Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

عزل وزراعة الخلايا الجذعية النخاعية النخاعية النخاعية في الفئران

doi: 10.3791/61532 Published: August 25, 2020
* These authors contributed equally

Summary

تقدم هذه المقالة طريقة تجمع بين الالتزام بنخاع العظم بالكامل وفرز قياس التدفق الخلوي لعزل الخلايا الجذعية النخاعية النخاعية من الفك السفلي للفئران وزراعةها وفرزها وتحديدها.

Abstract

هنا نقدم طريقة فعالة لعزل وزراعة نخاع العظم الفك السفلي الخلايا الجذعية المتوسطة (mBMSCs) في المختبر للحصول بسرعة على العديد من الخلايا عالية الجودة لمتطلبات تجريبية. يمكن استخدام mBMSCs على نطاق واسع في التطبيقات العلاجية كخلايا هندسية للأنسجة في حالة الأمراض القحفية الوجهية وتجديد الوجه والفكين في المستقبل بسبب القدرة الممتازة على التجديد الذاتي وإمكانات التمايز متعددة النسب. لذلك، من المهم الحصول على mBMSCs بأعداد كبيرة.

في هذه الدراسة، تم مسح نخاع العظام من الفك السفلي وتم عزل mBMSCs الأولية من خلال زراعة نخاع العظم كله. وعلاوة على ذلك، تم تنقية CD29+CD90+CD45- mBMSCs من خلال فرز الخلايا الفلورية. تم استخدام الجيل الثاني من mBMSCs المنقى لمزيد من الدراسة وعرض إمكانات في التفريق إلى الأروميات العظمية، والخلايا الدهنية، وخلايا الشوندروسيتي. وباستخدام هذا النموذج في المختبر، يمكن للمرء أن يحصل على عدد كبير من مركبات MBMSCs التكاثرية، مما قد يسهل دراسة الخصائص البيولوجية، والتفاعل اللاحق مع البيئة الدقيقة، وغيرها من تطبيقات مركبات الكربون الهيدروفلورية.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

نخاع العظم الخلايا الجذعية المتوسطة (BMSCs) هي الخلايا الجذعية غير الموبوائية المستمدة من نخاع العظام التي تظهر قدرة انتشار قوية وتمايز متعدد النسبالمحتملة 1،2،3،4. في الواقع ، تم اعتبار BMSCs كمرشح مثالي لهندسة الأنسجة العظمية وتجديدها منذ اكتشافها. لسنوات، كانت قمة الحرقفي أو العظام الطويلة مثل الساق وعظم الفخذ المصدر الأكثر شيوعا لBMSCs لتجديد القحف الوجهي. ومع ذلك، فإن مركبات BMSCs الأورو-الوجهية، مثل BMSCs الفك السفلي (mBMSCs)، تظهر بعض الاختلافات عن BMSCs العظام الطويلة، مثل الأصل الجنيني المختلف ونمط النمو. تنشأ الفك السفلي من خلايا القمة العصبية للطبقة الجرثومية العصبية وتخضع للتحجر داخل الممبر ، في حين أن الهياكل العظمية المحورية والملحقية هي من mesoderm وتخضع للتحجر الداخلي. وعلاوة على ذلك، أشارت الملاحظات السريرية والدراسات الحيوانية التجريبية باستمرار إلى أن هناك اختلافات وظيفية بين أوروفاسيال و إيلياك كريست BMSCs5،6،7،8. وقد أظهرت التقارير أن BMSCs المستمدة من العظام القحفية الوجهية مثل الفك السفلي، والعظام الفك العلوي، والعظام الحوفية أظهرت انتشار متفوقة، والعمر الافتراضي، والقدرة على التمايز من تلك من العظام المحورية والملحقية9. mBMSCs، لذلك، تعتبر الموارد المفضلة للتطبيقات العلاجية المستقبلية للأمراض القحفية الوجهية مثل الكشمة، ورم الفك، هشاشة العظام الفك، وعيب الأنسجة اللثة10،11،12. لفهم إمكانات العلاج في التجارب ما قبل السريرية، من الضروري إنشاء طريقة لعزل وزراعة mBMSCs بسرعة في المختبر.

في هذه الدراسة، كان الهدف هو الحصول على mBMSCs المنقى عن طريق الالتزام نخاع العظام كله وتدفق فرز الخلايا. أظهر المورفولوجيا التشريحية للفك السفلي للفئران ، التي لوحظت بوضوح من خلال التصوير المقطعي الدقيق (Micro-CT) والأقسام النسيجية ، أن العظم التربيكي للفك السفلي كان بين الفضاء النخاعي القاطع وعظم الحويصلات الهوائية. تم مسح نخاع العظم من العظام الطرية للحصول على خلايا النخاع الفك السفلي ، ولكن الخلايا المستزرعة بهذه الطريقة لم تكن mBMSCs نقية وكان من المرجح أن تتكون من أنواع متعددة من الخلايا ذات الفعالية غير المؤكدة والأناساب المتنوعة مثل الخلايا من خلايا العظام والدهون والخلايا البطانية13،14. وكانت الخطوة التالية لتنقية الخلايا ذات أهمية خاصة. تدفق قياس الخلايا مرشحات الخلايا من خلال التعرف على مزيج من البروتينات سطح الخلية، وقد اعتمدت على نطاق واسع في إثراء الخلايا الجذعية mesenchymal. تجانس الخلية هو الميزة الرئيسية لقياس التدفق الخلوي، ولكن العملية لا تحدد صلاحية الخلية ويمكن أن تؤدي إلى إنتاجية محدودة للخلايا. في هذه الدراسة، تم فرز P0 mBMSCs التي تم الحصول عليها من الالتزام نخاع العظام كله حسب قياس التدفق الخلوي للحصول على mBMSCs مع نقاء عالية وقدرة انتشار قوية.

تقدم هذه الدراسة بروتوكولا قابلا للاستنساخ وموثوقا به للعزلة والثقافة والتمايز بين مركبات BMSC الفك السفلي للفئران باستخدام مزيج من الالتزام بنخاع العظم الكامل وفرز قياس التدفق الخلوي. وهي طريقة موثوقة ومريحة للباحثين في المجالات ذات الصلة لاستخدامها.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

تمت الموافقة على جميع الإجراءات التجريبية الحيوانية في هذه الورقة من قبل لجنة رعاية الحيوان في مستشفى شنغهاي الشعبي التاسع ، كلية الطب بجامعة شنغهاي جياو تونغ.

1. إعداد

  1. استخدام اثنين من الفئران الذكور سبراغ دولي البالغ من العمر 5 أسابيع للتجربة.
  2. تعقيم جميع الأدوات، بما في ذلك حاملي الإبر، ملاقط ومقص في درجة حرارة عالية أو مغمورة في الإيثانول 75٪ لمدة 10 دقيقة.
    ملاحظة: يجب أن لا يكون الغمر الإيثانول طويلة جدا لتجنب تلف الخلايا.
  3. إعداد وسائل الإعلام الثقافية مسبقا، والتي يتم توفير تكوينها في الجدول 1. تكملة كل وسيلة على النحو المبين أدناه.
    1. إعداد α-MEM ثقافة المتوسطة (مع 10٪ FBS): تكملة الحد الأدنى من ألفا المتوسطة الأساسية (α-MEM) مع مصل البقر الجنين 10٪ و 1٪ البنسلين والستريبتوميسين.
    2. إعداد وسيط التمايز العظمي: تكملة التمايز العظمي المتوسط القاعدي مع 10٪ مصل البقر الجنيني، 1٪ الجلوتامين، 1٪ البنسلين-ستريبتوميسين، 0.20٪ حمض الأسكوربيك، 1٪ β-الجليسيروفوسفات و 0.01٪ ديكساميثازون.
    3. إعداد وسيط تحريضي أوستيوجينيك: مزيج 70٪ α-MEM متوسطة الثقافة (مع 10٪ FBS) و 30٪ متوسطة التمايز العظمي.
    4. إعداد التمايز adipogenic المتوسطة A: تكملة التمايز الدهني المتوسط القاعدي مع 10٪ مصل البقر الجنيني، 1٪ الجلوتامين، 1٪ البنسلين-ستريبتومايسين، 0.20٪ الأنسولين، 0.10٪ IBMX، 0.10٪ Rosiglitazone و 0.01٪ ديكساميثازون.
    5. إعداد التمايز adipogenic المتوسطة B: تكملة التمايز الشحمية المتوسط القاعدي مع 10٪ مصل البقر الجنيني، 1٪ الجلوتامين، 1٪ البنسلين-ستريبتومايسين و 0.20٪ الأنسولين.
    6. إعداد وسيط التمايز الدوندروجيني: مكمل التمايز الشوندروجيني المتوسط القاعدي مع 0.01٪ ديكساميثازون، 0.30٪ حمض الأسكوربيك، 1٪ ITS، 0.10٪ بيروفاتي الصوديوم، 0.10٪ برولين و 1٪ TGF-β3.
      ملاحظة: يجب استخدام وسيطة التمايز العظمية في غضون شهر بعد التكوين. الفترة الفعالة للوسط التمايز التشوندروجيني المكونة هي 12 ساعة.

2. عزل وزراعة mBMSCs الفئران

ملاحظة: يجب إجراء جميع العمليات التجريبية على الجليد قدر الإمكان للحفاظ على صلاحية الخلية.

  1. حصاد الفك السفلي للفئران
    1. قتل اثنين من الفئران الذكور سبراغ دولي البالغ من العمر 5 أسابيع عن طريق الاختناق CO2. تأكد من توقف تنفس الحيوان قبل الشروع في التجربة.
    2. شطف هذه الفئران في كوب يحتوي على 75٪ الإيثانول لمدة 3 دقائق.
    3. ضع الجرذ داخل غطاء دخان نظيف لحصاد الفك السفلي.
      ملاحظة: تعقيم غطاء الدخان بالأشعة فوق البنفسجية لمدة 30 دقيقة قبل الاستخدام.
    4. ضع الجرذ في وضع ية انسي الجلود والعضلات buccinator من أورة الangulus الثنائية إلى المنطقة الخلفية من الفك السفلي، وهو العظام المنقولة الوحيدة مع القواطع أقل.
      ملاحظة: من المستحسن إجراء شق 2 سم على كل جانب من أوريس الangulus للحصول على حقل عملية واضحة.
    5. فتح فم الجرذ عن طريق دفع القواطع الفك العلوي والفك السفلي نحو الاتجاه المعاكس مع كل من الإبهام لفضح الأسنان الفك السفلي، والتي تعلق على الفك السفلي.
    6. قطع تماما عضلات البوكال والأوتار تعلق على الكوراكويدات والحدود السفلية من الفك السفلي.
      ملاحظة: لوحظ زيادة حركة الفك السفلي خلال هذه الخطوة بسبب عدم وجود توتر في العضلات.
    7. اضغط على الأسنان الخلفية الفك السفلي وتدوير الظهر والهبوط حتى يتم كشف condyles على كلا الجانبين بشكل واضح.
      ملاحظة: يتم تنفيذ هذه الخطوة لفتح الفم اصطناعيا من الفئران إلى أقصى حد ممكن لخلع condyle. يتم توصيل الفك السفلي إلى الجمجمة من خلال condyles الثنائية، وبالتالي فإن التعرض للcondyles يؤدي إلى انقطاع بين الجمجمة والفك السفلي.
    8. فصل الجسم الفك السفلي من الجمجمة.
    9. تنظيف الأنسجة الرخوة الملتصقة على سطح العظام باستخدام شاش الرطب.
    10. ضع العظم في طبق زجاجي معقم 10 سم مملوء بالحد الأدنى من α المتوسطة الأساسية (α-MEM) أو محلول ملحي عازل للفوسفات (PBS) على الجليد للحفاظ على الجدوى.
  2. عزل وزراعة mBMSCs
    1. قطع العظام الأمامية على طول الحافة السطولية الأولى من الجسم الفك السفلي. إزالة الراموس الفك السفلي بما في ذلك الكوراكويد وال condyle على طول الحافة البعيدة من الضرس الثالث لفضح تجويف النخاع.
    2. ملء طبق زجاجي معقم 10 سم مع 10 مل من α-MEM (مع 10٪ FBS).
    3. استخدام حقنة 1 مل لتنشق α-MEM الثقافة المتوسطة. مع إبرة حقنة إدراجها في تجويف نخاع العظام، وتدفق مرارا وتكرارا نخاع العظام في الطبق. قم بغسل تجويف العظام 3 مرات على الأقل من جانبي العظم السطالي والقاصي على التوالي، حتى تحول العظم إلى اللون الأبيض.
      ملاحظة: هذه هي الخطوة الأكثر أهمية، كما تجويف نخاع العظم من الفك السفلي الفئران ليست واضحة كما هو الحال في العظام الطويلة والنقطة المناسبة لإدراج الإبرة يحتاج إلى تحديد تجريبيا. يجب تخزين جميع العينات التجريبية أعلاه على الجليد للحفاظ على صلاحية الخلية وبالتالي يجب ألا يزيد وقت التشغيل عن 2 ساعة.
    4. نقل الوسائط التي تحتوي على الخلايا المتدفقة إلى أنبوب طرد مركزي سعة 15 مل وطارد مركزي عند 800 × ز في 4 درجات مئوية لمدة 5 دقائق. تجاهل الناتنات الفائق.
    5. إعادة إنفاق الخلايا مع 3 مل من α-MEM (مع 10٪ FBS). صفيح الخلايا في طبق ثقافة جديد 10 سم واحتضان في 37 درجة مئوية في حاضنة5٪ CO 2.
    6. تحقق من التغيرات المورفولوجية ونمو هذه الخلايا في اليوم الثالث من الثقافة. إزالة وسيطة الثقافة مع الخلايا غير المضاد وشظايا الأنسجة. أضف بلطف 10 مل من α-MEM الطازجة (مع 10٪ FBS).
    7. بعد 7 أيام من الثقافة، وصلت P0 mBMSCs 70٪ إلى 80٪ التقاء.
  3. فرز خلايا التدفق
    ملاحظة: P0 mBMSCs تم تحديدها بشكل منوم وتنقيتها في المقام الأول من خلال فرز الخلايا التدفق.
    1. اسبيرات وتجاهل ثقافة المتوسطة ومن ثم غسل الطبق مع برنامج تلفزيوني. تجاهل برنامج تلفزيوني.
    2. إضافة 1 مل من 0.25٪ تريبسين مع 0.02٪ EDTA في الطبق. هضم الخلايا في 37 درجة مئوية لمدة 5 دقائق، ثم إضافة 2 مل من α-MEM (مع 10٪ FBS) لوقف رد الفعل.
    3. نقل تعليق الخلايا إلى أنبوب الطرد المركزي 15 مل والطرد المركزي في 800 × ز لمدة 5 دقائق.
    4. إعادة تثبيت الخلايا في 120 ميكرولتر من برنامج تلفزيوني (مع 10٪ FBS) بعد الطرد المركزي.
    5. منع هذه تعليق الخلية مع 1 ميكرولتر من الأجسام المضادة ضد CD16/CD32 في 4 درجة مئوية لمدة 15 دقيقة.
    6. نقل 100 ميكرولتر من تعليق الخلية إلى أنبوب جديد للطرد المركزي الدقيق، وصمة عار الخلايا مع فيكوريثرين (PE) - الأجسام المضادة المقترنة ضد CD45، الفلورسين-ايزوثيوسيانات (FITC) - الأجسام المضادة المقترنة ضد CD90 والوفيكوسيانين (APC) - الأجسام المضادة ضد CD29 في 4 درجة مئوية لمدة 1 ساعة فيالظلام 13،15. يظهر تركيز الأجسام المضادة المستخدمة في هذه التجربة في الجدول 2. استخدام 20 ميكرولتر أخرى من تعليق الخلية كتحكم سلبي غير ملطخة.
    7. ثم الطرد المركزي أنابيب في 800 × ز لمدة 5 دقائق، والتخلص من تعليق، وإعادة إنفاق الخلايا في 0.5 مل من برنامج تلفزيوني (مع 10٪ FBS).
    8. أضف 10 ميكرولتر من 0.01 ملغم/مل DAPI لمدة 10 دقائق قبل التحليل.
    9. استخدام مرشحات 40 نانومتر وضعت على أنابيب الطرد المركزي لتصفية الخلايا.
    10. تحليل الخلايا على مضان تنشيط الخلية الفرز. تعيين لوحات على النحو التالي. أولا، إزالة الخلايا الميتة من إجمالي عدد الخلايا عن طريق gating DAPI- الخلايا، ثم بوابة CD29+CD90+CD45- في الخلايا المحددة كما mBMSCs المستهدفة.
    11. جمع CD29 فرز+CD90+CD45- الخلايا في أنبوب الطرد المركزي 15 مل مع 3 مل من α-MEM (مع 10٪ FBS) معدة مسبقا.
    12. أجهزة الطرد المركزي الأنابيب في 800 × ز لمدة 5 دقائق. إزالة المخزن المؤقت للمجموعة وإضافة 1 مل من α-MEM الطازجة (مع 10٪ FBS) لإعادة إنفاق الخلايا. ثم طبق لهم في طبق ثقافة 6 سم.

3. قدرة تشكيل مستعمرة

ملاحظة: تم تنفيذ هذه الخطوة للتحقق من قدرة القسمة mBMSCs. 15

  1. حدد mBMSCs المرور الثاني (P2) لهذه التجربة. عندما وصل التقاء الخلية إلى 80٪ إلى 90٪، أعاد صياغة الخلايا في تدرج تسلسلي في لوحة بئر 6 لتقييم قدرتها على الانتشار اللاستنساخي.
    ملاحظة: يوصى بتعيين التدرج من 1 × 102 إلى 1 × 103 خلايا لكل بئر ، ولكن تم تحديد التمييع النهائي لخطوط الخلايا المختلفة ذات الأصل البشري أو الحيواني تجريبيا.
  2. ثقافة الخلايا في α-MEM (مع 10٪ FBS) لمدة أسبوعين تقريبا حتى يمكن رؤية عدد لا جيد من وحدات تشكيل المستعمرة تحت المجهر الخفيف. تحديث الثقافة المتوسطة كل 3 أيام.
  3. أسبيرات وتجاهل ثقافة المتوسطة، وغسل الآبار مع برنامج تلفزيوني مرتين لمدة 5 دقائق في وقت واحد. بعد ذلك إضافة 4٪ حل paraformaldehyde لكل بئر وإصلاح لمدة 10 دقيقة على الأقل.
  4. إزالة البارافورمالديهايد وشطف الآبار مرتين مع برنامج تلفزيوني.
  5. وصمة عار الخلايا مع الكريستال البنفسجي تلطيخ الحل واحتضانها في 37 درجة مئوية لمدة 10 دقيقة تقريبا.
    ملاحظة: وقت تلطيخ تعديلها بشكل مناسب حتى يتم تحقيق الظل المطلوب.
  6. إزالة محلول تلطيخ وغسل العينات بالماء المقطر لوقف رد الفعل.
  7. صورة تحت منظار مجسم وعدد مستعمرات الخلايا المتناثرة التي تتكون من 50 خلية على الأقل.

4. التمايز متعدد الخطوط من mBMSCs

ملاحظة: استخدمت مركبات P2 mBMSCs للتجارب اللاحقة ما لم يتم وصف خلاف ذلك.

  1. تحريض العظام من mBMSCs
    1. هضم mBMSCs كما هو موضح أعلاه. خلايا البذور في كثافة 2.5 × 105/ سم2 في لوحة بئر 12 تستكمل مع 1 مل α-MEM (مع 10٪ FBS).
    2. عندما وصل التقاء الخلية إلى 60-70٪، قم بتغيير الوسط إلى وسائط تحريضية 30٪ من العظام. ثقافة الخلايا مع α-MEM (مع 10٪ FBS) كعنصر تحكم سلبي وتغيير الوسط كل يومين.
      ملاحظة: بعد ظهور عدد كبير من عقيدات الكالسيوم أثناء تكوين العظام ، يوصى بتغيير نمط التبادل المتوسط إلى نصف حجم تبادل متوسط كل يومين ، لمنع الأروميات العظمية من الطفو.
    3. بعد زراعة لمدة سبعة أيام، وتقييم تكلس هذه الخلايا عن طريق الفوسفاتاز القلويةتلطيخ 16،17.
    4. إزالة ثقافة المتوسطة وإصلاح الخلايا مع 4٪ بارافورمالديهايد لمدة 10 دقيقة. شطف الخلايا باستخدام 1 مل من برنامج تلفزيوني لكل بئر لمدة 3 دقائق مرتين.
    5. ثم وصمة عار الخلايا مع محلول تلطيخ الفوسفاتاز القلوية واحتضان في 37 درجة مئوية لمدة 10-30 دقيقة.
      ملاحظة: يمكن إجراء الحضانة بين عشية وضحاها في درجة حرارة الغرفة للحصول على اللون المطلوب.
    6. غسل الآبار بالماء المقطر لوقف رد الفعل. التقط صورا تحت المجهر الخفيف. الحبيبات الحمراء المصطبغة تمثل نشاط الفوسفاتاز القلوية (ALP).
    7. بعد زراعة الخلايا المتبقية لمدة 7 أيام أخرى ، قم بإجراء تلطيخ أحمر أليسارين لتقييم قدرة التمعدن للخلايا.
    8. وصمة عار الخلايا مع 0.5٪ alizarin الأحمر تلطيخ الحل بعد تثبيت الخلية لمدة 10 دقيقة16,18. وقف رد فعل كروموجينيك مع الماء المقطر بعد 3-5 دقائق.
      ملاحظة: يمكن تمديد وقت التفاعل اعتمادا على اللون الذي تم تطويره.
    9. وأخيرا، ضع لوحة الثقافة تحت المجهر الخفيف لمراقبة تأثير تلطيخ العظام. العقيدات الحمراء تشير إلى رواسب الكالسيوم من هذه الخلايا.
  2. تحريض الدهون من mBMSCs
    1. البذور P2 mBMSCs في لوحة بئر 12 كما هو موضح أعلاه.
    2. بعد أن تصبح جيدا التقاء 90٪، والثقافة الخلايا مع التمايز adipogenic متوسطة A. استخدام الخلايا المستزرعة في المتوسط ثقافة α-MEM (مع 10٪ FBS) والسيطرة السلبية.
    3. بعد 2 أيام من التعريفي، يستنشق المتوسط A من البئر وإضافة 1 مل من التمايز adipogenic متوسطة B في كل بئر.
    4. بعد يوم واحد، إزالة متوسطة B وبدء دورة مرة أخرى مع المتوسطة A وأضاف مرة أخرى إلى البئر. ثقافة الخلايا بالتناوب باستخدام المتوسطة A و B.
    5. تطبيق التمايز المتوسطة A و B بالتناوب لثلاث دورات والكشف عن تولد هذه الخلايا عن طريق النفط الأحمر Oتلطيخ 16،18.
      ملاحظة: يمكن ملاحظة الكثير من قطرات الدهون المستديرة والكبيرة عن طريق زراعة هذه الخلايا مع التمايز المتوسط B لمدة 2 إلى 3 أيام إضافية.
    6. إزالة المتوسطة وإصلاح الخلايا مع 4٪ بارافورمالديهايد لمدة 10 دقيقة. غسل الخلايا مع برنامج تلفزيوني.
    7. وصمة عار الخلايا مع النفط الأحمر O تلطيخ الحل واحتضان في 37 درجة مئوية لمدة 3 دقائق تقريبا.
    8. إزالة محلول تلطيخ وغسل الآبار بالماء المقطر.
    9. مراقبة تولد الدهون تحت المجهر الخفيف.
  3. تحريض تولد التشندروجين من mBMSCs
    1. البذور P2 mBMSCs في أنبوب الطرد المركزي 15 مل في كثافة 5 × 105/ سم2.
    2. طاردة مركزية الأنابيب في 300 س ز لمدة 5 دقائق. تجاهل الناتنات الفائق.
    3. Resuspend الخلايا مع 0.5 مل من التمايز التشندروجيني المتوسطة. الطرد المركزي الخلايا في 300 × ز لمدة 5 دقائق.
    4. تخفيف سقف أنبوب الطرد المركزي واحتضانه عند 37 درجة مئوية فيحاضنة ثاني أكسيد الكربون 5٪. تجديد المتوسطة كل يومين.
      ملاحظة: تبدأ الخلايا بيليه بعد 24 ساعة. من المستحسن عدم تحريك أنبوب الطرد المركزي لمدة 48 ساعة. يجب الحرص على عدم يستنشق بيليه الخلية عند تغيير المتوسطة.
    5. بعد 21 يوما من الحث، قم بإصلاح الكريات الخلية مع 4٪ بارافورمالديهايد، تليها الجفاف، وتضمين البارافين والقسم.
    6. بعد إزالة الترطيب والترطيب، قم بوصم الشرائح في محلول Alcian الأزرق لمدة 15 دقيقة على الأقل18،19،20،21، ثم اغسل بالماء المقطر لوقف رد الفعل. التقط الصور تحت المجهر الخفيف.
    7. لتلطيخ immunofluorescent من نوع الكولاجين الثاني، قم بإجراء الخطوات أدناه.
      1. احتضان الشرائح مع 5 ميكروغرام / مل بروتيناز K لمدة 15 دقيقة في 37 درجة مئوية بعد خطوة إزالة الترطيب والترطيب.
      2. احتضان الشرائح في حظر العازلة لمدة 1 ساعة في 37 درجة مئوية.
      3. تطبيق 1 ميكرولتر من الكولاجين نوع الثاني الأجسام المضادة في 200 ميكرولتر من العازلة حجب على الشرائح واحتضان بين عشية وضحاها في 4 درجة مئوية.
      4. في اليوم التالي، اغسل الشرائح مع برنامج تلفزيوني مرتين واحتضن مع الأجسام المضادة الثانوية في 37 درجة مئوية لمدة 1 ساعة.
      5. احتضان شرائح مع 40،6-diamidino-2-phenylindole (DAPI) لمدة 10 دقائق.
    8. التقط صورا فوتوغرافية لكل شرائح تحت المجهر الفلوري.

5. في الوقت الحقيقي PCR

  1. استخراج إجمالي الحمض النووي الريبي من mBMSCs باستخدام ايزوثيوسيانات guanidium على أساس كاشف المتاحة تجاريا.
  2. إجراء النسخ العكسي من الحمض النووي الريبي في الحمض النووي التكميلي باستخدام عدة المتاحة تجاريا. وكانت ظروف رد الفعل للنسخ العكسي كما يلي: 65 درجة مئوية لمدة 5 دقائق، 37 درجة مئوية لمدة 15 دقيقة، 85 درجة مئوية لمدة 15 s.
  3. إجراء PCR في الوقت الحقيقي للكشف عن تكوين العظام وتولد الدهون جينات محددة باستخدام التمهيديات المدرجة في الجدول 3. وكان إجراء تضخيم PCR على النحو التالي: 95 درجة مئوية لمدة 5 دقائق.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

باستخدام هذا البروتوكول، انضمت نسبة كبيرة من الخلايا إلى اللوحة في اليوم الثالث بعد الثقافة الأولية. عادة، بعد 3-4 أيام إضافية من الثقافة، وصل التقاء الخلية إلى 70 إلى 80٪(الشكل 1B). مع فرز الخلايا الفلورية، تم تنقية DAPI-CD29+CD90+CD45- mBMSCs18،22، والتي شكلت حوالي 81.1٪ في خلايا P0 (الشكل 1C).

بعد البذر P2 mBMSCs في 100 خلية في كل بئر من 6 لوحة بئر لمدة أسبوع، لوحظ كمية كبيرة من وحدات تشكيل مستعمرة، مما يشير إلى قدرة كبيرة على تشكيل مستعمرة mBMSCs (الشكل 1D).

ولتقييم قدرة التمايز المتعدد النسب، تم حث مركبات mBMSCs على أنساب العظام وال شوندرو والاديبو، على التوالي، في 12 لوحة بئر. وأظهرت أجهزة mBMSCs قدرة قوية على التمايز العظمي. زيادة نشاط ALP، العقيدات الكالسيوم الحمراء موزعة بشكل متقطع تحت تلطيخ أحمر alizarin، وزيادة التعبير عن الجينات الخاصة osteogenic Runx2، ألب، Bsp وOcn (الشكل 2) وأشار التعريفي oestogenic. ل adipogenesis، التي تم تحديدها من قبل النفط الأحمر-O تلطيخ، العديد من vacuoles الغنية بالدهون كانت واضحة بعد 9 أيام من التعريفي. وبالمثل، أظهر التعبير عن الجينات المحددة adipogenic Pparγ1 و Cebpa زيادة كبيرة(الشكل 3). للمراقبة المجهرية لشرائح التمايز التشندرية ، أظهرت العينات تلطيخا إيجابيا للأزرق الألسي. وبالإضافة إلى ذلك، أظهر التأثثيد المناعي مع مضاد الكولاجين الثاني من النوع الثاني تراكما معززا لمصفوفة الغضاريف(الشكل 4).

الثقافة المتوسطة مكون التركيز النهائي
1.α-MEM متوسطة الثقافة (مع 10٪ FBS) α الحد الأدنى من المتوسطة الأساسية
مصل الأبقار الجنينية 10%
البنسلين والستريبتوميسين 1%
2.Osteogenic التعريفي المتوسطة α-MEM متوسطة الثقافة (مع 10٪FBS) 70%
تمايز العظام المتوسطة 30%
3.Osteogenic التمايز المتوسطة التمايز العظمي المتوسط القاعدي
مصل الأبقار الجنينية 10%
الجلوتامين 1%
البنسلين ستربتوميسين 1%
حمض الأسكوربيك 0.20%
β-غليسيروسفات 1%
ديكساميثازون 0.01%
4.Adipogenic التمايز المتوسطة A التمايز الشحمية المتوسطة القاعدية
مصل الأبقار الجنينية 10%
الجلوتامين 1%
البنسلين ستربتوميسين 1%
إنسولين 0.20%
آي بي إم إكس 0.10%
روزيجليتازون 0.10%
ديكساميثازون 0.01%
5.Adipogenic التمايز المتوسطة B: التمايز الشحمية المتوسطة القاعدية
مصل الأبقار الجنينية 10%
الجلوتامين 1%
البنسلين ستربتوميسين 1%
إنسولين 0.20%
6.Chondrogenic التمايز المتوسطة: تمايز التمايز التشوندروجيني المتوسط القاعدي
ديكساميثازون 0.01%
حمض الأسكوربيك 0.30%
ITS 1%
بيروفات الصوديوم 0.10%
برولين 0.10%
TGF-β3 1%

الجدول 1: مكونات الثقافة المتوسطة والوسط التفاضلي.

جسم تركيز
CD90.1 (Thy-1.1) الأجسام المضادة أحادية النسيلة 0.5 ملغ/مل
CD45 الأجسام المضادة أحادية النسيلة 0.2 ملغم/مل
الأجسام المضادة CD29 0.2 ملغم/مل
كولاجيني أرنب جسم مضاد متعدد النسيلة 5 ملغم/مل
الماعز المضادة الأرنب IgG H &؛ L (اليكسا فلور® 488) 1 ملغم/مل

الجدول 2: تركيز الأجسام المضادة المستخدمة في هذه الدراسة.

التمهيدي تسلسل(5' إلى 3')
GAPDH فوارد: كجكاغاغكاجاكاغجاج
عكس: أكاكاتاكتكاغاكاكاكاكاتاكاك
Runx2 فوارد: مجلس التعاون الخليجي
عكس: TGAACCTGGCCACTTTTT
ALP فوارد: AAACTCGCTTATGGCCG
عكس: TGGGTTGAATTCCTGCGGT
BPS فوارد: جياكغاتغاغاتغغاغا
عكس: ATCCTGACCCTCGTAGCCTT
أوسن إلى الأمام:كاكاكااتجتغاغاغاغاغك
عكس: GGCAACACATGCCCTAACG
سيبا فوارد: أغتكغاتاغاغاغاغاكاغاكاج
عكس: CGGTCATTGTCACTGGTCAACTCC
ببارك1 فوارد: CCATCGAGAACATCCAAGACAACC
عكس: GTGCTCTGTGAكاتCTCTCTGAG

الجدول 3: التهيئة المستخدمة في الوقت الحقيقي PCR.

Figure 1
الشكل 1: عزل وثقافة الشركات المتوسطة والكمبية. (أ) مخطط تخطيطي للبروتوكول. تم عزل mBMSCs ومطلية في اليوم 0 واحتضانها مع α-MEM المتوسطة الثقافة. في اليوم السابع، تم تنقية P0 mBMSCs من خلال فرز قياس التدفق الخلوي وتم طلاء الخلايا المفرزة على طبق ثقافة جديد. في اليوم 14، تم جمع P1 mBMSCs والطلاء على لوحة من 12 بئرا. في اليوم 15، تم حث P2 mBMSCs في الخلايا العظمية والخلايا الدهنية و chondroblasts تحت وسيط التعريفي المقابلة. (ب) نموذج تخطيطي لنخاع العظم الفك السفلي للفئران والمراقبة المجهرية ل P0 mBMSCs. (ج)تدفق الخلايا فرز mBMSCs الفئران. يظهر تحليل قياس التدفق الخلوي أن هذه الخلايا كانت إيجابية ل CD29 و CD90 ، ولكنها سلبية بالنسبة ل CD45 ، وهو ما يتوافق مع خصائص BMSC. من هذه، تم فرز 1.4 ×10 6 خلايا، والتي شكلت بشكل مناسب 80٪ من إجمالي الخلايا. (D) صورة تمثيلية من الكريستال البنفسجي الملون P2 mBMSC استنساخ. يرجى النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 2
الشكل 2: إمكانات التمايز العظمي لمركبات mBMSCs. (أ)بعد 7 أيام من تحريض osteogenic، تم تصور تغيير نشاط ALP. وكانت أعداد كبيرة من العقيدات المعدنية ملطخة تحت تلطيخ أحمر أليسارين في 14 يوما بعد تحريض التمايز العظمي. (B, C) تم تقييم المنطقة الإيجابية من ALP وتلطيخ أحمر alizarin باستخدام برنامج Image J. (C-G) التعبير مرنا من علامات خاصة بالعظام Runx2، ألب، Bsp وOcn زادت بشكل ملحوظ بعد 7 أيام من تكوين العظام. يرجى النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 3
الشكل 3: إمكانات التمايز الشحمية لمركبات mBMSCs بعد تسعة أيام من الحث. (أ)كمية كبيرة من شكل قطرات الدهون وddipocytes ملطخة بالنفط الأحمر س. (B, C) التعبير ميرنا علامات أديبوجينيك سيبا وPparγ1 زيادة ملحوظة بعد 9 أيام من تولد الدهون. يرجى النقر هنا لعرض نسخة أكبر من هذا الرقم.

Figure 4
الشكل 4: عرض مجسم لتأثير التمايز التشندروجيني. (أ)mBMSCs بعد 21 أيام chondrogenic التعريفي أظهرت إيجابية لتلطيخ الأزرق الألسيان. (ب) صورة immunofluorescence من مجموع التشوندروجيني ملطخة الكولاجين المضادة للنوع الثاني. يرجى النقر هنا لعرض نسخة أكبر من هذا الرقم.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

يصف هذا البروتوكول طريقة لعزل BMSCs من الفك السفلي للفئران في المختبر من خلال الجمع بين الالتزام بنخاع العظم الكامل وفرز الخلايا الفلورية ، وهي طريقة بسيطة وموثوقة للحصول على mBMSCs التكاثرية بقدرة تمييز قوية. يمكن لهذه الطريقة تنقية mBMSCs بشكل أولي عن طريق فرز خلايا التدفق ، ولكن إذا كانت هناك متطلبات أعلى لتجانس الخلايا ، فقد تكون هناك حاجة إلى طرق تنقية أكثر دقة.

حاليا، هناك أربع تقنيات رئيسية تستخدم لعزل mBMSCs، بما في ذلك الالتزام نخاع العظام كله، والطرد المركزي الانحدار الكثافة، وفرز الخلايا الفلورية والخلايا المغناطيسية تنشيط فرز22. ويعد الالتزام بنخاع العظم بالكامل والطرد المركزي المتدرجة للكثافة أكثر الطرق شيوعا وسهولة في الحصول على مركبات mBMSCs في وقت قصير، ومع ذلك، فإن النقاء المنخفض لمركبات mBMSCs المحصودة هو عيبها الرئيسي. يمكن أن تعزل الطريقتان الأخيرتان mBMSCs شديدة النقاء من خلال التقنيات المناعية ، ولكن لديهما عيوب في كونها مكلفة ، و تستغرق وقتا طويلا وضعف قدرة الخلية على البقاء. في هذه الدراسة تم الجمع بين مزايا الالتزام بنخاع العظم كله وطريقة فرز الخلايا الفلورية للحصول على أعداد كافية من mBMSCs التكاثرية في وقت قصير.

مما لا شك فيه، واحدة من أهم الخطوات في هذا البروتوكول هو تشريح الفك السفلي الفئران، والتي هي متميزة تماما عن تلك العظام المحورية والملحقية. من الضروري فهم تشريح الفك السفلي للفئران للحصول على عينة سليمة. على غرار الإنسان ، يجلس الفك السفلي للفئران تحت الفك العلوي ، ويحمل الأسنان السفلية في مكانه ويرتبط بالجمجمة بواسطة condyles ثنائية. وبما أن الفك السفلي هو العظم الوحيد الذي يمكن أن يتحرك في الجمجمة ، فهناك العديد من العضلات المرتبطة بالفك السفلي ، والتي تتحكم في حركته. فقط عن طريق إزالة هذه الأنسجة الرخوة تماما وتحويل الفم مفتوحة إلى أقصى حد يمكن أن يتعرض condyles الاتصال مع الجمجمة. ومن الجدير بالذكر أيضا أن الرقبة condylar هو ضعف مادي في الفك السفلي وسهلة لكسر. إذا تم العثور على مقاومة مفرطة عند تدوير الفك السفلي إلى الأسفل، فهذا يعني أن عضلات المصطكي قد لا تتم إزالتها تماما. عندما يلاحظ ذلك، لا تدويره مقيد، وإلا فإنه من السهل كسر الرقبة condylar مما يؤدي إلى تلوث الخلايا. وتشمل الصعوبات الأخرى في فصل وثقافة mBMSCs انخفاض المحتوى في نخاع العظام، ونشاط الخلايا الحساسة، وانخفاض النقاء، وانخفاض وتيرة الخلية وتلوث الخلايا الدموية18،23. 10- وللحصول على مركبات MBMSCs ذات النمو الجيد وإمكانات التمايز العالية نسبيا، فإن ضمان نشاط الشركات المتوسطة والمبيستيرية أمر بالغ الأهمية. هناك العديد من الخطوات الرئيسية ، بما في ذلك استخدام الفئران التي تبلغ من العمر أربعة أسابيع لهذه التجارب والتجارب اللاحقة ، حيث يفضل أن تحافظ الفئران الصغيرة على صلاحية جيدة. وقد أكدت العديد من الدراسات أن نشاط mBMSCs يرتبط بعمر الحيوانات التجريبية. وقد تؤدي تلك البلدان من كبار المانحين إلى انخفاض نشاط الانتشار، وإلى إمكانية التفريق والعمرالافتراضي 2. جميع العمليات خلال حصاد الخلية تحتاج إلى الانتهاء على الجليد ووقت التشغيل يجب أن تكون قصيرة قدر الإمكان، ويفضل في غضون 2 ساعة. بالإضافة إلى ذلك، الحفاظ على وقت الهضم تريبسين لا يزيد عن 3 دقائق. وأخيرا، لا يزال هناك تحد آخر في هذا البروتوكول يتمثل في عملية حصاد مركبات الكربون الهيدروفلورية. قد يكون من المزعج طرد mBMSCs من تجويف العظام لأن تجويف الفك السفلي للفئران صغير جدا ، لذلك من المهم جدا أن تكون على دراية بالهيكل التشريحي. يمكن أن تكون صور التصوير المقطعي المصغر ذات أهمية كبيرة في هذا الصدد. الى جانب ذلك ، تجدر الإشارة إلى أنه بما أن عظام الأحداث نحيلة وهشة ، يمكن أن يؤدي الكسر إلى التلوث.

في اشارة الى توصيف مناعي, BMSCs التعبير عن العديد من الأنماط الظاهرية, ولكن أيا منها هو محدد لهم24. من المقبول عموما أن BMSCs لا تعبر عن CD11b أو CD14 أو CD34 أو CD45، ولكن لديها تعبير عالي عن Sca-1 و CD29 و CD90 و CD105. اختارت هذه الدراسة علامات مقبولة على نطاق واسع من CD29، CD90، وCD45 لفرز الخلايا الفلورية13،14،25. ووجدت أن CD29+CD90+CD45- شكلت الخلية 80٪ بشكل مناسب من إجمالي الخلايا، وهو ما يكفي لثقافة الخلايا اللاحقة والبحوث.

على مدى عقود، يستخدم العلاج بالخلايا الجذعية على نطاق واسع في علاج الأمراض المختلفة، مثل أمراض الجهاز المناعي، والأمراض الجهازية الدموية، والسرطانات، أو الصدمات النفسية. مما لا شك فيه، يمكن استخدام mBMSCs، كبديل لBMSCs، كأداة أكثر أمانا وقوة في العلاج بالخلايا الجذعية بسبب خصائصها المتفوقة. ولذلك، فإن زراعة الخلايا وتوسيع نطاق مركبات MBMSCs تصبح ذات أهمية خاصة للحصول على عدد كاف من الخلايا للعلاج.

وباختصار، أظهرت هذه الدراسة بروتوكولا واعدا وموثوقا به لحصاد مركبات متعددة المول ثاني أكسيد الكربون وفيرة مع تجانس عال وقدرة متعددة التمايز في فترة قصيرة من الزمن.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

جميع المؤلفين يقولون أنه ليس لديهم تضارب في المصالح.

Acknowledgments

نشكر على مساعدة مختبر أمراض الفم الرقمية ومركز البحوث للتشوهات القحفية الوجهية في مستشفى الشعب التاسع في شنغهاي. يدعم عمل هذه المخطوطة منح من المؤسسة الوطنية للعلوم الطبيعية الصينية (NSFC) [81570950,81870740,81800949], شنغهاي قمة وهضبة التخصصات، صندوق SHIPM-mu من معهد شنغهاي للطب الدقيق، شنغهاي مستشفى الشعب التاسع، شنغهاي جياو تونغ كلية الطب جامعة [JC201809]، المشروع الحافز لفريق الابتكار رفيع المستوى لكلية الطب في جامعة جياو تونغ شنغهاي. و ل. ج. هو باحث في برنامج تنمية الشباب المتميز للمواهب الطبية للشباب، وبرنامج شنغهاي "النجوم الصاعدة للمواهب الطبية" لتنمية الشباب، ومشروع "تشن شينغ" من جامعة جياوتونغ في شنغهاي.

Materials

Name Company Catalog Number Comments
0.25% Trypsin-EDTA(1X) Gibco 25200072
10cm culture dish Corning
acutenaculum
Adipogenic differentiation medium Cyagen biosciences inc. MUBMX-90031
Alcian Blue Beyotime Biotechnology
Alizarin red Sigma-Aldrich A5533
Alkaline Phosphatase Color Development Kit Beyotime Biotechnology C3206
alpha-Minimum essential medium GE Healthcare HyClone Cell Culture SH30265.01B
Anti -CollagenII Rabbit pAb Abcam ab34712
Antibodies against CD16/CD32
Antifade Mounting Medium with DAPI Beyotime Biotechnology P0131
APC anti-mouse/rat CD29 Antibody biolegend inc 102215
Biosafety cabinet Esco AC2-4S8-CN
CD45 Monoclonal Antibody (OX1), PE, eBioscience Invitrogen 12-0461-82
CD90.1 (Thy-1.1) Monoclonal Antibody (HIS51), FITC, eBioscience Invitrogen 11-0900-85
Centrifuge cence L500
Chondrogenesis differentiation medium cyagen biosciences inc.
Confocal laser scanning microscope Zeiss LSM880
Countess II FL Automated Cell Counter Invitrogen AMQAF1000
Crystal Violet Staining Solution Beyotime Biotechnology C0121
Fetal Bovine Serum GE Healthcare HyClone Cell Culture SH30084.03
Goat Anti-Rabbit IgG H&L (Alexa Fluor 488) abcam ab150077
Incubator Esco CCL-170B-8
Inverted microscope olympus CKX53
Magzol reagent(Trizol reagent) Magen
micropipettor Eppendorf
Oil Red O
Osteogenic differentiation medium cyagen biosciences inc. MUBMX-90021
Penicillin-Streptomycin Gibco 15070063
Phosphate-buffered saline(1X) Gibco 20012027
PrimeScript RT Master Kit TakaRa Bio Inc RR036A
Proteinase K Sigma-Aldrich P6556
QuickBlock Blocking Buffer Beyotime Biotechnology P0260
scissor
SYBR1 Premix TakaRa Bio Inc
Toluidine Blue Beyotime Biotechnology
Trypan Blue Solution, 0.4% Gibco 15250061

DOWNLOAD MATERIALS LIST

References

  1. Jin, C., et al. Stem cell education for medical students at Tongji University: Primary cell culture and directional differentiation of rat bone marrow mesenchymal stem cells. Biochemistry and Molecular Biology Education. 46, (2), 151-154 (2018).
  2. Chu, D. T., et al. An Update on the Progress of Isolation, Culture, Storage, and Clinical Application of Human Bone Marrow Mesenchymal Stem/Stromal Cells. International Journal of Molecular Sciences. 21, (3), 708 (2020).
  3. Jin, Z., Chen, J., Shu, B., Xiao, Y., Tang, D. Bone mesenchymal stem cell therapy for ovariectomized osteoporotic rats: a systematic review and meta-analysis. BMC Musculoskeleton Disorder. 20, (1), 556 (2019).
  4. Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, (6893), 41-49 (2002).
  5. Musina, R. A., Bekchanova, E. S., Belyavskii, A. V., Sukhikh, G. T. Differentiation potential of mesenchymal stem cells of different origin. Bulletin of Experimental Biology and Medicine. 141, (1), 147-151 (2006).
  6. Lloyd, B., et al. Similarities and differences between porcine mandibular and limb bone marrow mesenchymal stem cells. Archives in Oral Biology. 77, 1-11 (2017).
  7. Zhang, W., et al. Comparison of the use of adipose tissue-derived and bone marrow-derived stem cells for rapid bone regeneration. Journal of Dental Research. 92, (12), 1136-1141 (2013).
  8. Stefanik, D., et al. Disparate osteogenic response of mandible and iliac crest bone marrow stromal cells to pamidronate. Oral Disorders. 14, (5), 465-471 (2008).
  9. Aghaloo, T. L., et al. Osteogenic potential of mandibular vs. long-bone marrow stromal cells. Journal of Dental Research. 89, (11), 1293-1298 (2010).
  10. Kaigler, D., et al. Stem cell therapy for craniofacial bone regeneration: a randomized, controlled feasibility trial. Cell Transplantation. 22, (5), 767-777 (2013).
  11. Li, C., Wang, F., Zhang, R., Qiao, P., Liu, H. Comparison of proliferation and osteogenic differentiation potential of rat mandibular and femoral bone marrow mesenchymal stem cells in vitro. Stem Cells Development. 2020, 1941629 (2020).
  12. Matsubara, T., et al. Alveolar bone marrow as a cell source for regenerative medicine: differences between alveolar and iliac bone marrow stromal cells. Journal of Bone and Mineral Research. 20, (3), 399-409 (2005).
  13. Chan, C. K. F., et al. Identification of the Human Skeletal Stem Cell. Cell. 175, (1), 43-56 (2018).
  14. Bianco, P., Riminucci, M., Gronthos, S., Robey, P. G. Bone marrow stromal stem cells: nature, biology, and potential applications. Stem Cells. 19, (3), 180-192 (2001).
  15. Franken, N. A., Rodermond, H. M., Stap, J., Haveman, J., van Bree, C. Clonogenic assay of cells in vitro. Nature Protocol. 1, (5), 2315-2319 (2006).
  16. Xu, H., et al. Icariin prevents oestrogen deficiency-induced alveolar bone loss through promoting osteogenesis via STAT3. Cell Proliferation. 53, (2), 12743 (2020).
  17. Zhang, P., Wu, Y., Jiang, Z., Jiang, L., Fang, B. Osteogenic response of mesenchymal stem cells to continuous mechanical strain is dependent on ERK1/2-Runx2 signaling. Internation Journal of Molecular Medicine. 29, (6), 1083-1089 (2012).
  18. Zhu, H., et al. A protocol for isolation and culture of mesenchymal stem cells from mouse compact bone. Nature Protocol. 5, (3), 550-560 (2010).
  19. Lach, M. S., et al. Chondrogenic Differentiation of Pluripotent Stem Cells under Controllable Serum-Free Conditions. International Journal of Molecular Sciences. 20, (11), 2711 (2019).
  20. Huang, X., Zhong, L., Hendriks, J., Post, J. N., Karperien, M. The Effects of the WNT-Signaling Modulators BIO and PKF118-310 on the Chondrogenic Differentiation of Human Mesenchymal Stem Cells. International Journal of Molecular Sciences. 19, (2), 561 (2018).
  21. Gale, A. L., Linardi, R. L., McClung, G., Mammone, R. M., Ortved, K. F. Comparison of the Chondrogenic Differentiation Potential of Equine Synovial Membrane-Derived and Bone Marrow-Derived Mesenchymal Stem Cells. Frontiers in Veterinary Sciences. 6, 178 (2019).
  22. Li, X., Zhang, Y., Qi, G. Evaluation of isolation methods and culture conditions for rat bone marrow mesenchymal stem cells. Cytotechnology. 65, (3), 323-334 (2013).
  23. Kagami, H., Agata, H., Tojo, A. Bone marrow stromal cells (bone marrow-derived multipotent mesenchymal stromal cells) for bone tissue engineering: basic science to clinical translation. International Journal of Biochemistry and Cell Biology. 43, (3), 286-289 (2011).
  24. Chamberlain, G., Fox, J., Ashton, B., Middleton, J. Concise review: mesenchymal stem cells: their phenotype, differentiation capacity, immunological features, and potential for homing. Stem Cells. 25, (11), 2739-2749 (2007).
  25. Abdallah, B. M., Alzahrani, A. M., Abdel-Moneim, A. M., Ditzel, N., Kassem, M. A simple and reliable protocol for long-term culture of murine bone marrow stromal(mesenchymal) stem cells that retained their in vitro and in vivo stemness in long-term culture. Biology Proceedings Online. 21, 3 (2019).
عزل وزراعة الخلايا الجذعية النخاعية النخاعية النخاعية في الفئران
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).More

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter