Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Isolation og dyrkning af mandibular knoglemarv mesenchymale stamceller hos rotter

doi: 10.3791/61532 Published: August 25, 2020
* These authors contributed equally

Summary

Denne artikel præsenterer en metode, der kombinerer hele knoglemarvsophæftning og flowcytometrisortering til isolering, dyrkning, sortering og identifikation af knoglemarvsmetrimometriske stamceller fra rotte mandibler.

Abstract

Her præsenterer vi en effektiv metode til isolering og dyrkning af mandibulære knoglemarvsmetrimylceller (mBMSCs) in vitro for hurtigt at opnå mange celler af høj kvalitet til eksperimentelle behov. mBMSCs kunne i vid udstrækning anvendes i terapeutiske anvendelser som vævstekniske celler i tilfælde af kraniofaciale sygdomme og kranio-maxillofacial regenerering i fremtiden på grund af den fremragende selvfornyelse evne og multi-afstamning differentiering potentiale. Derfor er det vigtigt at opnå mBMSCs i stort antal.

I denne undersøgelse blev knoglemarven skyllet ud af underkæben, og primære mBMSC'er blev isoleret gennem hele knoglemarvshængende dyrkning. Desuden blev CD29+CD90+CD45 mBMSCs renset gennem fluorescerende cellesortering. Anden generation af rensede mBMSC'er blev anvendt til yderligere undersøgelse og viste potentiale i at differentiere sig til osteoblaster, adipocytter og chondrocytter. Ved hjælp af denne in vitro-model kan man opnå et stort antal proliferative mBMSC'er, hvilket kan lette undersøgelsen af de biologiske egenskaber, den efterfølgende reaktion på mikromiljøet og andre anvendelser af mBMSC'er.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Knoglemarvsmetrimyle stamceller (BMSC'er) er ikke-hæmatopoietiske stamceller fra knoglemarv , der manifesterer en stærk spredningskapacitet og differentieringspotentiale for flere afstamninger1,2,3,4. Faktisk er BMSC'er blevet betragtet som en ideel kandidat til knoglevævsteknik og regenerering, lige siden de blev opdaget. I årevis har iliaca kam eller lange knogler såsom skinnebenet og lårbenet været den mest almindelige kilde til BMSCs for kraniofacial regenerering. Eller af kommercielle BMSC'er, såsom mandibular BMSCs (mBMSCs), udviser dog visse forskelle fra BMSC'er med lange knogler, f.eks. Mandibler opstår fra neurale kamceller i neuroectoderm kimlaget og gennemgår intramembranøs ossifikation, mens aksiale og blindtarmssømmer er fra mesodermen og gennemgår endokondrisk ossifikation. Endvidere har kliniske observationer og eksperimentelle dyreforsøg konsekvent vist , at der er funktionelle forskelle mellem orofacial og iliaca crest BMSCs5,6,7,8. Rapporter har vist, at BMSCs stammer fra kraniofacial knogle såsom mandible, maxillary knogle, og alveolar knogle udstillet overlegen spredning, levetid, og differentiering kapacitet end dem fra aksial og blindtarmsfæld9. mBMSCs anses derfor for at være de foretrukne ressourcer til fremtidige terapeutiske anvendelser af kraniofaciale sygdomme som cherubisme, kæbetumor, osteoporose af kæbeknogle og paradentosevævsdefekt10,11,12. For at forstå behandlingspotentialet i prækliniske eksperimenter er det vigtigt at etablere en metode til hurtig isolering og dyrkning af mBMSCs in vitro.

I denne undersøgelse var målet at opnå rensede mBMSC'er ved hel knoglemarvstilkæv og flowcytometrisortering. Den anatomiske morfologi af rotte mandible, tydeligt observeret gennem mikrocomputertomografi (Micro-CT) og histologiske sektioner, viste, at mandiblens trabekulære knogle var mellem det incisor medullære rum og alveolarbenet. Knoglemarven fra trabekulær knogle blev skyllet for at opnå mandibular marv celler, men cellerne dyrket på denne måde var ikke ren mBMSCs og var tilbøjelige til at bestå af flere typer af celler med usikre potencies og forskellige afstamninger såsom celler fra knogler, fedt og endotelceller13,14. Det næste trin i cellerensning var særlig vigtigt. Flow cytometri filtrerer celler ved at genkende en kombination af celle-overflade proteiner og er blevet bredt vedtaget i berigelsen af mesenchymale stamceller. Celle homogenitet er den største fordel ved flowcytometry, men processen bestemmer ikke celle levedygtighed og kan resultere i en begrænset celleydelse. I denne undersøgelse blev P0 mBMSC'erne opnået ved overholdelse af hele knoglemarvsbesætning sorteret efter flowcytometry for at opnå mBMSC'er med høj renhed og stærk spredningskapacitet.

Denne undersøgelse introducerer en reproducerbar og pålidelig protokol for isolation, kultur og differentiering af rotte mandibular BMSCs ved hjælp af en kombination af hele knoglemarvsophæftning og flow cytometrisortering. Det er en pålidelig og bekvem metode for forskere inden for beslægtede områder at bruge.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle dyreforsøg i dette papir blev godkendt af Animal Care Committee of Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine.

1. Forberedelse

  1. Brug to 5 uger gamle mandlige Sprague Dawley rotter til eksperimentet.
  2. Steriliser alle instrumenter, herunder nåleholdere, pincet og saks ved høj temperatur eller nedsænket i 75% ethanol i 10 minutter.
    BEMÆRK: Ethanol nedsænkning bør ikke være for lang til at undgå celleskader.
  3. Forbered kulturmedier på forhånd, hvis sammensætning findes i tabel 1. Supplere hvert medie som beskrevet nedenfor.
    1. Forberedelse af α-MEM-dyrkningsmedium (med 10% FBS): Supplerer minimumsfornødenheder med medium alfa (α-MEM) med 10% føtalt kvægserum og 1% penicillin og streptomycin.
    2. Forberedelse af osteogen differentieringsmedium: Supplement osteogen differentierings basal medium med 10% føtalt kvægserum, 1% glutamin, 1% penicillin-streptomycin, 0,20% ascorbinsyre, 1% β-glycerophosphat og 0,01% dexamethasone.
    3. Forberedelse af osteogent induktionsmedium: Bland 70% α-MEM-dyrkningsmedium (med 10% FBS) og 30% osteogent differentieringsmedium.
    4. Forberedelse af adipogen differentieringsmedium A: Supplement til adipogen differentierings basal medium med 10% føtalt kvægserum, 1% glutamin, 1% penicillin-streptomycin, 0,20% insulin, 0,10% IBMX, 0,10% Rosiglitazone og 0,01% Dexamethasone.
    5. Forberedelse af adipogen differentieringsmedium B: supplerer adipogen differentierings basal medium med 10% føtalt kvægserum, 1% glutamin, 1% penicillin-streptomycin og 0,20% insulin.
    6. Forberedelse af chondrogen differentieringsmedium: Supplere chondrogen differentiering basal medium med 0,01% Dexamethasone, 0,30% Ascorbinsyre, 1% ITS, 0,10% Natrium pyruvat, 0,10% Prolin og 1% TGF-β3.
      BEMÆRK: Det osteogene differentieringsmedium skal være opbrugt inden for en måned efter konfigurationen. Den effektive periode for det konfigurerede chondrogene differentieringsmedium er 12 timer.

2. Isolation og dyrkning af rotte mBMSCs

BEMÆRK: Alle forsøgsoperationer skal udføres på is så meget som muligt for at opretholde celledygtighed.

  1. Høst af rotte mandibler
    1. Aflive to 5-uger gamle mandlige Sprague Dawley rotter ved CO2 kvælning. Sørg for, at dyrets vejrtrækning stoppes, før du fortsætter med forsøget.
    2. Skyl disse rotter i et bægerglas, der indeholder 75% ethanol i 3 min.
    3. Placer rotten inde i en ren røghætte for at høste mandibler.
      BEMÆRK: Steriliser røghætten ved ultraviolet lysstråling i 30 minutter før brug.
    4. Placer rotten i en liggende position. Incise skind og buccinator muskler fra bilaterale angulus oris til den bageste region af mandiblen, som er den eneste bevægelige knogle med lavere fortænder.
      BEMÆRK: Det anbefales at lave et 2 cm snit på hver side af angulus oris for at få et klart operationsfelt.
    5. Åbn rottens mund ved at skubbe maxillary og mandibular fortænder mod den modsatte retning med begge tommelfingre for at udsætte mandibular tænderne, som er fastgjort til mandiblen.
    6. Helt afbryde buccal muskler og sener knyttet til coracoids og ringere grænse mandible.
      BEMÆRK: Der observeres en øget mobilitet af underkæbe under dette trin på grund af manglende muskelspændinger.
    7. Tryk på mandibular posterior tænder og rotere tilbage og nedad, indtil condyles på begge sider er tydeligt eksponeret.
      BEMÆRK: Dette trin udføres for kunstigt at åbne rottens mund i videst muligt omfang for at forvrænge kondylen. Underkæbbet er forbundet med kraniet gennem bilaterale kondyler, så eksponeringen af kondylerne fører til afbrydelsen mellem kraniet og underkæbe.
    8. Adskil mandiblen fra kraniet.
    9. Rengør det vedhængende bløde væv på knogleoverfladen ved hjælp af en våd gaze.
    10. Knoglen anbringes i en steril glasskål på 10 cm fyldt med forkølede essentielle mellem α (α-MEM) eller fosfatbuffersalline (PBS) på is for at bevare rentabiliteten.
  2. Isolation og dyrkning af mBMSCs
    1. Skær den forreste knogle af langs den mesiale kant af den første kindtand fra mandibularkroppen. Fjern mandibular ramus herunder coracoid og condyle langs distal kanten af den tredje molar at udsætte marv hulrum.
    2. Fyld en 10 cm steril glasskål med 10 mL α-MEM (med 10% FBS).
    3. Brug 1 mL sprøjte til at aspirere α-MEM kultur medium. Med sprøjten nålen indsat i knoglemarven hulrum, gentagne gange skylle knoglemarven i fadet. Skyl knoglehulen mindst 3 gange fra både mesial og distal sider af knoglen, henholdsvis indtil knoglen blev hvid.
      BEMÆRK: Dette er det mest kritiske skridt, da knoglemarvshulen på en rottegæbbe ikke er så tydelig som i lang knogle, og det rette punkt at indsætte nålen skal bestemmes empirisk. Alle ovennævnte forsøgsprøver bør opbevares på is for at sikre celledygtighed, og driftstiden må derfor ikke være længere end 2 timer.
    4. Mediet med de skyllede celler overføres til et 15 mL centrifugerør og centrifuge ved 800 x g i 4 °C i 5 min. Kassér supernatanten.
    5. Resuspend cellerne med 3 mL α-MEM (med 10% FBS). Plade cellerne i en ny 10 cm dyrkningsskål og inkubat ved 37 °C i en 5% CO2 inkubator.
    6. Kontroller de morfologiske ændringer og væksten af disse celler på 3. dag i kulturen. Fjern kulturmediet med ikke-klæbende celler og vævsfragmenter. Tilsæt forsigtigt 10 mL frisk α-MEM (med 10% FBS).
    7. Efter 7 dages kultur nåede P0 mBMSCs 70% til 80% sammenløb.
  3. Sortering af flowceller
    BEMÆRK: P0 mBMSCs blev fænotypisk identificeret og primært renset gennem flow cellesortering.
    1. Aspirér og kassér kulturmediet, og vask derefter skålen med PBS. Kassér PBS.
    2. Tilsæt 1 mL på 0,25% trypsin med 0,02% EDTA i skålen. Cellerne fordøjes ved 37 °C i 5 min. og tilsættes derefter 2 mL α-MEM (med 10% FBS) for at stoppe reaktionen.
    3. Cellernes suspension overføres til et 15 mL centrifugerør og centrifuge ved 800 x g i 5 min.
    4. Resuspend cellerne i 120 μL PBS (med 10% FBS) efter centrifugering.
    5. Disse celleaffjedringsblokkes med 1 μL antistof mod CD16/CD32 ved 4 °C i 15 min.
    6. 100 μL af celleaffjedringen overføres til et nyt mikrocentrifugerør indeholdende cellerne med Phycoerythrin (PE)-konjugeret antistof mod CD45, fluorescein-isothiocyanat (FITC)-konjugeret antistof mod CD90 og Allophycocyanin (APC)-antistof mod CD29 ved 4 °C i 1 time i mørke13,15. Koncentrationen af antistoffer, der anvendes i dette forsøg, er vist i tabel 2. Brug de øvrige 20 μL celleaffjedring som ikke-indgroet negativ kontrol.
    7. Derefter centrifugeres rørene ved 800 x g i 5 minutter, suspensionen kasseres, og cellerne genbruges i 0,5 mL PBS (med 10% FBS).
    8. Der tilsættes 10 μL på 0,01 mg/mL DAPI i 10 minutter før analyse.
    9. Brug 40 nm filtre placeret på centrifuge rør til at filtrere cellerne.
    10. Analyser cellerne i den fluorescensaktiverede celle Sorter. Indstil panelerne på følgende måde. For det første skal du fjerne døde celler fra det samlede celleantal ved at gating DAPI- celler, derefter gate CD29+CD90+CD45- i de valgte celler som målrettede mBMSCs.
    11. Den sorterede CD29+CD90+CD45- celler ind i et 15 mL centrifugerør med 3 mL α-MEM (med 10% FBS) forberedt på forhånd.
    12. Centrifuge rørene ved 800 x g i 5 min. Fjern indsamlingsbufferen, og tilføj 1 mL frisk α-MEM (med 10% FBS) for at genbruge cellerne. Derefter plade dem i en 6 cm kultur skål.

3. Kolonidannelseskapacitet

BEMÆRK: Dette trin blev udført for at kontrollere mBMSCs' divisionevne. 15 år

  1. Vælg mBMSCs (Second Passage MBMSCs) til dette eksperiment. Når celle sammenløbet nåede 80% til 90%, reseed cellerne i en seriel gradient i en 6 godt plade til at evaluere deres kloniske spredning evne.
    BEMÆRK: Det anbefales at indstille forløbet fra 1 x 102 til 1 x 103 celler pr. brønd, men de endelige fortyndinger af forskellige cellelinjer af human eller animalsk oprindelse blev empirisk bestemt.
  2. Kultur cellerne i α-MEM (med 10% FBS) i cirka to uger, indtil et godt antal af kolonien danner enheder kunne ses under lys mikroskop. Opdater kulturmediet hver 3. dag.
  3. Aspirat og kassér kulturmediet, vask brøndene med PBS to gange i 5 minutter ad gangen. Derefter tilsættes 4% paraformaldehydopløsning til hver brønd og fastgøres i mindst 10 minutter.
  4. Fjern paraformaldehyd og skyl brøndene to gange med PBS.
  5. Farv cellerne med krystalviolet farvningsopløsning, og inkuber dem i 37 °C i ca. 10 min.
    BEMÆRK: Farvningstiden justeres korrekt, indtil den ønskede skygge er opnået.
  6. Fjern farvningsopløsningen, og vask prøverne med destilleret vand for at stoppe reaktionen.
  7. Billede under et stereomikroskop og tælle spredte cellekolonier, som bestod af mindst 50 celler.

4. Differentiering af mBM'er med flere aer

BEMÆRK: P2 mBMSCs blev brugt til efterfølgende forsøg, medmindre andet er beskrevet.

  1. Osteogen induktion af mBMSCs
    1. Digest mBMSCs som beskrevet ovenfor. Frøceller med en densitet på 2,5 x 105/cm2 i en 12 brøndplade suppleret med 1 mL α-MEM (med 10% FBS).
    2. Når celle sammenløbet nåede 60-70%, ændre mediet i 30% osteogen induktion medier. Kultur cellerne med α-MEM (med 10% FBS) som en negativ kontrol og ændre mediet hver 2. dag.
      BEMÆRK: Efter et stort antal calcium knuder vises under osteogenese, anbefales det at ændre medium udveksling mønster til et halvt volumen medium udveksling hver 2 dag, for at forhindre osteoblaster fra flydende.
    3. Efter dyrkning i syv dage skal du vurdere forkalkningen af disse celler ved hjælp af alkalisk fosfatase farvning16,17.
    4. Fjern dyrkningsmediet og fastgør cellerne med 4% paraformaldehyd i 10 minutter. Cellerne skylles med 1 mL PBS pr. brønd i 3 min. to gange.
    5. Derefter plettes cellerne med alkalisk fosfatasefarvningsopløsning, og der inkuberes ved 37 °C i 10-30 min.
      BEMÆRK: Inkubation kan udføres natten over ved stuetemperatur for at opnå den nødvendige farve.
    6. Vask brøndene med destilleret vand for at stoppe reaktionen. Tag billeder under lysmikroskop. Røde pigmenterede granulater repræsenterer alkalisk fosfataseaktivitet (ALP).
    7. Efter dyrkning af de resterende celler i yderligere 7 dage, udføre alizarin rød farvning for at evaluere mineralisering kapacitet af cellerne.
    8. Plette cellerne med 0,5% alizarin rød farvning opløsning efter celle fiksering i 10 min16,18. Den kromogene reaktion standses med destilleret vand efter 3-5 min.
      BEMÆRK: Reaktionstiden kan forlænges afhængigt af den udviklede farve.
    9. Endelig skal du placere kulturpladen under lysmikroskopet for at observere effekten af osteogen farvning; røde knuder indikerer calciumaflejringer af disse celler.
  2. Adipogen induktion af mBMSCs
    1. Seed P2 mBMSCs i en 12 godt plade som beskrevet ovenfor.
    2. Efter brønden bliver 90% sammenflydende, kultur cellerne med adipogen differentiering medium A. Brug celler dyrket i α-MEM kultur medium (med 10% FBS) som negativ kontrol.
    3. Efter 2 dages induktion suges mediet A fra brønden og tilsæt 1 mL adipogen differentieringsmedium B i hver brønd.
    4. Efter en dag skal du fjerne medium B og starte cyklussen igen med medium A tilføjet tilbage i brønden. Kultur cellerne skiftevis ved hjælp af medium A og B.
    5. Påfør differentieringsmediet A og B skiftevis i tre cyklusser og detektere disse cellers adipogenese ved olierød O farvning16,18.
      BEMÆRK: Masser af runde og store lipiddråber kan observeres ved at dyrke disse celler med differentieringsmedium B i yderligere 2 til 3 dage.
    6. Fjern mediet og fastgør cellerne med 4% paraformaldehyd i 10 minutter. Vask cellerne ud med PBS.
    7. Cellerne plettes med olierød O-farvningsopløsning, og der inkuberes ved 37 °C i ca. 3 min.
    8. Fjern farvningsopløsningen og vask brøndene med destilleret vand.
    9. Overhold adipogenese under lysmikroskop.
  3. Chondrogenesis induktion af mBMSCs
    1. Frø P2 mBMSCs i 15 mL centrifugerør med en densitet på 5 x 105/cm2.
    2. Centrifuge rørene ved 300 x g i 5 min. Kassér supernatanten.
    3. Resuspend cellerne med 0,5 mL chondrogen differentiering medium. Centrifuge cellerne ved 300 x g i 5 min.
    4. Hætten af centrifugerøret løsnes, og den inkuberes ved 37 °C i en 5% CO 2-inkubator. Forny mediet hver 2. dag.
      BEMÆRK: Cellerne starter pelleting efter 24 timer. Det anbefales ikke at flytte centrifugerøret i 48 timer. Pas på ikke at suge cellepillen, når du skifter mediet.
    5. Efter 21 dages induktion skal du fastgøre cellepillerne med 4% paraformaldehyd, efterfulgt af dehydrering, paraffinindlejring og sektionsopdelte.
    6. Efter deparaffinisering og hydrering plettes diasene i Alcian blå opløsning i mindst 15 min18,19,20,21, og vask derefter med destilleret vand for at stoppe reaktionen. Tag fotografierne under lysmikroskop.
    7. For immunfluorescerende farvning af kollagen type II, udføre nedenstående trin.
      1. Diasene inkuberes med 5 μg/mL proteinase K i 15 min ved 37 °C efter deparaffinerings- og hydreringstrinnet.
      2. Indsnævr lysbillederne i blokeringsbufferen i 1 time ved 37 °C.
      3. 1 μL kollagen type II antistof påføres i 200 μL blokeringsbuffer på lysbillederne og inkuberes natten over ved 4 °C.
      4. Den næste dag vaskes lysbillederne med PBS to gange og inkuberes med sekundære antistoffer ved 37 °C i 1 time.
      5. Inkuber skiverne med 40,6-diamidino-2-phenylindole (DAPI) i 10 min.
    8. Tag billeder af hvert dias under fluorescensmikroskopi.

5. Pcr i realtid

  1. Ekstrakt total RNA fra mBMSCs ved hjælp af en guanidium isothiocyanat baseret kommercielt tilgængelige reagens.
  2. Udfør omvendt transskription af RNA i komplementært DNA ved hjælp af et kommercielt tilgængeligt sæt. Reaktionsbetingelserne for omvendt transskribering var som følger: 65 °C i 5 min., 37 °C i 15 min., 85 °C for 15 s.
  3. Udfør PCR i realtid for at opdage osteogenese og adipogenesespecifikke gener ved hjælp af primere, der er anført i tabel 3. PCR-forstærkningsproceduren var som følger: 95 °C i 5 min. 95 °C for 5 s, 60 °C for 30 s for 40 cyklusser.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ved hjælp af denne protokol overholdt en stor del af cellerne pladen på den tredje dag efter den oprindelige kultur. Efter yderligere 3-4 dages kultur nåede cellesammenløbet typisk op på 70-80 %(figur 1B). Med fluorescerende cellesortering blev DAPI-CD29+CD90+CD45 mBMSCs renset18,22, som tegnede sig for ca. 81,1% i P0-cellerne (Figur 1C).

Efter såning P2 mBMSCs på 100 celler i hver brønd på 6 godt plade i en uge, en betydelig mængde koloni danner enheder blev observeret, hvilket tydede på den betydelige koloni danner evne til mBMSCs (Figur 1D).

For at vurdere differentieringsevnen for flere afstamninger blev mBMSC'erne induceret til henholdsvis osteo-, chondro- og adipo-afstamninger i henholdsvis 12 brøndplader. MBMSCs udviste en stærk osteogen differentieringskapacitet. Øget aktivitet af ALP, røde brændbare knuder fordelt sporadisk under alizarin rød farvning, og øget ekspression af osteogene specifikke gener Runx2, Alp, Bsp og Ocn (Figur 2) angivet oestogenic induktion. For adipogenesis, identificeret ved Olie-rød-O farvning, talrige lipid-rige vakuoler var tydelige efter 9 dages induktion. På samme måde viste udtrykket af adipogene specifikke gener Pparγ1 og Cebpa en betydelig stigning (figur 3). Til mikroskopisk observation af chondrogen differentieringsdias viste prøverne positiv farvning for alciansk blå. Desuden viste immunistaining med anti-type II kollagenantistof øget ophobning af bruskmatrix (Figur 4).

Kultur Medium komponent Endelig koncentration
1.α-MEM kulturmedium (med 10%FBS) α-minimum væsentlige medium
Føtalt kvægserum 10%
Penicillin og streptomycin 1%
2.Osteogent induktionsmedium α-MEM kulturmedium (med 10%FBS) 70%
Osteogen differentieringsmedium 30%
3.Osteogent differentieringsmedium Osteogent differentieret basalt medium
Føtalt kvægserum 10%
Glutamin 1%
Penicillin-Streptomycin 1%
askorbinsyre 0.20%
β-Glycerophosphat 1%
Dexamethason 0.01%
4.Adipogen differentieringsmedium A Adipogen differentiering basal medium
Føtalt kvægserum 10%
Glutamin 1%
Penicillin-Streptomycin 1%
insulin 0.20%
IBMX 0.10%
Rosiglitazone 0.10%
Dexamethason 0.01%
5.Adipogent differentieringsmedium B: Adipogen differentiering basal medium
Føtalt kvægserum 10%
Glutamin 1%
Penicillin-Streptomycin 1%
insulin 0.20%
6.Chondrogenic differentiering medium: Chondrogenesis differentiering basial medium
Dexamethason 0.01%
askorbinsyre 0.30%
dens 1%
Natrium pyruvat 0.10%
Prolin 0.10%
TGF-β3 1%

Tabel 1: Komponenter af kulturmedium og differentieringsmedium.

antistof koncentration
CD90.1 (Thy-1.1) Monoklonalt antistof 0,5 mg/mL
CD45 Monoklonalt antistof 0,2 mg/mL
CD29 Antistof 0,2 mg/mL
KollagenII kanin polyklonalt antistof 5 mg/mL
Ged Anti-Kanin IgG H &l (Alexa Fluor® 488) 1 mg/mL

Tabel 2: Antistofkoncentration anvendt i denne undersøgelse.

Primer Rækkefølge(5' til 3')
GAPDH Foward: CGGCAAGTTCAACGGCACAGTCAAGG
Bagside: ACGACATACTCAGCACCAGCATCACC
Runx2 Foward: GCCTTCAAGGTTGTAGCCCT
Omvendt: TGAACCTGGCCACTTGGTTT
Alp Foward: AAACTCGCTTATGGTCCCCG
Omvendt: TGGGTTTGAATTCCTGCGGT
bps Foward: GCACGGTTGAGTATGGGGAA
Omvendt: ATCCTGACCCTCGTAGCCTT
Ocn Fremad:CAACCCCAATTGTGACGAGC
Omvendt:GGCAACACATGCCCTAAACG
Cebpa Mod øst: AGTCGGTGGATAAGAACAGCAACG
Omvendt: CGGTCATTGTCACTGGTCAACTCC
Pparγ1 Foward: CCATCGAGGACATCCAAGACAACC
Omvendt: GTGCTCTGTGACAATCTGCCTGAG

Tabel 3: Primere, der bruges i pcr i realtid.

Figure 1
Figur 1: Isolation og kultur af mBMSCs. (A) Skematisk diagram over protokollen. mBMSCs blev isoleret og belagt på dag 0 og inkuberet med α-MEM kultur medium. På dag 7 blev P0 mBMSCs renset gennem flow cytometrisortering, og de sorterede celler blev belagt på en ny kulturret. På dag 14 blev P1 mBMSCs indsamlet og plating på 12-brønds plade. På dag 15 blev P2 mBMSC'er induceret til osteoblaster, adipogene celler og chondroblaster under tilsvarende induktionsmedium. (B) Skematisk model af rotte mandibulær knoglemarv og mikroskopisk observation af P0 mBMSC'er. (C) Strømning af cytomisortering af rotte mBMSC'er. Flowcytometrianalysen viser, at disse celler var positive for CD29 og CD90, men negative for CD45, som er sammenfaldende med BMSC-egenskaber. Af disse blev 1,4 x 106 celler sorteret, hvilket tegnede sig for passende 80% af de samlede celler. (D) Repræsentativt billede af krystalviolet farvede P2 mBMSC-kloner. Klik her for at se en større version af dette tal.

Figure 2
Figur 2: MBMC'ers osteogen differentieringspotentiale. (A)Efter 7 dages osteogen induktion blev ændringen af ALP-aktiviteten visualiseret. Et stort antal mineraliserede knuder blev farvet under alizarin rød farvning på 14 dage efter induktion af osteogen differentiering. (B,C) Det positive område af ALP og alizarin rød farvning blev evalueret ved hjælp af Image J software. (C-G) MRNA-ekspressionen af osteoblastspecifikke markører Runx2, Alp, Bsp og Ocn steg betydeligt efter 7 dages osteogenese. Klik her for at se en større version af dette tal.

Figure 3
Figur 3: Adipogen differentieringspotentiale for mBMSCs efter ni dages induktion. (A) En stor mængde lipiddråber og adipocytter blev plettet af olierød-O. (B,C) MRNA-udtrykket af adipogene markører Cebpa og Pparγ1 steg bemærkelsesværdigt efter 9 dages adipogenesis. Klik her for at se en større version af dette tal.

Figure 4
Figur 4: Stereoscope-visning af chondrogen differentieringseffekt. (A) mBMSCs efter 21 dage chondrogen induktion viste positiv for alcian blå farvning. (B) Immunfluorescensbillede af chondrogen aggregat farvet med anti-type II kollagen. Klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Denne protokol beskriver en metode til at isolere BMSC'er fra rotte mandibles in vitro ved at kombinere hele knoglemarvstilstrækkelse og fluorescerende cellesortering, hvilket er en enkel og pålidelig måde at opnå proliferative mBMSCs med stærk differentieringsevne. Denne metode kan foreløbigt rense mBMSCs ved flowcellesortering, men hvis der er højere krav til celle homogenitet, kan der være behov for mere præcise rensningsmetoder.

I øjeblikket er der fire hovedteknikker, der anvendes til isolering af mBMSCs, herunder overholdelse af hele knoglemarvsmarven, tæthedsgradientcentrifugering, fluorescerende cellesortering og magnetisk aktiveret cellesortering22. Hele knoglemarvsophæftning og tæthedsgradient centrifugering er de mest almindelige og nemme metoder, der anvendes til at opnå mBMSCs på kort tid, men den lave renhed af høstede mBMSCs er deres største ulempe. De sidste to metoder kan isolere stærkt rensede mBMSCs gennem immunologiske teknikker, men har manglerne ved at være dyre, tager lang tid og nedsat celle levedygtighed. I denne undersøgelse blev fordelene ved hel knoglemarvsophæftning og fluorescerende cellesorteringsmetode kombineret for at opnå tilstrækkeligt mange proliferative mBMSC'er på kort tid.

Uden tvivl er et af de mest kritiske skridt i denne protokol dissektion af rotte mandible, som er helt forskellig fra dem af aksiale og blindtarmsben. Det er vigtigt at forstå anatomien af rotte mandible for at opnå en intakt prøve. Svarende til mennesker, rotte mandible sidder under maxilla, holder de nederste tænder på plads og er forbundet til kraniet af bilaterale condyles. Da underkæben er den eneste knogle, der kan bevæge sig i kraniet, er der mange muskler knyttet til mandible, som styrer dens bevægelse. Kun ved at fjerne disse bløde væv helt og dreje munden åben maksimalt kan condyles forbinder med kraniet blive udsat. Det er også værd at nævne, at condylar halsen er en fysisk svaghed i mandible og er let at fraktur. Hvis der konstateres overdreven modstand, når du drejer underkæbbet nedad, betyder det, at masticatormusklerne muligvis ikke er helt fjernet. Når dette observeres, må du ikke rotere det begrænset, ellers er det let at bryde kondylarhalsen og derved føre til celleforurening. Andre vanskeligheder i adskillelse og kultur af mBMSCs omfatter lavt indhold i knoglemarv, delikat celle aktivitet, lav renhed, lav cellefrekvens og forurening af hæmatopoietiske celler18,23. For at opnå mBMC'er med god vækst og et relativt højt differentieringspotentiale er det af afgørende betydning at sikre mBMSC'ernes aktivitet. Der er flere vigtige trin, herunder brugen af fire uger gamle rotter til dette og efterfølgende forsøg, da unge rotter foretrækkes at opretholde god levedygtighed. Mange undersøgelser har bekræftet, at mBMC'ernes aktivitet er relateret til forsøgsdyrenes alder. Disse mBMSC'er fra ældre donorer kan resultere i lavere spredningsaktivitet, differentieringspotentiale og levetid2. Alle operationer under cellehøsten skal være afsluttet på is, og driftstiden skal være så kort som muligt, helst inden for 2 timer. Derudover skal du holde trypsin fordøjelsestiden ikke længere end 3 minutter. Endelig er endnu en udfordring i denne protokol processen med at høste MBMSCs. Det kan være besværligt at skylle mBMSCs fra knoglehulen, fordi hulrummet af rotte mandible er meget lille, så det er meget vigtigt at være bekendt med den anatomiske struktur. Micro-CT billeder kan være til stor hjælp i denne henseende. Desuden er det værd at bemærke, at da unge knogler er slanke og sprøde, kan brud resultere i forurening.

Med henvisning til immunophenotypic karakterisering udtrykker BMSCs flere fænotyper, men ingen af dem er specifikke for dem24. Det er almindeligt anerkendt, at BMSC'er ikke udtrykker CD11b, CD14, CD34 eller CD45, men de har et højt udtryk for Sca-1, CD29, CD90 og CD105. Denne undersøgelse valgte de bredt accepterede markører for CD29, CD90 og CD45 for fluorescerende cellesortering13,14,25. Den fandt, at CD29+CD90+CD45 celle tegnede sig for passende 80% af de samlede celler, hvilket var nok til efterfølgende cellekultur og forskning.

I årtier anvendes stamcelleterapi i vid udstrækning til behandling af forskellige sygdomme, såsom immunsystemsygdomme, hæmatologiske systemiske sygdomme, kræft eller traumer. Utvivlsomt, mBMSCs, som en erstatning for BMSCs, kan bruges som et sikrere og mere kraftfuldt værktøj i stamcelleterapi på grund af deres overlegne egenskaber. Cellekultur og udvidelse af mBMSC'er bliver derfor særlig vigtigt for at opnå et tilstrækkeligt antal celler til behandling.

Sammenfattende viste denne undersøgelse en lovende og pålidelig protokol til høst af rigelige mBMSCs med høj homogenitet og multidifferentieringskapacitet på kort tid.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Alle forfattere siger, at de ikke har nogen interessekonflikter.

Acknowledgments

Vi takker for hjælp fra Laboratoriet for Digitaliseret Stomatologi og Research Center for Craniofacial Anomalies of Shanghai Ninth People's Hospital. Værket i dette manuskript er støttet af tilskud fra National Natural Science Foundation of China (NSFC) [81570950,81870740,81800949], Shanghai Summit &Plateau Disciplines, SHIPM-mu-fonden fra Shanghai Institute of Precision Medicine, Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine [JC201809], Incitamentsprojektet for innovationsteam på højt niveau for Shanghai Jiao Tong University School of Medicine. Og LJ er en forsker i Outstanding Youth Medical Talents, Shanghai "Rising Stars of Medical Talent" Youth Development Program og "Chen Xing" projekt fra Shanghai Jiaotong University.

Materials

Name Company Catalog Number Comments
0.25% Trypsin-EDTA(1X) Gibco 25200072
10cm culture dish Corning
acutenaculum
Adipogenic differentiation medium Cyagen biosciences inc. MUBMX-90031
Alcian Blue Beyotime Biotechnology
Alizarin red Sigma-Aldrich A5533
Alkaline Phosphatase Color Development Kit Beyotime Biotechnology C3206
alpha-Minimum essential medium GE Healthcare HyClone Cell Culture SH30265.01B
Anti -CollagenII Rabbit pAb Abcam ab34712
Antibodies against CD16/CD32
Antifade Mounting Medium with DAPI Beyotime Biotechnology P0131
APC anti-mouse/rat CD29 Antibody biolegend inc 102215
Biosafety cabinet Esco AC2-4S8-CN
CD45 Monoclonal Antibody (OX1), PE, eBioscience Invitrogen 12-0461-82
CD90.1 (Thy-1.1) Monoclonal Antibody (HIS51), FITC, eBioscience Invitrogen 11-0900-85
Centrifuge cence L500
Chondrogenesis differentiation medium cyagen biosciences inc.
Confocal laser scanning microscope Zeiss LSM880
Countess II FL Automated Cell Counter Invitrogen AMQAF1000
Crystal Violet Staining Solution Beyotime Biotechnology C0121
Fetal Bovine Serum GE Healthcare HyClone Cell Culture SH30084.03
Goat Anti-Rabbit IgG H&L (Alexa Fluor 488) abcam ab150077
Incubator Esco CCL-170B-8
Inverted microscope olympus CKX53
Magzol reagent(Trizol reagent) Magen
micropipettor Eppendorf
Oil Red O
Osteogenic differentiation medium cyagen biosciences inc. MUBMX-90021
Penicillin-Streptomycin Gibco 15070063
Phosphate-buffered saline(1X) Gibco 20012027
PrimeScript RT Master Kit TakaRa Bio Inc RR036A
Proteinase K Sigma-Aldrich P6556
QuickBlock Blocking Buffer Beyotime Biotechnology P0260
scissor
SYBR1 Premix TakaRa Bio Inc
Toluidine Blue Beyotime Biotechnology
Trypan Blue Solution, 0.4% Gibco 15250061

DOWNLOAD MATERIALS LIST

References

  1. Jin, C., et al. Stem cell education for medical students at Tongji University: Primary cell culture and directional differentiation of rat bone marrow mesenchymal stem cells. Biochemistry and Molecular Biology Education. 46, (2), 151-154 (2018).
  2. Chu, D. T., et al. An Update on the Progress of Isolation, Culture, Storage, and Clinical Application of Human Bone Marrow Mesenchymal Stem/Stromal Cells. International Journal of Molecular Sciences. 21, (3), 708 (2020).
  3. Jin, Z., Chen, J., Shu, B., Xiao, Y., Tang, D. Bone mesenchymal stem cell therapy for ovariectomized osteoporotic rats: a systematic review and meta-analysis. BMC Musculoskeleton Disorder. 20, (1), 556 (2019).
  4. Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, (6893), 41-49 (2002).
  5. Musina, R. A., Bekchanova, E. S., Belyavskii, A. V., Sukhikh, G. T. Differentiation potential of mesenchymal stem cells of different origin. Bulletin of Experimental Biology and Medicine. 141, (1), 147-151 (2006).
  6. Lloyd, B., et al. Similarities and differences between porcine mandibular and limb bone marrow mesenchymal stem cells. Archives in Oral Biology. 77, 1-11 (2017).
  7. Zhang, W., et al. Comparison of the use of adipose tissue-derived and bone marrow-derived stem cells for rapid bone regeneration. Journal of Dental Research. 92, (12), 1136-1141 (2013).
  8. Stefanik, D., et al. Disparate osteogenic response of mandible and iliac crest bone marrow stromal cells to pamidronate. Oral Disorders. 14, (5), 465-471 (2008).
  9. Aghaloo, T. L., et al. Osteogenic potential of mandibular vs. long-bone marrow stromal cells. Journal of Dental Research. 89, (11), 1293-1298 (2010).
  10. Kaigler, D., et al. Stem cell therapy for craniofacial bone regeneration: a randomized, controlled feasibility trial. Cell Transplantation. 22, (5), 767-777 (2013).
  11. Li, C., Wang, F., Zhang, R., Qiao, P., Liu, H. Comparison of proliferation and osteogenic differentiation potential of rat mandibular and femoral bone marrow mesenchymal stem cells in vitro. Stem Cells Development. 2020, 1941629 (2020).
  12. Matsubara, T., et al. Alveolar bone marrow as a cell source for regenerative medicine: differences between alveolar and iliac bone marrow stromal cells. Journal of Bone and Mineral Research. 20, (3), 399-409 (2005).
  13. Chan, C. K. F., et al. Identification of the Human Skeletal Stem Cell. Cell. 175, (1), 43-56 (2018).
  14. Bianco, P., Riminucci, M., Gronthos, S., Robey, P. G. Bone marrow stromal stem cells: nature, biology, and potential applications. Stem Cells. 19, (3), 180-192 (2001).
  15. Franken, N. A., Rodermond, H. M., Stap, J., Haveman, J., van Bree, C. Clonogenic assay of cells in vitro. Nature Protocol. 1, (5), 2315-2319 (2006).
  16. Xu, H., et al. Icariin prevents oestrogen deficiency-induced alveolar bone loss through promoting osteogenesis via STAT3. Cell Proliferation. 53, (2), 12743 (2020).
  17. Zhang, P., Wu, Y., Jiang, Z., Jiang, L., Fang, B. Osteogenic response of mesenchymal stem cells to continuous mechanical strain is dependent on ERK1/2-Runx2 signaling. Internation Journal of Molecular Medicine. 29, (6), 1083-1089 (2012).
  18. Zhu, H., et al. A protocol for isolation and culture of mesenchymal stem cells from mouse compact bone. Nature Protocol. 5, (3), 550-560 (2010).
  19. Lach, M. S., et al. Chondrogenic Differentiation of Pluripotent Stem Cells under Controllable Serum-Free Conditions. International Journal of Molecular Sciences. 20, (11), 2711 (2019).
  20. Huang, X., Zhong, L., Hendriks, J., Post, J. N., Karperien, M. The Effects of the WNT-Signaling Modulators BIO and PKF118-310 on the Chondrogenic Differentiation of Human Mesenchymal Stem Cells. International Journal of Molecular Sciences. 19, (2), 561 (2018).
  21. Gale, A. L., Linardi, R. L., McClung, G., Mammone, R. M., Ortved, K. F. Comparison of the Chondrogenic Differentiation Potential of Equine Synovial Membrane-Derived and Bone Marrow-Derived Mesenchymal Stem Cells. Frontiers in Veterinary Sciences. 6, 178 (2019).
  22. Li, X., Zhang, Y., Qi, G. Evaluation of isolation methods and culture conditions for rat bone marrow mesenchymal stem cells. Cytotechnology. 65, (3), 323-334 (2013).
  23. Kagami, H., Agata, H., Tojo, A. Bone marrow stromal cells (bone marrow-derived multipotent mesenchymal stromal cells) for bone tissue engineering: basic science to clinical translation. International Journal of Biochemistry and Cell Biology. 43, (3), 286-289 (2011).
  24. Chamberlain, G., Fox, J., Ashton, B., Middleton, J. Concise review: mesenchymal stem cells: their phenotype, differentiation capacity, immunological features, and potential for homing. Stem Cells. 25, (11), 2739-2749 (2007).
  25. Abdallah, B. M., Alzahrani, A. M., Abdel-Moneim, A. M., Ditzel, N., Kassem, M. A simple and reliable protocol for long-term culture of murine bone marrow stromal(mesenchymal) stem cells that retained their in vitro and in vivo stemness in long-term culture. Biology Proceedings Online. 21, 3 (2019).
Isolation og dyrkning af mandibular knoglemarv mesenchymale stamceller hos rotter
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).More

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter