGCCCT
הפוך: TGAACCTGGACTTGGTTT
LP (100) פווורד: AAACTCGCTTATGGTCCCCG
הפוך: TGGGTTTGAATTCCTGGGGT
BPS פווורד: GCACGGTTGTATGGAA
הפוך: ATCCTGACCCTCGTAGCCTT
און (Ocn) קדימה:קק"קאטגטגגג'ק
הפוך:GGCAACAקטגמקCTAAACG
צ'בפה (1999) פווורד: AGTCGGTגאטאגאקאקאקאג
הפוך: CGGTCאטגקטגטק
פפר 1 פווורד: CCATCGAGגאגאקאקהאקה
הפוך: GTGCTCTGTGACTCTGCCTGAG

טבלה 3: פריימרים המשמשים PCR בזמן אמת.

Figure 1
איור 1: בידוד ותרבות של mBMSCs. ( A )דיאגרמהסכמטית של הפרוטוקול. mBMSCs היו מבודדים מצופים ביום 0 והדגירה עם מדיום תרבות α-MEM. ביום 7, P0 mBMSCs טוהרו באמצעות מיון cytometry זרימה ואת התאים ממוינים היו מצופים על צלחת תרבות חדשה. ביום 14, P1 mBMSCs נאספו ציפוי על צלחת 12-well. ביום 15, P2 mBMSCs היו המושרה לתוך osteoblasts, תאים אדיפוגניים chondroblasts תחת מדיום אינדוקציה המקביל. (B)מודל סכמטי של מח עצם עצם גברי עכברוש ותצפית מיקרוסקופית של P0 mBMSCs. (C) מיון ציטומטריה זרימה של mBMSCs עכברוש. ניתוח cytometry זרימה מראה תאים אלה היו חיוביים עבור CD29 ו- CD90, אבל שלילי עבור CD45, אשר עולה עם מאפייני BMSC. מתוכם, 1.4 x 106 תאים מוינו, אשר היוו כראוי 80% מכלל התאים. (D) תמונה מייצגת של שיבוטים מוכתמים סגול קריסטל P2 mBMSC. לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 2
איור 2: פוטנציאל בידול אוסטאוגני של mBMSCs. (A) לאחר 7 ימים של אינדוקציה אוסטאוגנית, השינוי של פעילות ALP היה דמיינו. מספר גדול של גושים מינרליים הוכתמו תחת כתמים אדומים alizarin ב 14 ימים לאחר אינדוקציה של בידול אוסטאוגני. (B,C) האזור החיובי של ALP וכתמים אדומים alizarin הוערכו באמצעות תוכנת Image J. (C-G) ביטוי mRNA של סמנים ספציפיים osteoblast Runx2, Alp, Bsp ו Ocn גדל באופן משמעותי לאחר 7 ימים של osteogenesis. לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 3
איור 3: פוטנציאל הבידול האדיפוגני של mBMSCs לאחר תשעה ימים של אינדוקציה. (A)כמות גדולה של טיפות שומנים טופס adipocytes הוכתמו על ידי שמן אדום-O. (B,C) ביטוי mRNA של סמנים אדיפוגניים Cebpa ו Pparγ1 גדל להפליא לאחר 9 ימים של אדיפוגנזה. לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Figure 4
איור 4: תצוגת סטריאוסקופ של אפקט הבידול כונדרוגני. (A)mBMSCs לאחר 21 ימים אינדוקציה כונדרוגנית הראה חיובי עבור כתמים כחולים אלסיים. (B) תמונת אימונופלואורסצנטיות של צבירה כונדרוגנית מוכתמת בקולגן מסוג II אנטי. לחץ כאן כדי להציג גירסה גדולה יותר של איור זה.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

פרוטוקול זה מתאר שיטה לבודד BMSCs מן הלסת התחתונה חולדה במבחנה על ידי שילוב של דבקות מח עצם שלם מיון תאים פלואורסצנטי, המהווה דרך פשוטה ואמינה להשיג mBMSCs התפשטות עם יכולת בידול חזקה. שיטה זו יכולה לטהר מראש mBMSCs על ידי מיון תא זרימה, אבל אם יש דרישות גבוהות יותר עבור הומוגניות התא, שיטות טיהור מדויקות יותר עשוי להידרש.

נכון לעכשיו, ישנן ארבע טכניקות עיקריות המשמשות בידוד mBMSCs, כולל דבקות מח עצם שלם, צנטריפוגה הדרגתית צפיפות, מיון תאים פלואורסצנטיים מיון תאים מופעל מגנטי22. דבקות מח עצם שלם וצנטריפוגה הדרגתית צפיפות הם השיטות הנפוצות והקלות ביותר המשמשות להשגת mBMSCs בזמן קצר, עם זאת, הטוהר הנמוך של mBMSCs שנקטפו הוא החיסרון העיקרי שלהם. שתי השיטות האחרונות יכולות לבודד mBMSCs מטוהרים מאוד באמצעות טכניקות אימונולוגיות, אבל יש את החסרונות של להיות יקר, לוקח זמן רב ופוגע בכדאיות התא. במחקר זה היתרונות של דבקות מח עצם שלם ואת שיטת מיון תאים פלואורסצנטיים שולבו כדי להשיג מספיק מספרים של mBMSCs שגשוג תוך זמן קצר.

ללא ספק, אחד הצעדים הקריטיים ביותר בפרוטוקול זה הוא ניתוח של הלסת התחתונה של החולדה, אשר נבדל למדי מאלה של עצמות ציריות ונספחיות. זה חיוני כדי להבין את האנטומיה של עכברוש mandible כדי לקבל מדגם שלם. בדומה לאנושי, הלסת התחתונה של החולדה יושבת מתחת למקסילה, מחזיקה את השיניים התחתונות במקומן ומחוברת לגולגולת על ידי קונדילים דו-צדדיים. מכיוון שהלסת התחתונה היא העצם היחידה שיכולה לנוע בגולגולת, ישנם שרירים רבים המחוברים ללסת התחתונה, השולטים בתנועתה. רק על ידי הסרת רקמות רכות אלה לחלוטין והפיכת הפה פתוח באופן מקסימלי ניתן לחשוף את הקונדילים המתחברים לגולגולת. ראוי גם להזכיר כי הצוואר condylar היא חולשה פיזית בלסת התחתונה וקל לשבור. אם נמצאה התנגדות מוגזמת בעת סיבוב הלסת התחתונה כלפי מטה, משמעות הדבר היא כי השרירים הלסת לא ניתן להסיר לחלוטין. כאשר זה נצפתה, לא לסובב אותו באופן מוגבל, אחרת קל לשבור את הצוואר condylar ובכך מוביל לזיהום התא. קשיים אחרים בהפרדה ובתרבות של mBMSCs כוללים תוכן נמוך במח העצם, פעילות תאים עדינה, טוהר נמוך, תדירות תאים נמוכה וזיהום של תאים hematopoietic18,23. כדי להשיג mBMSCs עם צמיחה טובה ופוטנציאל בידול גבוה יחסית, הבטחת הפעילות של mBMSCs היא בעלת חשיבות מכרעת. ישנם מספר צעדים מרכזיים, כולל שימוש בחולדות בנות ארבעה שבועות לניסויים אלה ואחר כך, שכן חולדות צעירות מעדיפות לשמור על כדאיות טובה. מחקרים רבים אישרו כי הפעילות של mBMSCs קשורה לגיל של בעלי חיים ניסיוניים. MBMSCs אלה מתורמים מבוגרים עלולים לגרום לפעילות התפשטות נמוכה יותר, פוטנציאל בידול ואורךחיים 2. כל הפעולות במהלך קציר התא צריך להסתיים על קרח ואת זמן הפעולה צריך להיות קצר ככל האפשר, רצוי בתוך 2 שעות. בנוסף, לשמור על זמן העיכול טריפסין לא יותר מ 3 דקות. לבסוף, אתגר נוסף בפרוטוקול זה הוא תהליך של קצירת mBMSCs. זה עלול להיות בעייתי לשטוף mBMSCs מחלל העצם כי החלל של הלסת התחתונה של החולדה הוא קטן מאוד, ולכן חשוב מאוד להכיר את המבנה האנטומי. תמונות מיקרו-CT יכולות לעזור מאוד בהקשר זה. חוץ מזה, ראוי לציין כי כמו עצמות נעורים הם דקים ופריכים, שבירה יכולה לגרום לזיהום.

בהתייחסו לאפיון אימונופנוטיפי, BMSCs מבטאים מספר פנוטיפים, אך אף אחד מהם אינו ספציפי עבורם24. מקובל ש- BMSCs אינם מבטאים CD11b, CD14, CD34 או CD45, אך יש להם ביטוי גבוה של Sca-1, CD29, CD90 ו- CD105. מחקר זה בחר את הסמנים המקובלים של CD29, CD90 ו- CD45 עבור מיון תאים פלואורסצנטיים13,14,25. נמצא כי CD29+CD90+CD45- התא היווה כראוי 80% מכלל התאים, וזה היה מספיק עבור תרבות התא הבאים ומחקר.

במשך עשרות שנים נעשה שימוש נרחב בטיפול במחלות שונות, כגון מחלות מערכת החיסון, מחלות מערכתיות המטולוגיות, סרטן או טראומה. אין ספק, mBMSCs, כתחליף BMSCs, יכול לשמש ככלי בטוח וחזק יותר בטיפול בתאי גזע בשל המאפיינים המעולים שלהם. תרבות התא והתרחבות של mBMSCs, אם כן, להיות חשוב במיוחד כדי לקבל מספר מספיק של תאים לטיפול.

לסיכום, מחקר זה הדגים פרוטוקול מבטיח ואמין כדי לקצור mBMSCs בשפע עם הומוגניות גבוהה ויכולת בידול מרובה בתקופה קצרה של זמן.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

כל המחברים מציינים שאין להם ניגודי אינטרסים.

Acknowledgments

אנו מודים על הסיוע של המעבדה עבור מרכז סטומטולוגיה דיגיטלית ומחקר עבור אנומליות Craniofacial של בית החולים העממי התשיעי של שנגחאי. עבודתו של כתב יד זה נתמכת על ידי מענקים מהקרן הלאומית למדעי הטבע של סין (NSFC) [81570950,81870740,81800949], פסגת שנגחאי & מישור דיסציפלינות, קרן SHIPM-mu ממכון שנגחאי לרפואה מדויקת, בית החולים העממי התשיעי של שנגחאי, בית הספר לרפואה של אוניברסיטת שנגחאי ג'יאו טונג [JC201809], פרויקט התמריצים של צוות חדשנות ברמה גבוהה עבור בית הספר לרפואה של אוניברסיטת ג'יאו טונג בשנגחאי. ואל.ג'יי הוא חוקר של כישרונות רפואיים מצטיינים לנוער, שנגחאי "כוכבים עולים של כישרון רפואי" תוכנית פיתוח נוער ופרויקט "חן שינג" מאוניברסיטת שנגחאי Jiaotong.

Materials

Name Company Catalog Number Comments
0.25% Trypsin-EDTA(1X) Gibco 25200072
10cm culture dish Corning
acutenaculum
Adipogenic differentiation medium Cyagen biosciences inc. MUBMX-90031
Alcian Blue Beyotime Biotechnology
Alizarin red Sigma-Aldrich A5533
Alkaline Phosphatase Color Development Kit Beyotime Biotechnology C3206
alpha-Minimum essential medium GE Healthcare HyClone Cell Culture SH30265.01B
Anti -CollagenII Rabbit pAb Abcam ab34712
Antibodies against CD16/CD32
Antifade Mounting Medium with DAPI Beyotime Biotechnology P0131
APC anti-mouse/rat CD29 Antibody biolegend inc 102215
Biosafety cabinet Esco AC2-4S8-CN
CD45 Monoclonal Antibody (OX1), PE, eBioscience Invitrogen 12-0461-82
CD90.1 (Thy-1.1) Monoclonal Antibody (HIS51), FITC, eBioscience Invitrogen 11-0900-85
Centrifuge cence L500
Chondrogenesis differentiation medium cyagen biosciences inc.
Confocal laser scanning microscope Zeiss LSM880
Countess II FL Automated Cell Counter Invitrogen AMQAF1000
Crystal Violet Staining Solution Beyotime Biotechnology C0121
Fetal Bovine Serum GE Healthcare HyClone Cell Culture SH30084.03
Goat Anti-Rabbit IgG H&L (Alexa Fluor 488) abcam ab150077
Incubator Esco CCL-170B-8
Inverted microscope olympus CKX53
Magzol reagent(Trizol reagent) Magen
micropipettor Eppendorf
Oil Red O
Osteogenic differentiation medium cyagen biosciences inc. MUBMX-90021
Penicillin-Streptomycin Gibco 15070063
Phosphate-buffered saline(1X) Gibco 20012027
PrimeScript RT Master Kit TakaRa Bio Inc RR036A
Proteinase K Sigma-Aldrich P6556
QuickBlock Blocking Buffer Beyotime Biotechnology P0260
scissor
SYBR1 Premix TakaRa Bio Inc
Toluidine Blue Beyotime Biotechnology
Trypan Blue Solution, 0.4% Gibco 15250061

DOWNLOAD MATERIALS LIST

References

  1. Jin, C., et al. Stem cell education for medical students at Tongji University: Primary cell culture and directional differentiation of rat bone marrow mesenchymal stem cells. Biochemistry and Molecular Biology Education. 46, (2), 151-154 (2018).
  2. Chu, D. T., et al. An Update on the Progress of Isolation, Culture, Storage, and Clinical Application of Human Bone Marrow Mesenchymal Stem/Stromal Cells. International Journal of Molecular Sciences. 21, (3), 708 (2020).
  3. Jin, Z., Chen, J., Shu, B., Xiao, Y., Tang, D. Bone mesenchymal stem cell therapy for ovariectomized osteoporotic rats: a systematic review and meta-analysis. BMC Musculoskeleton Disorder. 20, (1), 556 (2019).
  4. Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, (6893), 41-49 (2002).
  5. Musina, R. A., Bekchanova, E. S., Belyavskii, A. V., Sukhikh, G. T. Differentiation potential of mesenchymal stem cells of different origin. Bulletin of Experimental Biology and Medicine. 141, (1), 147-151 (2006).
  6. Lloyd, B., et al. Similarities and differences between porcine mandibular and limb bone marrow mesenchymal stem cells. Archives in Oral Biology. 77, 1-11 (2017).
  7. Zhang, W., et al. Comparison of the use of adipose tissue-derived and bone marrow-derived stem cells for rapid bone regeneration. Journal of Dental Research. 92, (12), 1136-1141 (2013).
  8. Stefanik, D., et al. Disparate osteogenic response of mandible and iliac crest bone marrow stromal cells to pamidronate. Oral Disorders. 14, (5), 465-471 (2008).
  9. Aghaloo, T. L., et al. Osteogenic potential of mandibular vs. long-bone marrow stromal cells. Journal of Dental Research. 89, (11), 1293-1298 (2010).
  10. Kaigler, D., et al. Stem cell therapy for craniofacial bone regeneration: a randomized, controlled feasibility trial. Cell Transplantation. 22, (5), 767-777 (2013).
  11. Li, C., Wang, F., Zhang, R., Qiao, P., Liu, H. Comparison of proliferation and osteogenic differentiation potential of rat mandibular and femoral bone marrow mesenchymal stem cells in vitro. Stem Cells Development. 2020, 1941629 (2020).
  12. Matsubara, T., et al. Alveolar bone marrow as a cell source for regenerative medicine: differences between alveolar and iliac bone marrow stromal cells. Journal of Bone and Mineral Research. 20, (3), 399-409 (2005).
  13. Chan, C. K. F., et al. Identification of the Human Skeletal Stem Cell. Cell. 175, (1), 43-56 (2018).
  14. Bianco, P., Riminucci, M., Gronthos, S., Robey, P. G. Bone marrow stromal stem cells: nature, biology, and potential applications. Stem Cells. 19, (3), 180-192 (2001).
  15. Franken, N. A., Rodermond, H. M., Stap, J., Haveman, J., van Bree, C. Clonogenic assay of cells in vitro. Nature Protocol. 1, (5), 2315-2319 (2006).
  16. Xu, H., et al. Icariin prevents oestrogen deficiency-induced alveolar bone loss through promoting osteogenesis via STAT3. Cell Proliferation. 53, (2), 12743 (2020).
  17. Zhang, P., Wu, Y., Jiang, Z., Jiang, L., Fang, B. Osteogenic response of mesenchymal stem cells to continuous mechanical strain is dependent on ERK1/2-Runx2 signaling. Internation Journal of Molecular Medicine. 29, (6), 1083-1089 (2012).
  18. Zhu, H., et al. A protocol for isolation and culture of mesenchymal stem cells from mouse compact bone. Nature Protocol. 5, (3), 550-560 (2010).
  19. Lach, M. S., et al. Chondrogenic Differentiation of Pluripotent Stem Cells under Controllable Serum-Free Conditions. International Journal of Molecular Sciences. 20, (11), 2711 (2019).
  20. Huang, X., Zhong, L., Hendriks, J., Post, J. N., Karperien, M. The Effects of the WNT-Signaling Modulators BIO and PKF118-310 on the Chondrogenic Differentiation of Human Mesenchymal Stem Cells. International Journal of Molecular Sciences. 19, (2), 561 (2018).
  21. Gale, A. L., Linardi, R. L., McClung, G., Mammone, R. M., Ortved, K. F. Comparison of the Chondrogenic Differentiation Potential of Equine Synovial Membrane-Derived and Bone Marrow-Derived Mesenchymal Stem Cells. Frontiers in Veterinary Sciences. 6, 178 (2019).
  22. Li, X., Zhang, Y., Qi, G. Evaluation of isolation methods and culture conditions for rat bone marrow mesenchymal stem cells. Cytotechnology. 65, (3), 323-334 (2013).
  23. Kagami, H., Agata, H., Tojo, A. Bone marrow stromal cells (bone marrow-derived multipotent mesenchymal stromal cells) for bone tissue engineering: basic science to clinical translation. International Journal of Biochemistry and Cell Biology. 43, (3), 286-289 (2011).
  24. Chamberlain, G., Fox, J., Ashton, B., Middleton, J. Concise review: mesenchymal stem cells: their phenotype, differentiation capacity, immunological features, and potential for homing. Stem Cells. 25, (11), 2739-2749 (2007).
  25. Abdallah, B. M., Alzahrani, A. M., Abdel-Moneim, A. M., Ditzel, N., Kassem, M. A simple and reliable protocol for long-term culture of murine bone marrow stromal(mesenchymal) stem cells that retained their in vitro and in vivo stemness in long-term culture. Biology Proceedings Online. 21, 3 (2019).
בידוד וטיפוח של תאי גזע מסנכימליים במח עצם מנדיבול בחולדות
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).More

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter