Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Isolamento e coltivazione di cellule staminali mesenchimali del midollo osseo mandibolare nei ratti

doi: 10.3791/61532 Published: August 25, 2020
* These authors contributed equally

Summary

Questo articolo presenta un metodo che combina l'aderenza al midollo osseo intero e lo smistamento della citometria del flusso per isolare, coltivare, smistare e identificare le cellule staminali mesenchimali del midollo osseo dalle mattidi di ratto.

Abstract

Qui presentiamo un metodo efficace per isolare e coltivare in vitro cellule staminali mesenchimali del midollo osseo mandibolare (mBMSC) per ottenere rapidamente numerose cellule di alta qualità per esigenze sperimentali. Gli mBMSC potrebbero essere ampiamente utilizzati in applicazioni terapeutiche come cellule di ingegneria tissutale in caso di malattie craniofacciali e rigenerazione cranio-maxillo-facciale in futuro grazie all'eccellente capacità di autorinnoto e al potenziale di differenziazione multi-lignaggio. Pertanto, è importante ottenere mBMSC in gran numero.

In questo studio, il midollo osseo è stato lavato dalla mattiere e i mBMSC primari sono stati isolati attraverso la coltivazione aderente al midollo osseo intero. Inoltre, CD29+CD90+CD45 mBMSC sono stati purificati attraverso lo smistamento delle celle fluorescenti. La seconda generazione di mBMSC purificati è stata utilizzata per ulteriori studi e ha mostrato un potenziale nella differenziazione in osteoblasti, adipociti e condrociti. Utilizzando questo modello in vitro, si può ottenere un elevato numero di mBMSC proliferativi, che possono facilitare lo studio delle caratteristiche biologiche, la successiva reazione al microambiente e altre applicazioni degli mBMSC.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Le cellule staminali mesenchimali del midollo osseo (BMSC) sono cellule staminali non ematopoietiche derivate dal midollo osseo che manifestano una forte capacità di proliferazione e un potenziale di differenziazione multi-lignaggio1,2,3,4. In effetti, i BMSC sono stati considerati un candidato ideale per l'ingegneria e la rigenerazione dei tessuti ossei sin dalla loro scoperta. Per anni, la cresta iliaca o ossa lunghe come la tibia e il femore sono state la fonte più comune di BMSC per la rigenerazione craniofacciale. Tuttavia, i BMSC orofacciali, come i BMSC mandibolari (mBMSC), mostrano alcune differenze rispetto ai BMSC ossei lunghi, come la diversa origine embrionale e il modello di sviluppo. Le manzibole derivano da cellule di cresta neurale dello strato germinale del neuroectoderma e subiscono ossificazione intramembranosa, mentre gli scheletri assiali e appendicolari provengono dal mesoderma e subiscono ossificazione endocondrale. Inoltre, osservazioni cliniche e studi sperimentali su animali hanno costantemente indicato che esistono differenze funzionali tra BMSC a cresta orofacciale e iliaca5,6,7,8. I rapporti hanno dimostrato che i BMSC derivati da ossa craniofacciali come manzibola, osso mascellare e osso alveolare mostravano una capacità di proliferazione, durata della vita e differenziazione superiore rispetto a quelle delle ossa assiali e appendicolari9. Gli mBMSC, quindi, sono considerati le risorse preferite per future applicazioni terapeutiche di malattie craniofacciali come cherubismo, tumore della mascella, osteoporosi dell'osso mascellare e difetto del tessuto parodontale10,11,12. Per comprendere il potenziale di trattamento negli esperimenti preclinici, è essenziale stabilire un metodo per isolare e coltivare rapidamente i mBMSC in vitro.

In questo studio, l'obiettivo era quello di ottenere mBMSC purificati mediante aderenza al midollo osseo intero e smistamento della citometria del flusso. La morfologia anatomica della mavibola del ratto, chiaramente osservata attraverso la microtomografia computerizzata (Micro-CT) e le sezioni istologiche, ha mostrato che l'osso trabecolare della manzibola era tra lo spazio midollare incisivo e l'osso alveolare. Il midollo osseo dall'osso trabecolare è stato lavato per ottenere cellule mandibolari del midollo, ma le cellule coltivate in questo modo non erano mBMSC puri ed erano suscettibili di consistere in più tipi di cellule con potenze incerte e diversi lignaggi come cellule da ossa, grassi e cellule endoteliali13,14. Il passo successivo della purificazione cellulare è stato particolarmente importante. La citometria a flusso filtra le cellule riconoscendo una combinazione di proteine della superficie cellulare ed è stata ampiamente adottata nell'arricchimento delle cellule staminali mesenchimali. L'omogeneità cellulare è il principale vantaggio della citometria del flusso, ma il processo non determina la vitalità cellulare e può comportare una resa cellulare limitata. In questo studio, i MBMSC P0 ottenuti dall'aderenza al midollo osseo intero sono stati ordinati per citometria di flusso per ottenere mBMSC ad alta purezza e forte capacità di proliferazione.

Questo studio introduce un protocollo riproducibile e affidabile per l'isolamento, la coltura e la differenziazione dei BMSC mandibolari del ratto utilizzando una combinazione di aderenza al midollo osseo intero e smistamento della citometria del flusso. È un metodo affidabile e conveniente da utilizzare per i ricercatori nei campi correlati.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tutte le procedure sperimentali sugli animali in questo documento sono state approvate dal Comitato per la cura degli animali del Nono Ospedale Popolare di Shanghai, Shanghai Jiao Tong University School of Medicine.

1. Preparazione

  1. Usa due ratti Sprague Dawley maschi di 5 settimane per l'esperimento.
  2. Sterilizzare tutti gli strumenti, compresi portaaghi, pinzette e forbici ad alta temperatura o immersi nel 75% di etanolo per 10 min.
    NOTA: L'immersione in etanolo non deve essere troppo lunga per evitare danni alle cellule.
  3. Preparare preventivamente i mezzi di coltura, la cui composizione è fornita nella tabella 1. Integrare ogni mezzo come descritto di seguito.
    1. Preparazione di α di coltura α-MEM (con FBS al 10%): Integrare l'alfa medio essenziale minimo (α-MEM) con siero bovino fetale al 10% e 1% di penicillina e streptomicina.
    2. Preparazione del mezzo di differenziazione osteogenica: Supplemento di differenziazione osteogenica mezzo basale con 10% siero bovino fetale, 1% glutammina, 1% penicillina-streptomicina, 0,20% acido ascorbico, 1% β-glicerofosfato e 0,01% desametasone.
    3. Preparazione del mezzo di induzione osteogenica: Mescolare il 70% α-MEM (con 10% FBS) e il 30% di mezzo di differenziazione osteogenica.
    4. Preparazione del mezzo di differenziazione adipogenica A: Supplemento di differenziazione adipogenica mezzo basale con 10% siero bovino fetale, 1% glutammina, 1% penicillina-streptomicina, 0,20% insulina, 0,10% IBMX, 0,10% Rosiglitazone e 0,01% Dexametasone.
    5. Preparazione del mezzo di differenziazione adipogenica B: integrare il mezzo basale di differenziazione adipogenica con il 10% di siero bovino fetale, l'1% di glutammina, l'1% di penicillina-streptomicina e lo 0,20% di insulina.
    6. Preparazione del mezzo di differenziazione condrogenica: Integrare il mezzo basale di differenziazione condrogenica con 0,01% di desametasone, 0,30% acido ascorbico, 1% ITS, 0,10% piruvato di sodio, 0,10% prolina e 1% TGF-β3.
      NOTA: Il mezzo di differenziazione osteogenica deve essere utilizzato entro un mese dalla configurazione. Il periodo effettivo del mezzo di differenziazione condrogenica configurato è di 12 ore.

2. Isolamento e coltivazione di mBMSC di ratto

NOTA: Tutte le operazioni sperimentali devono essere eseguite sul ghiaccio il più possibile per mantenere la vitalità cellulare.

  1. Macibole per topi da raccolta
    1. Eutanasia due ratti maschi di 5 settimane Sprague Dawley per asfissia da CO2. Assicurarsi che la respirazione dell'animale sia interrotta prima di procedere con l'esperimento.
    2. Risciacquare questi ratti in un bicchiere contenente il 75% di etanolo per 3 min.
    3. Posizionare il topo all'interno di una cappa pulita per raccogliere le mattine.
      NOTA: Sterilizzare la cappa dei fumi con radiazioni di luce ultravioletta per 30 minuti prima dell'uso.
    4. Mettere il topo in posizione supina. Incidere le pelli e i muscoli buccinator dall'angulus oris bilaterale alla regione posteriore della mattiera, che è l'unico osso mobile con incisivo inferiore.
      NOTA: Si consiglia di fare un'incisione di 2 cm su ciascun lato dell'angulus oris per ottenere un campo di funzionamento chiaro.
    5. Aprire la bocca del topo spingendo gli incisivi mascellari e mandibolari verso la direzione opposta con entrambi i pollici per esporre i denti mandibolari, che sono attaccati alla mandibola.
    6. Scollegare completamente i muscoli buccali e i tendini attaccati ai coracoidi e al bordo inferiore della mattidibile.
      NOTA: Durante questo passaggio si osserva una maggiore mobilità della mattiere a causa della mancanza di tensione muscolare.
    7. Premere i denti posteriori mandibolari e ruotare avanti e indietro fino a quando i condili su entrambi i lati sono chiaramente esposti.
      NOTA: Questo passaggio viene eseguito per aprire artificialmente la bocca del ratto nella massima misura possibile per dislocare il condilo. La mandibola è collegata al cranio attraverso condili bilaterali, quindi l'esposizione dei condili porta alla disconnessione tra il cranio e la mandibola.
    8. Separa il corpo maribola dal cranio.
    9. Pulire il tessuto molle aderente sulla superficie ossea usando una garza bagnata.
    10. Posizionare l'osso in un piatto di vetro sterile da 10 cm riempito con mezzo-α (α-MEM) o tampone fosfato (PBS) preraffreddato sul ghiaccio per preservare la vitalità.
  2. Isolamento e coltivazione dei mBMSC
    1. Tagliare l'osso anteriore lungo il bordo mesiale del primo molare dal corpo mandibolare. Rimuovere il ramus mandibolare tra cui coracoide e condile lungo il bordo distale del terzo molare per esporre la cavità del midollo.
    2. Riempire un piatto di vetro sterile da 10 cm con 10 mL di α-MEM (con FBS al 10%).
    3. Utilizzare una siringa da 1 ml per aspirare α di coltura mem. Con l'ago della siringa inserito nella cavità del midollo osseo, sciacquare ripetutamente il midollo osseo nel piatto. Sciacquare la cavità ossea almeno 3 volte dai lati mesiali e distale dell'osso, rispettivamente, fino a quando l'osso non è diventato bianco.
      NOTA: Questo è il passaggio più critico, poiché la cavità del midollo osseo di una mavibola del ratto non è così ovvia come nell'osso lungo e il punto corretto per inserire l'ago deve essere determinato empiricamente. Tutti i campioni sperimentali di cui sopra devono essere conservati sul ghiaccio per mantenere la vitalità cellulare e quindi il tempo di funzionamento non deve essere superiore a 2 ore.
    4. Trasferire il supporto contenente le celle lacrettate in un tubo di centrifuga da 15 ml e centrifugare a 800 x g in 4 °C per 5 min. Scartare il supernatante.
    5. Rimorsiva le cellule con 3 mL di α-MEM (con FBS al 10%). Placcare le cellule in un nuovo piatto da coltura di 10 cm e incubare a 37 °C in un incubatore di CO2 al 5%.
    6. Controlla i cambiamenti morfologici e la crescita di queste cellule il 3 ° giorno di coltura. Rimuovere il mezzo di coltura con cellule non arent e frammenti di tessuto. Aggiungere delicatamente 10 mL di α-MEM fresco (con FBS al 10%).
    7. Dopo 7 giorni di cultura, i MBMSC P0 hanno raggiunto la confluenza dal 70% all'80%.
  3. Ordinamento cella di flusso
    NOTA: I MBMSC P0 sono stati identificati fenotipicamente e purificati principalmente attraverso lo smistamento delle celle di flusso.
    1. Aspirare e scartare il mezzo di coltura e quindi lavare il piatto con PBS. Scartare il PBS.
    2. Aggiungere 1 mL di 0,25% di tripside con 0,02% DI EDTA nel piatto. Digerire le cellule a 37 °C per 5 minuti, quindi aggiungere 2 mL di α-MEM (con 10% FBS) per fermare la reazione.
    3. Trasferire la sospensione delle cellule in un tubo di centrifuga da 15 ml e centrifugare a 800 x g per 5 min.
    4. Rimorsiva le cellule in 120 μL di PBS (con FBS al 10%) dopo la centrifugazione.
    5. Bloccare queste sospensioni cellulari con 1 μL di anticorpo contro CD16/CD32 a 4 °C per 15 min.
    6. Trasferire 100 μL della sospensione cellulare in un nuovo tubo di microcentrifugo, macchiare le cellule con anticorpo coniugato di ficoerytrina (PE) contro CD45, anticorpo coniugato fluoresceina-isotiocianato (FITC) contro CD90 e alloficocianina (APC)-anticorpo contro CD29 a 4 °C per 1 h albuio 13,15. La concentrazione di anticorpi utilizzati in questo esperimento è illustrata nella tabella 2. Utilizzare gli altri 20 μL di sospensione cellulare come controllo negativo non macchiato.
    7. Quindi centrifugare i tubi a 800 x g per 5 minuti, scartare la sospensione e rimorsi le celle in 0,5 ml di PBS (con FBS al 10%).
    8. Aggiungere 10 μL di 0,01 mg/mL DAPI per 10 minuti prima dell'analisi.
    9. Utilizzare filtri da 40 nm posizionati su tubi di centrifuga per filtrare le celle.
    10. Analizzare le celle sullo smistatore di celle attivato dalla fluorescenza. Impostare i pannelli come segue. In primo luogo, rimuovere le celle morte dal conteggio totale delle celle gating DAPI- celle, quindi gate CD29+CD90+CD45- nelle celle selezionate come mBMSC mirati.
    11. Raccogliere le celle SMistate CD29+CD90+CD45- in un tubo di centrifuga da 15 ml con 3 ml di α-MEM (con FBS al 10% pre-preparato.
    12. Centrifugare i tubi a 800 x g per 5 min. Rimuovere il buffer di raccolta e aggiungere 1 mL di α-MEM fresco (con FBS al 10%) per rimorsi le celle. Quindi placcarli in un piatto di coltura di 6 cm.

3. Capacità di formazione della colonia

NOTA: questo passaggio è stato eseguito per verificare la capacità di divisione degli mBMSC. 15 di cui: la commissione per i

  1. Selezionate gli mBMSC di secondo passaggio (P2) per questo esperimento. Quando la confluenza cellulare ha raggiunto l'80%-90%, ha reseedato le cellule in un gradiente seriale in una piastra di 6 pozzi per valutare la loro capacità di proliferazione clonale.
    NOTA: Si raccomanda di impostare il gradiente da 1 x 102 a 1 x 103 cellule per pozzo, ma le diluizioni finali di diverse linee cellulari di origine umana o animale sono state determinate empiricamente.
  2. Coltura delle cellule in α-MEM (con FBS al 10%) per circa due settimane fino a quando un buon numero di unità di formazione della colonia poteva essere visto al microscopio leggero. Aggiorna il mezzo cultura ogni 3 giorni.
  3. Aspirare e scartare il mezzo di coltura, lavare i pozzetti con PBS due volte per 5 minuti alla volta. Quindi aggiungere la soluzione di paraformaldeide al 4% ad ogni pozzo e fissare per almeno 10 minuti.
  4. Rimuovere la paraformaldeide e sciacquare i pozzi due volte con PBS.
  5. Macchiare le cellule con soluzione di colorazione viola cristallo e incubarle in 37 °C per circa 10 minuti.
    NOTA: Il tempo di colorazione regolato in modo appropriato fino a raggiungere la tonalità desiderata.
  6. Rimuovere la soluzione di colorazione e lavare i campioni con acqua distillata per interrompere la reazione.
  7. Immagine sotto uno stereomicroscopio e conteggio colonie di cellule sparse che consisteva di almeno 50 cellule.

4. Differenziazione multilinea degli mBMSC

NOTA: I MBMSC P2 sono stati utilizzati per esperimenti successivi, salvo diversa indicazione.

  1. Induzione osteogenica di mBMSC
    1. Digerire gli mBMSC come descritto sopra. Cellule di semi ad una densità di 2,5 x 105/cm2 in una piastra da 12 pozza integrata con 1 mL α-MEM (con FBS al 10%).
    2. Quando la confluenza cellulare ha raggiunto il 60-70%, cambiare il mezzo in 30% di mezzi di induzione osteogenica. Coltura delle cellule con α-MEM (con FBS al 10%) come controllo negativo e cambiare il mezzo ogni 2 giorni.
      NOTA: Dopo che un gran numero di noduli di calcio compaiono durante l'osteogenesi, si consiglia di cambiare il modello di scambio medio in uno scambio medio di mezzo volume ogni 2 giorni, per evitare che gli osteoblasti galleggiano.
    3. Dopo aver coltivato per sette giorni, valutare la calcificazione di queste cellule mediante colorazione fosfatasi alcalina16,17.
    4. Rimuovere il mezzo di coltura e fissare le cellule con paraformaldeide al 4% per 10 minuti. Risciacquare le cellule utilizzando 1 mL di PBS per pozzo per 3 minuti due volte.
    5. Quindi macchiare le cellule con soluzione di colorazione fosfatasi alcalina e incubare a 37 °C per 10-30 min.
      NOTA: L'incubazione può essere eseguita durante la notte a temperatura ambiente per ottenere il colore richiesto.
    6. Lavare i pozzi con acqua distillata per interrompere la reazione. Scatta fotografie al microscopio luminoso. I granuli pigmentati rossi rappresentano l'attività della fosfatasi alcalina (ALP).
    7. Dopo aver coltivato le cellule rimanenti per altri 7 giorni, eseguire la colorazione rossa di alizarina per valutare la capacità di mineralizzazione delle cellule.
    8. Macchiare le cellule con soluzione di colorazione rossa di alizarina allo 0,5% dopo la fissazione cellulare per 10 min16,18. Interrompere la reazione cromogenica con acqua distillata dopo 3-5 minuti.
      NOTA: Il tempo di reazione può essere esteso a seconda del colore sviluppato.
    9. Infine, posizionare la piastra di coltura al microscopio luminoso per osservare l'effetto della colorazione osteogenica; i noduli rossi indicano depositi di calcio di queste cellule.
  2. Induzione adipogenica di mBMSC
    1. Semi P2 mBMSC in una piastra da 12 po', come descritto sopra.
    2. Dopo che il pozzo è diventato confluente al 90%, coltura le cellule con mezzo di differenziazione adipogenica A. Utilizzare cellule coltivate in un mezzo di coltura α-MEM (con FBS al 10%) come controllo negativo.
    3. Dopo 2 giorni di induzione, aspirare il mezzo A dal pozzo e aggiungere 1 mL di mezzo di differenziazione adipogenica B in ogni pozzo.
    4. Dopo un giorno, rimuovere il medio B e ricominciare il ciclo con il mezzo A aggiunto di nuovo nel pozzo. Coltura alternativa delle celle mediante il mezzo A e B.
    5. Applicare alternativamente il mezzo di differenziazione A e B per tre cicli e rilevare l'adipogenesi di queste cellule mediante colorazione O rosso olio16,18.
      NOTA: Molte goccioline lipidiche rotonde e grandi possono essere osservate coltivando queste cellule con mezzo di differenziazione B per altri 2-3 giorni.
    6. Rimuovere il mezzo e fissare le cellule con paraformaldeide al 4% per 10 minuti. Lavare le cellule con PBS.
    7. Macchiare le cellule con olio rosso O soluzione di colorazione e incubare a 37 °C per circa 3 min.
    8. Rimuovere la soluzione di colorazione e lavare i pozzali con acqua distillata.
    9. Osservare l'adipogenesi al microscopio luminoso.
  3. Induzione della condrogenesi dei mBMSC
    1. Semi P2 mBMSC in tubo di centrifuga da 15 mL ad una densità di 5 x 105/cm2.
    2. Centrifugare i tubi a 300 x g per 5 min. Scartare il supernatante.
    3. Rimorsiva le cellule con 0,5 mL di mezzo di differenziazione condrogenica. Centrifugare le cellule a 300 x g per 5 min.
    4. Allentare il tappo del tubo di centrifuga e incubarlo a 37 °C in un incubatore di CO2 al 5%. Rinnovare il mezzo ogni 2 giorni.
      NOTA: Le cellule iniziano a pellettizzazione dopo 24 ore. Si consiglia di non spostare il tubo di centrifuga per 48 ore. Fare attenzione a non aspirare il pellet cellulare quando si cambia il mezzo.
    5. Dopo 21 giorni di induzione, fissare il pellet cellulare con paraformaldeide al 4%, seguito da disidratazione, incorporamento e sessificazione della paraffina.
    6. Dopo la deparaffinizzazione e l'idratazione, macchiare gli scivoli in soluzione blu alciana per almeno15 min 18,19,20,21, quindi lavare con acqua distillata per fermare la reazione. Cattura le fotografie al microscopio luminoso.
    7. Per la colorazione immunofluorescente del collagene di tipo II, eseguire i passaggi seguenti.
      1. Incubare i vetrini con 5 μg/mL proteinasi K per 15 min a 37 °C dopo la fase di deparaffinizzazione e idratazione.
      2. Incubare i vetrini in tampone di blocco per 1 h a 37 °C.
      3. Applicare 1 μL di anticorpo collagene di tipo II in 200 μL di tampone di blocco sulle diapositive e incubare durante la notte a 4 °C.
      4. Il giorno successivo, lavare due volte i vetrini con PBS e incubare con anticorpi secondari a 37 °C per 1 h.
      5. Incubare le fette con 40,6-diamidino-2-fenilindolo (DAPI) per 10 min.
    8. Scatta fotografie di ogni diapositiva sotto microscopia a fluorescenza.

5. PCR in tempo reale

  1. Estrarre l'RNA totale dagli mBMSC utilizzando un reagente disponibile in commercio a base di isotiocianato di guanidio.
  2. Eseguire la trascrizione inversa dell'RNA in DNA complementare utilizzando un kit disponibile in commercio. Le condizioni di reazione della trascrizione inversa erano le seguenti: 65 °C per 5 min, 37 °C per 15 min, 85 °C per 15 s.
  3. Eseguire PCR in tempo reale per rilevare l'osteogenesi e l'adipogenesi di geni specifici utilizzando primer elencati nella tabella 3. La procedura di amplificazione PCR era la seguente: 95 °C per 5 min.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Utilizzando questo protocollo, gran parte delle cellule ha aderito alla piastra il terzo giorno dopo la coltura iniziale. In genere, dopo altri 3-4 giorni di coltura, la confluenza cellulare ha raggiunto il 70-80% (Figura 1B). Con lo smistamento delle celle fluorescenti, DAPI-CD29+CD90+CD45 mBMSC sono statipurificati 18,22, che rappresentavano circa l'81,1% nelle celle P0 (Figura 1C).

Dopo aver seminato P2 mBMSC a 100 cellule in ogni pozzo di 6 piastre per una settimana, è stata osservata una quantità significativa di unità di formazione della colonia, il che ha suggerito la significativa capacità di formazione della colonia di mBMSC (Figura 1D).

Per valutare la capacità di differenziazione multi-lignaggio, gli mBMSC sono stati indotti rispettivamente in lignaggi osteo-, condro e adipo, in 12 piastre di pozzo. Gli mBMSC mostrano una forte capacità di differenziazione osteogenica. L'aumento dell'attività di ALP, i noduli calcificati rossi distribuiti sporadicamente sotto colorazione rossa di alizarina e l'aumento dell'espressione dei geni specifici osteogenici Runx2, Alp, Bsp e Ocn (Figura 2) hanno indicato l'induzione esogenica. Per l'adipogenesi, identificata dalla colorazione Oil-red-O, numerosi vacuoli ricchi di lipidi erano evidenti dopo 9 giorni di induzione. Allo stesso modo, l'espressione di geni specifici adipogenici Pparγ1 e Cebpa ha mostrato un aumento significativo (Figura 3). Per l'osservazione microscopica di diapositive di differenziazione condrogenica, i campioni hanno mostrato colorazione positiva per il blu di Alcian. Inoltre, l'immunosottenzione con anticorpi collagene anti-tipo II ha mostrato un maggiore accumulo di matrice cartilaginea (Figura 4).

Mezzo di coltura componente Concentrazione finale
1.α-MEM (con 10%FBS) α essenziale minimo indispensabile
Siero bovino fetale 10%
Penicillina e streptomicina 1%
2.Mezzo di induzione osteogenica α di cultura mem (con 10%FBS) 70%
Mezzo di differenziazione osteogenica 30%
3.Mezzo di differenziazione osteogenica Differenziazione osteogenica media basale
Siero bovino fetale 10%
glutammina 1%
Penicillina-Streptomicina 1%
acido ascorbico 0.20%
β-glicerofosfato 1%
desametasone 0.01%
4.Mezzo di differenziazione adipogenica A Differenziazione adipogenica del mezzo basale
Siero bovino fetale 10%
glutammina 1%
Penicillina-Streptomicina 1%
insulina 0.20%
IBMX 0.10%
Rosiglitazone 0.10%
desametasone 0.01%
5.Mezzo di differenziazione adipogenica B: Differenziazione adipogenica del mezzo basale
Siero bovino fetale 10%
glutammina 1%
Penicillina-Streptomicina 1%
insulina 0.20%
6.Mezzo di differenziazione condrogenica: Mezzo basiale di differenziazione condrogenesi
desametasone 0.01%
acido ascorbico 0.30%
suo 1%
Piruvato di sodio 0.10%
prolina 0.10%
TGF-β3 1%

Tabella 1: Componenti del mezzo di coltura e del mezzo di differenziazione.

anticorpo concentrazione
CD90.1 (Thy-1.1) Anticorpo monoclonale 0,5 mg/mL
Anticorpo monoclonale CD45 0,2 mg/mL
Anticorpo CD29 0,2 mg/mL
Anticorpo policlonale di coniglio CollagenII 5 mg/mL
Capra Anti-Coniglio IgG H&L (Alexa Fluor® 488) 1 mg/mL

Tabella 2: Concentrazione di anticorpi utilizzata in questo studio.

abbecedario Sequenza (da 5' a 3')
GAPDH Foward: CGGCAAGTTCAACGGCACAGTCAAGG
Rovescio: ACGACATACTCAGCACCAGCATCACC
Runx2 Per il verso: GCCTTCAAGGTTGTAGCCCT
Inverso: TGAACCTGGCCACTTGGTTT
Alp Per il verso: AAACTCGCTTATGGTCCCCG
Inverso: TGGGTTTGAATTCCTGCGGT
Bps Foward: GCACGGTTGAGTATGGGGAA
Rovescio: ATCCTGACCCTCGTAGCCTT
Ocn Avanti:CAACCCCAATTGTGACGAGC
Inverso:GGCAACACATGCCCTAAACG
Cebpa Foward: AGTCGGTGGATAAGAACAGCAACG
Rovescio: CGGTCATTGTCACTGGTCAACTCC
Pparγ1 Foward: CCATCGAGGACATCCAAGACAACC
Inverso: GTGCTCTGTGACAATCTGCCTGAG

Tabella 3: Primer utilizzati nella PCR in tempo reale.

Figure 1
Figura 1: Isolamento e cultura degli mBMSC. (A) Schema del protocollo. Gli mBMSC sono stati isolati e placcati il giorno 0 e incubati con α di coltura mem. Il giorno 7, i MBMSC P0 sono stati purificati attraverso lo smistamento della citometria a flusso e le cellule ordinate sono state placcate su un nuovo piatto di coltura. Il giorno 14, i mBMSC P1 sono stati raccolti e placcati su piastra da 12 pomp porsi. Il giorno 15, i MBMSC P2 sono stati indotti in osteoblasti, cellule adipogeniche e condroblasti sotto il corrispondente mezzo di induzione. (B) Modello schematico del midollo osseo mandibolare del ratto e osservazione microscopica dei P0 mBMSC. (C) Cernita citometrica a flusso dei mBMSC dei ratti. L'analisi della citometria del flusso mostra che queste cellule erano positive per CD29 e CD90, ma negative per CD45, che è congruente con le caratteristiche BMSC. Di questi, sono state ordinate 1,4 x10 6 cellule, che rappresentavano opportunamente l'80% delle cellule totali. (D) Immagine rappresentativa dei cloni mBMSC P2 macchiati di viola cristallo. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: Potenziale di differenziazione osteogenica degli mBMSC. (A) Dopo 7 giorni di induzione osteogenica, è stato visualizzato il cambiamento dell'attività dell'ALP. Un gran numero di noduli mineralizzati sono stati macchiati sotto colorazione rossa di alizarina a 14 giorni dall'induzione della differenziazione osteogenica. (B,C) L'area positiva della colorazione rossa alp e alizarina è stata valutata utilizzando il software Image J. (C-G) L'espressione dell'mRNA dei marcatori specifici degli osteoblasti Runx2, Alp, Bsp e Ocn è aumentata significativamente dopo 7 giorni di osteogenesi. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: Potenziale di differenziazione adipogenica degli mBMSC dopo nove giorni di induzione. (A) Una grande quantità di goccioline lipidiche si formano e gli adipociti sono stati macchiati da olio-rosso-O. (B,C) L'espressione dell'mRNA dei marcatori adipogenici Cebpa e Pparγ1 è aumentata notevolmente dopo 9 giorni di adipogenesi. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4: Vista stereoscopica dell'effetto di differenziazione condrogenica. (A) mBMSC dopo 21 giorni di induzione condrogenica ha mostrato positivo per la colorazione blu alcian. (B) Immagine di immunofluorescenza dell'aggregato condrogenico macchiato di collagene anti-tipo II. Clicca qui per visualizzare una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Questo protocollo descrive un metodo per isolare i BMSC dalle mantidi di ratto in vitro combinando l'aderenza al midollo osseo intero e lo smistamento delle cellule fluorescenti, che è un modo semplice e affidabile per ottenere mBMSC proliferativi con una forte capacità di differenziazione. Questo metodo potrebbe purificare preventivamente gli mBMSC mediante smistamento delle celle di flusso, ma se ci sono requisiti più elevati per l'omogeneità cellulare, possono essere necessari metodi di purificazione più precisi.

Attualmente, esistono quattro tecniche principali utilizzate per isolare gli mBMSC, tra cui l'aderenza al midollo osseo intero, la centrifugazione del gradiente di densità, lo smistamento delle celle fluorescenti e lo smistamento magneticodelle celle attivate 22. L'aderenza al midollo osseo intero e la centrifugazione del gradiente di densità sono i metodi più comuni e facili utilizzati per ottenere mBMSC in breve tempo, tuttavia, la bassa purezza degli mBMSC raccolti è il loro principale svantaggio. Gli ultimi due metodi possono isolare mBMSC altamente purificati attraverso tecniche immunologiche, ma hanno la capacità di essere costosi, di prendere molto tempo e compromettere la vitalità cellulare. In questo studio i vantaggi dell'aderenza al midollo osseo intero e del metodo di cernita delle cellule fluorescenti sono stati combinati per ottenere un numero sufficiente di mBMSC proliferativi in breve tempo.

Senza dubbio, uno dei passaggi più critici di questo protocollo è la dissezione della manzibola del ratto, che è abbastanza distinta da quelle delle ossa assiali e appendicolari. È essenziale comprendere l'anatomia della mattidibola del ratto per ottenere un campione intatto. Simile all'umano, la mandibola del ratto si trova sotto la mascella, tiene i denti inferiori in posizione ed è collegata al cranio da condili bilaterali. Poiché la mattiere è l'unico osso che può muoversi nel cranio, ci sono molti muscoli attaccati alla mattiere, che controllano il suo movimento. Solo rimuovendo completamente questi tessuti molli e volgendo la bocca aperta al massimo possono essere esposti i condili che si collegano con il cranio. Vale anche la pena ricordare che il collo condilare è una debolezza fisica nella mandibola ed è facile da fratturare. Se si riscontra un'eccessiva resistenza quando si ruota la mavibola verso il basso, significa che i muscoli masticatori potrebbero non essere stati completamente rimossi. Quando questo viene osservato, non ruotarlo con tensione, altrimenti è facile rompere il collo condilo portando così alla contaminazione cellulare. Altre difficoltà nella separazione e nella coltura degli mBMSC includono basso contenuto nel midollo osseo, attività cellulare delicata, bassa purezza, bassa frequenza cellulare e contaminazione delle cellule ematopoietiche18,23. Per ottenere mBMSC con una buona crescita e un potenziale di differenziazione relativamente elevato, garantire l'attività degli mBMSC è di fondamentale importanza. Ci sono diversi passaggi chiave, tra cui l'uso di ratti di quattro settimane per questo e esperimenti successivi, poiché i giovani ratti sono preferiti per mantenere una buona vitalità. Molti studi hanno confermato che l'attività degli mBMSC è legata all'età degli animali da esperimento. Gli mBMSC dei donatori più anziani possono comportare una minore attività di proliferazione, un potenziale di differenziazione e una duratadella vita 2. Tutte le operazioni durante la raccolta cellulare devono essere completate sul ghiaccio e il tempo di funzionamento dovrebbe essere il più breve possibile, preferibilmente entro 2 ore. Inoltre, mantenere il tempo di digestione della tripina non più di 3 minuti. Infine, un'altra sfida di questo protocollo è il processo di raccolta degli mBMSC. Può essere fastidioso sciacquare gli mBMSC dalla cavità ossea perché la cavità della mavibola del ratto è molto piccola, quindi è molto importante avere familiarità con la struttura anatomica. Le immagini micro-CT possono essere di grande aiuto in questo senso. Inoltre, vale la pena notare che poiché le ossa giovani sono sottili e fragili, la rottura può causare contaminazione.

Riferendosi alla caratterizzazione immunofenotipica, i BMSC esprimono diversi fenotipi, ma nessuno dei quali è specifico diessi 24. È generalmente accettato che i BMSC non esprima CD11b, CD14, CD34 o CD45, ma hanno un'alta espressione di Sca-1, CD29, CD90 e CD105. Questo studio ha scelto i marcatori ampiamente accettati di CD29, CD90 e CD45 per lo smistamento dellecelle fluorescenti 13,14,25. Ha scoperto che CD29+CD90+CD45− la cellula rappresentava opportunamente l'80% delle cellule totali, il che era sufficiente per la successiva coltura e ricerca cellulare.

Per decenni, la terapia con cellule staminali è ampiamente utilizzata nel trattamento di varie malattie, come malattie del sistema immunitario, malattie sistemiche ematologiche, tumori o traumi. Indubbiamente, gli mBMSC, in sostituzione dei BMSC, possono essere utilizzati come strumento più sicuro e potente nella terapia con cellule staminali grazie alle loro caratteristiche superiori. La coltura cellulare e l'espansione degli mBMSC diventano quindi particolarmente importanti per ottenere un numero sufficiente di cellule per il trattamento.

In sintesi, questo studio ha dimostrato un protocollo promettente e affidabile per raccogliere abbondanti mBMSC con elevata omogeneità e capacità di multi-differenziazione in un breve periodo di tempo.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Tutti gli autori affermano di non avere conflitti di interesse.

Acknowledgments

Ringraziamo per l'assistenza del Laboratorio per la Stomatologia Digitalizzata e il Centro di Ricerca per anomalie craniofacciali dell'ospedale nono popolo di Shanghai. Il lavoro di questo manoscritto è supportato da sovvenzioni della National Natural Science Foundation of China (NSFC) [81570950,81870740,81800949], Shanghai Summit & Plateau Disciplines, il fondo SHIPM-mu dello Shanghai Institute of Precision Medicine, Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine [JC201809], il Progetto incentive del team di innovazione di alto livello per la Shanghai Jiao Tong University School of Medicine. E L.J. è uno studioso dell'Outstanding Youth Medical Talents, del programma di sviluppo giovanile "Rising Stars of Medical Talent" di Shanghai e del progetto "Chen Xing" della Shanghai Jiaotong University.

Materials

Name Company Catalog Number Comments
0.25% Trypsin-EDTA(1X) Gibco 25200072
10cm culture dish Corning
acutenaculum
Adipogenic differentiation medium Cyagen biosciences inc. MUBMX-90031
Alcian Blue Beyotime Biotechnology
Alizarin red Sigma-Aldrich A5533
Alkaline Phosphatase Color Development Kit Beyotime Biotechnology C3206
alpha-Minimum essential medium GE Healthcare HyClone Cell Culture SH30265.01B
Anti -CollagenII Rabbit pAb Abcam ab34712
Antibodies against CD16/CD32
Antifade Mounting Medium with DAPI Beyotime Biotechnology P0131
APC anti-mouse/rat CD29 Antibody biolegend inc 102215
Biosafety cabinet Esco AC2-4S8-CN
CD45 Monoclonal Antibody (OX1), PE, eBioscience Invitrogen 12-0461-82
CD90.1 (Thy-1.1) Monoclonal Antibody (HIS51), FITC, eBioscience Invitrogen 11-0900-85
Centrifuge cence L500
Chondrogenesis differentiation medium cyagen biosciences inc.
Confocal laser scanning microscope Zeiss LSM880
Countess II FL Automated Cell Counter Invitrogen AMQAF1000
Crystal Violet Staining Solution Beyotime Biotechnology C0121
Fetal Bovine Serum GE Healthcare HyClone Cell Culture SH30084.03
Goat Anti-Rabbit IgG H&L (Alexa Fluor 488) abcam ab150077
Incubator Esco CCL-170B-8
Inverted microscope olympus CKX53
Magzol reagent(Trizol reagent) Magen
micropipettor Eppendorf
Oil Red O
Osteogenic differentiation medium cyagen biosciences inc. MUBMX-90021
Penicillin-Streptomycin Gibco 15070063
Phosphate-buffered saline(1X) Gibco 20012027
PrimeScript RT Master Kit TakaRa Bio Inc RR036A
Proteinase K Sigma-Aldrich P6556
QuickBlock Blocking Buffer Beyotime Biotechnology P0260
scissor
SYBR1 Premix TakaRa Bio Inc
Toluidine Blue Beyotime Biotechnology
Trypan Blue Solution, 0.4% Gibco 15250061

DOWNLOAD MATERIALS LIST

References

  1. Jin, C., et al. Stem cell education for medical students at Tongji University: Primary cell culture and directional differentiation of rat bone marrow mesenchymal stem cells. Biochemistry and Molecular Biology Education. 46, (2), 151-154 (2018).
  2. Chu, D. T., et al. An Update on the Progress of Isolation, Culture, Storage, and Clinical Application of Human Bone Marrow Mesenchymal Stem/Stromal Cells. International Journal of Molecular Sciences. 21, (3), 708 (2020).
  3. Jin, Z., Chen, J., Shu, B., Xiao, Y., Tang, D. Bone mesenchymal stem cell therapy for ovariectomized osteoporotic rats: a systematic review and meta-analysis. BMC Musculoskeleton Disorder. 20, (1), 556 (2019).
  4. Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, (6893), 41-49 (2002).
  5. Musina, R. A., Bekchanova, E. S., Belyavskii, A. V., Sukhikh, G. T. Differentiation potential of mesenchymal stem cells of different origin. Bulletin of Experimental Biology and Medicine. 141, (1), 147-151 (2006).
  6. Lloyd, B., et al. Similarities and differences between porcine mandibular and limb bone marrow mesenchymal stem cells. Archives in Oral Biology. 77, 1-11 (2017).
  7. Zhang, W., et al. Comparison of the use of adipose tissue-derived and bone marrow-derived stem cells for rapid bone regeneration. Journal of Dental Research. 92, (12), 1136-1141 (2013).
  8. Stefanik, D., et al. Disparate osteogenic response of mandible and iliac crest bone marrow stromal cells to pamidronate. Oral Disorders. 14, (5), 465-471 (2008).
  9. Aghaloo, T. L., et al. Osteogenic potential of mandibular vs. long-bone marrow stromal cells. Journal of Dental Research. 89, (11), 1293-1298 (2010).
  10. Kaigler, D., et al. Stem cell therapy for craniofacial bone regeneration: a randomized, controlled feasibility trial. Cell Transplantation. 22, (5), 767-777 (2013).
  11. Li, C., Wang, F., Zhang, R., Qiao, P., Liu, H. Comparison of proliferation and osteogenic differentiation potential of rat mandibular and femoral bone marrow mesenchymal stem cells in vitro. Stem Cells Development. 2020, 1941629 (2020).
  12. Matsubara, T., et al. Alveolar bone marrow as a cell source for regenerative medicine: differences between alveolar and iliac bone marrow stromal cells. Journal of Bone and Mineral Research. 20, (3), 399-409 (2005).
  13. Chan, C. K. F., et al. Identification of the Human Skeletal Stem Cell. Cell. 175, (1), 43-56 (2018).
  14. Bianco, P., Riminucci, M., Gronthos, S., Robey, P. G. Bone marrow stromal stem cells: nature, biology, and potential applications. Stem Cells. 19, (3), 180-192 (2001).
  15. Franken, N. A., Rodermond, H. M., Stap, J., Haveman, J., van Bree, C. Clonogenic assay of cells in vitro. Nature Protocol. 1, (5), 2315-2319 (2006).
  16. Xu, H., et al. Icariin prevents oestrogen deficiency-induced alveolar bone loss through promoting osteogenesis via STAT3. Cell Proliferation. 53, (2), 12743 (2020).
  17. Zhang, P., Wu, Y., Jiang, Z., Jiang, L., Fang, B. Osteogenic response of mesenchymal stem cells to continuous mechanical strain is dependent on ERK1/2-Runx2 signaling. Internation Journal of Molecular Medicine. 29, (6), 1083-1089 (2012).
  18. Zhu, H., et al. A protocol for isolation and culture of mesenchymal stem cells from mouse compact bone. Nature Protocol. 5, (3), 550-560 (2010).
  19. Lach, M. S., et al. Chondrogenic Differentiation of Pluripotent Stem Cells under Controllable Serum-Free Conditions. International Journal of Molecular Sciences. 20, (11), 2711 (2019).
  20. Huang, X., Zhong, L., Hendriks, J., Post, J. N., Karperien, M. The Effects of the WNT-Signaling Modulators BIO and PKF118-310 on the Chondrogenic Differentiation of Human Mesenchymal Stem Cells. International Journal of Molecular Sciences. 19, (2), 561 (2018).
  21. Gale, A. L., Linardi, R. L., McClung, G., Mammone, R. M., Ortved, K. F. Comparison of the Chondrogenic Differentiation Potential of Equine Synovial Membrane-Derived and Bone Marrow-Derived Mesenchymal Stem Cells. Frontiers in Veterinary Sciences. 6, 178 (2019).
  22. Li, X., Zhang, Y., Qi, G. Evaluation of isolation methods and culture conditions for rat bone marrow mesenchymal stem cells. Cytotechnology. 65, (3), 323-334 (2013).
  23. Kagami, H., Agata, H., Tojo, A. Bone marrow stromal cells (bone marrow-derived multipotent mesenchymal stromal cells) for bone tissue engineering: basic science to clinical translation. International Journal of Biochemistry and Cell Biology. 43, (3), 286-289 (2011).
  24. Chamberlain, G., Fox, J., Ashton, B., Middleton, J. Concise review: mesenchymal stem cells: their phenotype, differentiation capacity, immunological features, and potential for homing. Stem Cells. 25, (11), 2739-2749 (2007).
  25. Abdallah, B. M., Alzahrani, A. M., Abdel-Moneim, A. M., Ditzel, N., Kassem, M. A simple and reliable protocol for long-term culture of murine bone marrow stromal(mesenchymal) stem cells that retained their in vitro and in vivo stemness in long-term culture. Biology Proceedings Online. 21, 3 (2019).
Isolamento e coltivazione di cellule staminali mesenchimali del midollo osseo mandibolare nei ratti
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).More

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter