Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Isolatie en teelt van mandibulaire beenmerg mesenchymale stamcellen bij ratten

doi: 10.3791/61532 Published: August 25, 2020
* These authors contributed equally

Summary

Dit artikel presenteert een methode die volledige beenmergaanhechting en flowcytometriesortering combineert voor het isoleren, cultiveren, sorteren en identificeren van beenmerg mesenchymale stamcellen uit rattenkaken.

Abstract

Hier presenteren we een efficiënte methode voor het isoleren en cultiveren van mandibulaire beenmerg mesenchymale stamcellen (mBMSC's) in vitro om snel talrijke hoogwaardige cellen te verkrijgen voor experimentele vereisten. mBMSC's kunnen op grote schaal worden gebruikt in therapeutische toepassingen als weefseltechnologiecellen in het geval van craniofaciale ziekten en cranio-maxillofaciale regeneratie in de toekomst vanwege het uitstekende zelfvernieuwingsvermogen en multi-lineage differentiatiepotentieel. Daarom is het belangrijk om mBMSC's in grote aantallen te verkrijgen.

In deze studie werd beenmerg uit de onderkaak gespoeld en werden primaire mBC's geïsoleerd door hele beenmergaanaanhechtingsteelt. Bovendien werden CD29+CD90+CD45 mBC's gezuiverd door fluorescerende celsortering. De tweede generatie gezuiverde mBC's werd gebruikt voor verder onderzoek en toonde potentieel bij het differentiëren in osteoblasten, adipocyten en chondrocyten. Met behulp van dit in vitro model kan men een groot aantal proliferatieve mBC's verkrijgen, wat de studie van de biologische kenmerken, de daaropvolgende reactie op het micromilieu en andere toepassingen van mBMSC's kan vergemakkelijken.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Beenmerg mesenchymale stamcellen (BMSC 's) zijn niet-hematopoëtische stamcellen afgeleid van beenmerg die een sterk proliferatievermogen en multi-lineage differentiatiepotentieel1,2,3,4manifesteren . Bmsc's worden inderdaad beschouwd als een ideale kandidaat voor botweefseltechnologie en regeneratie sinds ze werden ontdekt. Al jaren zijn de iliacale kuif of lange botten zoals het scheenbeen en dijbeen de meest voorkomende bron van BMSC's voor craniofaciale regeneratie. Orofaciale BMSC's, zoals mandibulaire BMSC's (mBMSC's), vertonen echter enkele verschillen met BMSC's met lange botten, zoals verschillende embryonale oorsprong en ontwikkelingspatroon. Kaken ontstaan uit neurale kuifcellen van de kiemlaag van het neuroectoderm en ondergaan intramembraneuze ossificatie, terwijl axiale en appendiculaire skeletten van het mesoderm zijn en endochondrale ossificatie ondergaan. Bovendien hebben klinische waarnemingen en experimentele dierstudies consequent aangetoond dat er functionele verschillen zijn tussen orofaciale en iliacale crest BMSC 's5,6,7,8. Rapporten hebben aangetoond dat BMSC's afgeleid van craniofaciale botten zoals onderkaak, maxillair bot en alveolair bot een superieure proliferatie, levensduur en differentiatiecapaciteit vertoonden dan die van axiale en appendiculaire botten9. mBMSC's worden daarom beschouwd als de voorkeursbronnen voor toekomstige therapeutische toepassingen van craniofaciale ziekten zoals cherubisme, kaaktumor, osteoporose van kaakbot en parodontale weefseldefect10,11,12. Om het behandelingspotentieel in preklinische experimenten te begrijpen, is het essentieel om een methode vast te stellen voor het snel isoleren en cultiveren van mBC's in vitro.

In deze studie was het doel om gezuiverde mBC's te verkrijgen door volledige beenmergaantrouwing en flowcytometriesortering. De anatomische morfologie van de onderkaak van ratten, duidelijk waargenomen door middel van micro-computertomografie (Micro-CT) en histologische secties, toonde aan dat het trabeculaire bot van de onderkaak zich tussen de snijtanden en het alveolaire bot bevond. Het beenmerg van trabeculair bot werd gespoeld om mandibulaire mergcellen te verkrijgen, maar de cellen die op deze manier werden gekweekt, waren geen zuivere mBMSC's en bestonden waarschijnlijk uit meerdere soorten cellen met onzekere potenties en diverse afstammingen zoals cellen uit bot-, vet- en endotheelcellen13,14. De volgende stap van celzuivering was bijzonder belangrijk. Flow cytometrie filtert cellen door het herkennen van een combinatie van cel-oppervlakte eiwitten en is op grote schaal toegepast in de verrijking van mesenchymale stamcellen. Celhomogeniteit is het belangrijkste voordeel van flowcytometrie, maar het proces bepaalt de levensvatbaarheid van cellen niet en kan resulteren in een beperkte celopbrengst. In deze studie werden de P0 mBMSC's verkregen uit volledige beenmergaantrouwing gesorteerd op flowcytometrie om mBC's met een hoge zuiverheid en sterke proliferatiecapaciteit te verkrijgen.

Deze studie introduceert een reproduceerbaar en betrouwbaar protocol voor isolatie, kweek en differentiatie van mandibulaire BMSC's van ratten met behulp van een combinatie van volledige beenmergaantrouwing en flowcytometriesortering. Het is een betrouwbare en handige methode voor onderzoekers op verwante gebieden om te gebruiken.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle dierproefprocedures in dit document werden goedgekeurd door het Animal Care Committee van het Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine.

1. Voorbereiding

  1. Gebruik twee 5 weken oude mannelijke Sprague Dawley ratten voor het experiment.
  2. Steriliseer alle instrumenten, inclusief naaldhouders, pincet en schaar op hoge temperatuur of ondergedompeld in 75% ethanol gedurende 10 minuten.
    OPMERKING: De onderdompeling van ethanol mag niet te lang zijn om celschade te voorkomen.
  3. Bereid cultuurmedia vooraf voor, waarvan de samenstelling is opgenomen in tabel 1. Vul elk medium aan zoals hieronder beschreven.
    1. Bereiding van α-MEM-kweekmedium (met 10% FBS): Vul minimaal essentieel medium alfa (α-MEM) aan met 10% foetale runderserum en 1% penicilline en streptomycine.
    2. Bereiding van osteogeen differentiatiemedium: Supplement osteogeen differentiatie basaal medium met 10% foetale runderserum, 1% glutamine, 1% penicilline-streptomycine, 0,20% ascorbinezuur, 1% β-glycerofosfaat en 0,01% dexamethason.
    3. Bereiding van osteogeen inductiemedium: Meng 70% α-MEM-kweekmedium (met 10% FBS) en 30% osteogeen differentiatiemedium.
    4. Bereiding van adipogeen differentiatiemedium A: Supplement adipogeen differentiatie basaal medium met 10% foetale runderserum, 1% glutamine, 1% penicilline-streptomycine, 0,20% insuline, 0,10% IBMX, 0,10% Rosiglitazon en 0,01% Dexamethason.
    5. Bereiding van adipogeen differentiatiemedium B: aanvulling op adipogeen differentiatie basaal medium met 10% foetale runderserum, 1% glutamine, 1% penicilline-streptomycine en 0,20% insuline.
    6. Bereiding van chondrogene differentiatiemedium: Supplement chondrogene differentiatie basaal medium met 0,01% Dexamethason, 0,30% Ascorbinezuur, 1% ITS, 0,10% Natrium pyruvaat, 0,10% Proline en 1% TGF-β3.
      OPMERKING: Het osteogene differentiatiemedium moet binnen een maand na de configuratie worden gebruikt. De effectieve periode van het geconfigureerde chondrogene differentiatiemedium is 12 uur.

2. Isolatie en teelt van rat mBMSC's

OPMERKING: Alle experimentele bewerkingen moeten zoveel mogelijk op ijs worden uitgevoerd om de levensvatbaarheid van de cellen te behouden.

  1. Het oogsten van ratten kaken
    1. Euthanaseer twee 5 weken oude mannelijke Sprague Dawley ratten door CO2 verstikking. Zorg ervoor dat de ademhaling van het dier wordt gestopt voordat u doorgaat met het experiment.
    2. Spoel deze ratten gedurende 3 minuten af in een bekerglas met 75% ethanol.
    3. Plaats de rat in een schone zuurkast om onderkaken te oogsten.
      OPMERKING: Steriliseer de zuurkast gedurende 30 minuten voor gebruik door ultraviolette lichtstraling.
    4. Plaats de rat in een liggende positie. Insnijd de huiden en buccinatorspieren van bilaterale angulus oris tot het achterste gebied van de onderkaak, het enige beweegbare bot met een lagere snijtuit.
      OPMERKING: Het wordt aanbevolen om een incisie van 2 cm aan elke kant van de angulus oris te maken om een duidelijk operatieveld te krijgen.
    5. Open de mond van de rat door de maxillaire en mandibulaire snijtanden met beide duimen in de tegenovergestelde richting te duwen om de mandibulaire tanden bloot te leggen, die aan de onderkaak zijn bevestigd.
    6. Koppel de buccale spieren en de pezen die aan de coracoïden en de inferieure rand van de onderkaak zijn bevestigd volledig los.
      OPMERKING: Een verhoogde mobiliteit van de onderkaak wordt tijdens deze stap waargenomen vanwege het gebrek aan spierspanning.
    7. Druk op de mandibulaire achterste tanden en draai naar achteren en naar beneden totdat de condyles aan beide zijden duidelijk zichtbaar zijn.
      OPMERKING: Deze stap wordt uitgevoerd om de mond van de rat zoveel mogelijk kunstmatig te openen om de condyle te ontwrichten. De onderkaak is verbonden met de schedel via bilaterale condyles, dus de blootstelling van de condyles leidt tot de ontkoppeling tussen de schedel en de onderkaak.
    8. Scheid het onderkaaklichaam van de schedel.
    9. Reinig het hechte zachte weefsel op het botoppervlak met een nat gaasje.
    10. Plaats het bot in een steriele glazen schaal van 10 cm gevuld met voorgekoelde minimaal essentiële medium-α (α-MEM) of fosfaatbufferoplossing (PBS) op ijs om de levensvatbaarheid te behouden.
  2. Isolatie en teelt van de mBMSC's
    1. Snijd het voorste bot langs de mesial rand van de eerste kies af van het mandibulaire lichaam. Verwijder de mandibulaire ramus inclusief coracoïde en condyle langs de distale rand van de derde kies om de mergholte bloot te leggen.
    2. Vul een steriele glazen schaal van 10 cm met 10 ml α-MEM (met 10% FBS).
    3. Gebruik 1 ml spuit om α-MEM kweekmedium te aspireren. Met de spuitnaald in de beenmergholte, spoelt u het beenmerg herhaaldelijk in de schaal. Spoel de botholte ten minste 3 keer van respectievelijk mesiale als distale zijden van het bot totdat het bot wit werd.
      OPMERKING: Dit is de meest kritieke stap, omdat de beenmergholte van een onderkaak van een rat niet zo duidelijk is als in lang bot en het juiste punt om de naald in te brengen empirisch moet worden bepaald. Alle experimentele monsters hierboven moeten op ijs worden opgeslagen om de levensvatbaarheid van de cellen te behouden en daarom mag de gebruiksduur niet langer zijn dan 2 uur.
    4. Breng de media met de gespoelde cellen over in een centrifugebuis van 15 ml en centrifugeer gedurende 5 minuten bij 800 x g in 4 °C. Gooi het supernatant weg.
    5. Resuspendeer de cellen met 3 ml α-MEM (met 10% FBS). Leg de cellen in een nieuwe kweekschaal van 10 cm en incubeer bij 37 °C in een CO2-incubator van 5%.
    6. Controleer de morfologische veranderingen en groei van deze cellen op de 3e dag van de cultuur. Verwijder het kweekmedium met niet-aadherente cellen en weefselfragmenten. Voeg voorzichtig 10 ml verse α-MEM toe (met 10% FBS).
    7. Na 7 dagen cultuur bereikten P0 mBMSC's 70% tot 80% samenvloeiing.
  3. Celsortering van stroom
    OPMERKING: P0 mBMSC's werden fenotypisch geïdentificeerd en voornamelijk gezuiverd door middel van stroomcelsortering.
    1. Aspireer en gooi het kweekmedium weg en was de schaal vervolgens met PBS. Gooi de PBS weg.
    2. Voeg 1 ml 0,25% trypsine met 0,02% EDTA toe aan de schaal. Verteer de cellen gedurende 5 minuten op 37 °C en voeg vervolgens 2 ml α-MEM (met 10% FBS) toe om de reactie te stoppen.
    3. Breng de celsuspensie over in een centrifugebuis van 15 ml en centrifugeer gedurende 5 minuten op 800 x g.
    4. Resuspend de cellen in 120 μL PBS (met 10% FBS) na centrifugeren.
    5. Blokkeer deze celsuspensies met 1 μL antilichaam tegen CD16/CD32 bij 4 °C gedurende 15 min.
    6. Breng 100 μL van de celsuspensie over in een nieuwe microcentrifugebuis, bevlek de cellen met Phycoerythrin (PE)-geconjugeerd antilichaam tegen CD45, fluoresceïne-isothiocyanaat (FITC)-geconjugeerd antilichaam tegen CD90 en Allofycocyanine (APC)-antilichaam tegen CD29 bij 4 °C gedurende 1 uur in het donker13,15. De concentratie antilichamen die in dit experiment wordt gebruikt , is weergegeven in tabel 2. Gebruik de andere 20 μL celsuspensie als niet-aangetaste negatieve controle.
    7. Centrifugeer vervolgens de buizen gedurende 5 minuten op 800 x g, gooi de suspensie weg en resuspendeer de cellen in 0,5 ml PBS (met 10% FBS).
    8. Voeg 10 μL 0,01 mg/ml DAPI toe gedurende 10 minuten vóór analyse.
    9. Gebruik 40 nm filters op centrifugebuizen om de cellen te filteren.
    10. Analyseer de cellen op fluorescentie-geactiveerde celsorteerder. Stel de panelen als volgt in. Verwijder eerst dode cellen uit het totale aantal cellen door DAPI-cellen te gaten en vervolgens CD29+CD90+CD45- in de geselecteerde cellen als gerichte mBMSC's te gaten.
    11. Verzamel de gesorteerde CD29+CD90+CD45- cellen in een centrifugebuis van 15 ml met 3 ml α-MEM (met 10% FBS) vooraf voorbereid.
    12. Centrifugeer de buizen gedurende 5 min op 800 x g. Verwijder de verzamelbuffer en voeg 1 ml verse α-MEM (met 10% FBS) toe om de cellen opnieuw te gebruiken. Leg ze vervolgens in een kweekschaal van 6 cm.

3. Kolonievormingsvermogen

OPMERKING: Deze stap is uitgevoerd om te controleren op de verdelingscapaciteit van mBC's. 15

  1. Selecteer tweede passage mBMSCs (P2) voor dit experiment. Wanneer de celconfluentie 80% tot 90% bereikte, herseed de cellen in een seriële gradiënt in een 6-putplaat om hun clonal proliferatievermogen te evalueren.
    OPMERKING: Het wordt aanbevolen om de gradiënt in te stellen van 1 x10 2 tot 1 x10 3 cellen per put, maar de uiteindelijke verdunningen van verschillende cellijnen van menselijke of dierlijke oorsprong werden empirisch bepaald.
  2. Kweek de cellen in α-MEM (met 10% FBS) gedurende ongeveer twee weken totdat een groot aantal kolonievormende eenheden onder lichtmicroscoop te zien was. Ververs het cultuurmedium om de 3 dagen.
  3. Aspireer en gooi het kweekmedium weg, was de putten twee keer gedurende 5 minuten per keer met PBS. Voeg vervolgens 4% paraformaldehyde-oplossing toe aan elke put en fixeer gedurende ten minste 10 minuten.
  4. Verwijder de paraformaldehyde en spoel de putten twee keer af met PBS.
  5. Bevlek de cellen met kristalviolet kleuroplossing en incubeer ze gedurende ongeveer 10 minuten in 37 °C.
    OPMERKING: De kleurtijd is op de juiste manier aangepast totdat de gewenste schaduw is bereikt.
  6. Verwijder de kleuroplossing en was de monsters met gedestilleerd water om de reactie te stoppen.
  7. Afbeelding onder een stereomicroscoop en telling verspreide celkolonies die uit ten minste 50 cellen bestonden.

4. Multilineage differentiatie van mBMSC's

OPMERKING: De P2 mBMSC's werden gebruikt voor latere experimenten, tenzij anders beschreven.

  1. Osteogene inductie van mBMSC's
    1. Verteer de mBC's zoals hierboven beschreven. Zaadcellen met een dichtheid van 2,5 x 105/cm2 in een 12 putplaat aangevuld met 1 ml α-MEM (met 10% FBS).
    2. Wanneer de celconfluentie 60-70% bereikte, verander het medium in 30% osteogene inductiemedia. Kweek de cellen met α-MEM (met 10% FBS) als een negatieve controle en verander het medium elke 2 dagen.
      OPMERKING: Nadat een groot aantal calciumknobbeltjes verschijnen tijdens osteogenese, wordt aanbevolen om het medium uitwisselingspatroon om de 2 dagen te veranderen in een medium uitwisseling van een half volume, om te voorkomen dat osteoblasten drijven.
    3. Beoordeel na zeven dagen cultiveren de verkalking van deze cellen door alkalische fosfatasekleuring16,17.
    4. Verwijder het kweekmedium en fixeer de cellen met 4% paraformaldehyde gedurende 10 minuten. Spoel de cellen twee keer met 1 ml PBS per put gedurende 3 minuten.
    5. Bevlek vervolgens de cellen met alkalische fosfatase kleuroplossing en incubeer bij 37 °C gedurende 10-30 minuten.
      OPMERKING: Incubatie kan 's nachts bij kamertemperatuur worden uitgevoerd om de gewenste kleur te verkrijgen.
    6. Was de putten met gedestilleerd water om de reactie te stoppen. Maak foto's onder een lichtmicroscoop. Rood gepigmenteerde korrels vertegenwoordigen alkalische fosfatase (ALP) activiteit.
    7. Na het cultiveren van de resterende cellen gedurende nog eens 7 dagen, voer alizarine rode kleuring uit om de mineralisatiecapaciteit van de cellen te evalueren.
    8. Bevlek de cellen met 0,5% alizarin rode kleuroplossing na celfixatie gedurende 10 min16,18. Stop de chromogene reactie met gedestilleerd water na 3-5 min.
      OPMERKING: De reactietijd kan worden verlengd, afhankelijk van de ontwikkelde kleur.
    9. Plaats ten slotte de kweekplaat onder de lichtmicroscoop om het effect van osteogene vlekken te observeren; rode knobbeltjes duiden op calciumafzettingen van deze cellen.
  2. Adipogene inductie van mBMSC's
    1. Seed P2 mBMSCs in een 12 well plaat zoals hierboven beschreven.
    2. Nadat de put 90% samenvloeiend is geworden, kweekt u de cellen met adipogeen differentiatiemedium A. Gebruik cellen gekweekt in α-MEM-cultuurmedium (met 10% FBS) als negatieve controle.
    3. Na 2 dagen inductie aspireert u het medium A uit de put en voegt u 1 ml adipogeen differentiatiemedium B toe aan elke put.
    4. Verwijder na één dag medium B en start de cyclus opnieuw met medium A dat weer in de put is toegevoegd. Kweek de cellen afwisselend met medium A en B.
    5. Breng het differentiatiemedium A en B afwisselend gedurende drie cycli aan en detecteer de adipogenese van deze cellen door olierode O-kleuring16,18.
      OPMERKING: Veel ronde en grote lipidedruppels kunnen worden waargenomen door deze cellen nog 2 tot 3 dagen te cultiveren met differentiatiemedium B.
    6. Verwijder het medium en bevestig de cellen met 4% paraformaldehyde gedurende 10 minuten. Was de cellen uit met PBS.
    7. Bevlek de cellen met olierode O-kleuroplossing en incubeer ongeveer 3 min bij 37 °C.
    8. Verwijder de kleuroplossing en was de putten met gedestilleerd water.
    9. Observeer adipogenese onder lichtmicroscoop.
  3. Chondrogenese inductie van mBMSC's
    1. Zaad P2 mBMSC's in 15 ml centrifugebuis met een dichtheid van 5 x 105/cm2.
    2. Centrifugeer de buizen gedurende 5 min op 300 x g. Gooi het supernatant weg.
    3. Resuspend de cellen met 0,5 ml chondrogene differentiatie medium. Centrifugeer de cellen gedurende 5 min op 300 x g.
    4. Draai de dop van de centrifugebuis los en incubeer deze bij 37 °C in een CO2-incubator van 5%. Vernieuw het medium om de 2 dagen.
      OPMERKING: Cellen beginnen na 24 uur met pellets. Het wordt aanbevolen om de centrifugebuis gedurende 48 uur niet te verplaatsen. Zorg ervoor dat u de celkorrel niet aspireert bij het verwisselen van het medium.
    5. Na 21 dagen inductie, fixeer de celkorrels met 4% paraformaldehyde, gevolgd door uitdroging, paraffine-inbedding en doorsnede.
    6. Na deparaffinisatie en hydratatie, beits de dia's in Alcian blauwe oplossing voor ten minste 15 min18,19,20,21,dan wassen met gedestilleerd water om de reactie te stoppen. Leg de foto's vast onder een lichtmicroscoop.
    7. Voer voor immunofluorescente kleuring van collageen type II de onderstaande stappen uit.
      1. Incubeer de dia's met 5 μg/ml proteïnase K gedurende 15 minuten bij 37 °C na de deparaffinisatie- en hydratatiestap.
      2. Incubeer de dia's in blokkeerbuffer gedurende 1 uur bij 37 °C.
      3. Breng 1 μL collageen type II-antilichaam in 200 μL blokkeerbuffer aan op de dia's en incubeer 's nachts bij 4 °C.
      4. Was de volgende dag de dia's tweemaal met PBS en incubeer met secundaire antilichamen bij 37 °C gedurende 1 uur.
      5. Incubeer de plakjes met 40,6-diamidino-2-fenylindole (DAPI) gedurende 10 min.
    8. Maak foto's van elke dia onder fluorescentiemicroscopie.

5. Real-time PCR

  1. Extract totale RNA uit mBMSC's met behulp van een guanidium isothiocyanaat gebaseerd op commercieel verkrijgbaar reagens.
  2. Voer omgekeerde transcriptie van RNA uit in complementair DNA met behulp van een in de handel verkrijgde kit. De reactieomstandigheden van omgekeerde transcriptie waren als volgt: 65 °C gedurende 5 min, 37 °C gedurende 15 min, 85 °C gedurende 15 s.
  3. Voer real-time PCR uit om osteogenese en adipogenese specifieke genen te detecteren met behulp van primers vermeld in tabel 3. De PCR-versterkingsprocedure was als volgt: 95 °C gedurende 5 min. 95 °C gedurende 5 s, 60 °C voor 30 s gedurende 40 cycli.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Met behulp van dit protocol hechtte een groot deel van de cellen zich aan de plaat op de derde dag na de eerste kweek. Meestal bereikte de celconfluentie na nog eens 3-4 dagen cultuur 70 tot 80% (figuur 1B). Bij fluorescerende celsortering werden DAPI-CD29+CD90+CD45 mBMSC's gezuiverd18,22, wat goed was voor ongeveer 81,1% in de P0-cellen (figuur 1C).

Na het zaaien van P2 mBMSC's op 100 cellen in elke put van 6 putplaat gedurende een week, werd een aanzienlijke hoeveelheid kolonievormende eenheden waargenomen, wat de significante kolonievormingscapaciteit van mBMSC's suggereerde (Figuur 1D).

Om het multi-lineage differentiatievermogen te beoordelen, werden de mBC's geïnduceerd in respectievelijk osteo-, chondro- en adipo-lineages in 12 putplaten. De mBMSC's vertoonden een sterk osteogeen differentiatievermogen. Verhoogde activiteit van ALP, rode calcific knobbeltjes sporadisch verdeeld onder alizarine rode kleuring, en verhoogde expressie van osteogene specifieke genen Runx2, Alp, Bsp en Ocn (Figuur 2) duidden op oestogene inductie. Voor adipogenese, geïdentificeerd door olierode-O-kleuring, waren talrijke lipiderijke vacuolen duidelijk na 9 dagen inductie. Evenzo vertoonde de expressie van adipogene specifieke genen Pparγ1 en Cebpa een significante toename (figuur 3). Voor microscopische observatie van chondrogene differentiatiedia's vertoonden de monsters positieve kleuring voor Alcisch blauw. Bovendien vertoonde immunostaining met anti-type II collageenantilichaam een verbeterde accumulatie van kraakbeenmatrix (figuur 4).

Cultuur Medium bestanddeel Definitieve concentratie
1.α-MEM cultuurmedium (met 10%FBS) α minimaal essentieel medium
Foetale runderserum 10%
Penicilline en streptomycine 1%
2.Osteogenic inductiemedium α-MEM cultuurmedium (met 10%FBS) 70%
Osteogene differentiatie differentiatie medium 30%
3.Osteogenic differentiatiemedium Osteogene differentiatie basaal medium
Foetale runderserum 10%
Glutamine 1%
Penicilline-Streptomycine 1%
Ascorbinezuur 0.20%
β-Glycerofosfaat 1%
Dexamethason 0.01%
4.Adipogenic differentiatiemedium A Adipogeen differentiatie basaal medium
Foetale runderserum 10%
Glutamine 1%
Penicilline-Streptomycine 1%
insuline 0.20%
IBMX 0.10%
Rosiglitazon 0.10%
Dexamethason 0.01%
5.Adipogenic differentiatiemedium B: Adipogeen differentiatie basaal medium
Foetale runderserum 10%
Glutamine 1%
Penicilline-Streptomycine 1%
insuline 0.20%
6.Chondrogene differentiatie medium: Chondrogenese differentiatie basiaal medium
Dexamethason 0.01%
Ascorbinezuur 0.30%
zijn 1%
Natrium pyruvaat 0.10%
Proline 0.10%
TGF-β3 1%

Tabel 1: Componenten van cultuurmedium en differentiatiemedium.

antistof concentratie
CD90.1 (Thy-1.1) Monoklonaal antilichaam 0,5 mg/ml
CD45 Monoklonaal antilichaam 0,2 mg/ml
CD29 Antilichaam 0,2 mg/ml
CollagenII konijn polyklonaal antilichaam 5mg/ml
Geit Anti-Konijn IgG H&L (Alexa Fluor® 488) 1mg/ml

Tabel 2: Antilichaamconcentratie gebruikt in dit onderzoek.

abc Volgorde(5' tot 3')
GAPDH Bron: CGGCAAGTTCAACGGCACAGTCAAGG
Keerzijde: ACGACATACTCAGCACCAGCATCACC
Runx2 Bron: GCCTTCAAGGTTGTAGCCCT
Keerzijde: TGAACCTGGCCACTTGGTTT
alp Bron: AAACTCGCTTATGGTCCCCG
Keerzijde: TGGGTTTGAATTCCTGCGGT
Bps Bron: GCACGGTTGAGTATGGGGAA
Keerzijde: ATCCTGACCCTCGTAGCCTT
Ocn Voorwaarts:CAACCCCAATTGTGACGAGC
Keerzijde:GGCAACACATGCCCTAAACG
Cebpa Bron: AGTCGGTGGATAAGAACAGCAACG
Keerzijde: CGGTCATTGTCACTGGTCAACTCC
Pparγ1 Bron: CCATCGAGGACATCCAAGACAACC
Keerzijde: GTGCTCTGTGACAATCTGCCTGAG

Tabel 3: Primers gebruikt in Real-time PCR.

Figure 1
Figuur 1: Isolatie en cultuur van mBMSC's. (A) Schematisch schema van het protocol. mBC's werden geïsoleerd en geplateerd op dag 0 en geïncubeerd met α-MEM-cultuurmedium. Op dag 7 werden de P0 mBMSC's gezuiverd door middel van flow cytometrie sorteren en werden de gesorteerde cellen geplateerd op een nieuwe kweekschaal. Op dag 14 werden P1 mBMSC's verzameld en plateren op 12-put plaat. Op dag 15 werden P2 mBMSC's geïnduceerd in osteoblasten, adipogene cellen en chondroblasten onder overeenkomstig inductiemedium. (B) Schematisch model van mandibulaire beenmerg van ratten en microscopische observatie van P0 mBMSC's. (C) Flow cytometrie sortering van rat mBMSC's. De flow cytometrie analyse toont aan dat deze cellen positief waren voor CD29 en CD90, maar negatief voor CD45, wat congruent is met BMSC kenmerken. Hiervan werden 1,4 x 106 cellen gesorteerd, wat goed was voor 80% van de totale cellen. (D) Representatief beeld van kristal violet bevlekte P2 mBMSC klonen. Klik hier om een grotere versie van deze afbeelding te bekijken.

Figure 2
Figuur 2: Osteogeen differentiatiepotentieel van mBMSC's. (A) Na 7 dagen osteogene inductie werd de verandering van ALP-activiteit gevisualiseerd. Grote aantallen gemineraliseerde knobbeltjes werden gekleurd onder alizarine rode kleuring op 14 dagen na inductie van osteogene differentiatie. (B,C) Het positieve gebied van ALP en alizarin rode kleuring werden geëvalueerd met behulp van Image J software. (C-G) De mRNA expressie van osteoblast-specifieke markers Runx2, Alp, Bsp en Ocn nam significant toe na 7 dagen osteogenese. Klik hier om een grotere versie van deze afbeelding te bekijken.

Figure 3
Figuur 3: Adipogeen differentiatiepotentieel van mBC's na negen dagen inductie. (A) Een grote hoeveelheid lipidedruppels en adipocyten werden gekleurd door olierode O. (B,C) De mRNA-expressie van adipogene markers Cebpa en Pparγ1 nam opmerkelijk toe na 9 dagen adipogenese. Klik hier om een grotere versie van deze afbeelding te bekijken.

Figure 4
Figuur 4: Stereoscope weergave van chondrogene differentiatie effect. (A) mBC's na 21 dagen chondrogene inductie vertoonden positief voor alcische blauwe kleuring. (B) Immunofluorescentiebeeld van chondrogenisch aggregaat gekleurd met anti-type II collageen. Klik hier om een grotere versie van deze afbeelding te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dit protocol beschrijft een methode om BMSC's in vitro te isoleren van rattenmankaken door volledige beenmergaantrouwing en fluorescerende celsortering te combineren, wat een eenvoudige en betrouwbare manier is om proliferatieve mBC's met een sterk differentiatievermogen te verkrijgen. Deze methode zou mBC's voorlopig kunnen zuiveren door celsortering, maar als er hogere eisen zijn aan celhomogeniteit, kunnen nauwkeurigere zuiveringsmethoden nodig zijn.

Momenteel zijn er vier hoofdtechnieken die worden gebruikt voor het isoleren van mBMSC's, waaronder volledige beenmergaanhechting, dichtheidsgradiëntcentrifugatie, fluorescerende celsortering en magnetisch geactiveerde celsortering22. Volledige beenmergaantrouwing en dichtheidsgradiëntcentrifugatie zijn de meest voorkomende en eenvoudige methoden die worden gebruikt om mBC's in korte tijd te verkrijgen, maar de lage zuiverheid van geoogste mBC's is hun grootste nadeel. De laatste twee methoden kunnen sterk gezuiverde mBC's isoleren door middel van immunologische technieken, maar hebben de tekortkomingen dat ze duur zijn, lang duren en de levensvatbaarheid van cellen aantasten. In deze studie werden de voordelen van volledige beenmergaanhechting en de fluorescerende celsorteermethode gecombineerd om in korte tijd voldoende proliferatieve mBC's te verkrijgen.

Ongetwijfeld is een van de meest kritieke stappen in dit protocol dissectie van de onderkaak van ratten, die heel anders is dan die van axiale en appendiculaire botten. Het is essentieel om de anatomie van de onderkaak van ratten te begrijpen om een intact monster te verkrijgen. Net als bij de mens zit de onderkaak van de rat onder de maxilla, houdt de ondertanden op zijn plaats en is verbonden met de schedel door bilaterale condyles. Omdat de onderkaak het enige bot is dat in de schedel kan bewegen, zijn er veel spieren aan de onderkaak bevestigd, die de beweging ervan regelen. Alleen door deze zachte weefsels volledig te verwijderen en de mond maximaal open te draaien, kunnen de condyles die verbinding maken met de schedel worden blootgesteld. Het is ook vermeldenswaard dat de condylle nek een fysieke zwakte in onderkaak is en gemakkelijk te breken is. Als er overmatige weerstand wordt gevonden bij het naar beneden draaien van de onderkaak, betekent dit dat de mastiekspieren mogelijk niet volledig zijn verwijderd. Wanneer dit wordt waargenomen, roteer het dan niet beperkt, anders is het gemakkelijk om de condylarhals te breken, wat leidt tot celverontreiniging. Andere moeilijkheden bij de scheiding en de kweek van mBMSC 's zijn een laag gehalte aan beenmerg, delicate celactiviteit, lage zuiverheid, lage celfrequentie en verontreiniging van hematopoëtische cellen18,23. Om mBC's met een goede groei en een relatief hoog differentiatiepotentieel te verkrijgen, is het van cruciaal belang om de activiteit van mBMSC's te waarborgen. Er zijn verschillende belangrijke stappen, waaronder het gebruik van vier weken oude ratten voor deze en daaropvolgende experimenten, omdat jonge ratten de voorkeur hebben om een goede levensvatbaarheid te behouden. Veel studies hebben bevestigd dat de activiteit van mBMSC's gerelateerd is aan de leeftijd van proefdieren. Deze mBC's van oudere donoren kunnen leiden tot een lagere proliferatieactiviteit, differentiatiepotentieel en levensduur2. Alle bewerkingen tijdens de celoogst moeten op ijs worden voltooid en de bewerkingstijd moet zo kort mogelijk zijn, bij voorkeur binnen 2 uur. Houd bovendien de trypsineverteringstijd niet langer dan 3 minuten. Tot slot is een andere uitdaging in dit protocol het proces van het oogsten van mBMSC's. Het kan lastig zijn om mBMSC's uit de botholte te spoelen omdat de holte van de onderkaak van ratten erg klein is, dus het is erg belangrijk om bekend te zijn met de anatomische structuur. Micro-CT beelden kunnen hierbij van grote hulp zijn. Bovendien is het vermeldensgeval dat, aangezien juveniele botten slank en broos zijn, breuk kan leiden tot besmetting.

Verwijzend naar immunofenotypische karakterisering, drukken BMSC's verschillende fenotypes uit, maar geen van hen is specifiek24. Het is algemeen aanvaard dat BMSC's cd11b, CD14, CD34 of CD45 niet uitdrukken, maar ze hebben een hoge expressie van Sca-1, CD29, CD90 en CD105. Deze studie koos de algemeen aanvaarde markers van CD29, CD90 en CD45 voor fluorescerende celsortering13,14,25. Het stelde vast dat CD29+CD90+CD45 cel goed was voor 80% van de totale cellen, wat voldoende was voor latere celkweek en onderzoek.

Al tientallen jaren wordt stamceltherapie veel gebruikt bij de behandeling van verschillende ziekten, zoals ziekten van het immuunsysteem, hematologische systemische ziekten, kankers of trauma. Ongetwijfeld kunnen mBMSC's, als vervanging voor BMSC's, worden gebruikt als een veiliger en krachtiger hulpmiddel in stamceltherapie vanwege hun superieure kenmerken. Celkweek en uitbreiding van mBMSC's worden daarom bijzonder belangrijk om voldoende cellen voor behandeling te verkrijgen.

Samengevat toonde deze studie een veelbelovend en betrouwbaar protocol aan om in korte tijd overvloedige mBC's met een hoge homogeniteit en multidifferentiatiecapaciteit te oogsten.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Alle auteurs verklaren dat ze geen belangenconflicten hebben.

Acknowledgments

We danken voor de hulp van Laboratory for Digitized Stomatology and Research Center for Craniofacial Anomalies of Shanghai Ninth People's Hospital. Het werk van dit manuscript wordt ondersteund door subsidies van de National Natural Science Foundation of China (NSFC) [81570950,81870740,81800949], Shanghai Summit & Plateau Disciplines, het SHIPM-mu fonds van Shanghai Institute of Precision Medicine, Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine [JC201809], het Incentive Project of High-level Innovation Team for Shanghai Jiao Tong University. En L.J. is een geleerde van de Outstanding Youth Medical Talents, Shanghai "Rising Stars of Medical Talent" Youth Development Program en het "Chen Xing" project van shanghai Jiaotong University.

Materials

Name Company Catalog Number Comments
0.25% Trypsin-EDTA(1X) Gibco 25200072
10cm culture dish Corning
acutenaculum
Adipogenic differentiation medium Cyagen biosciences inc. MUBMX-90031
Alcian Blue Beyotime Biotechnology
Alizarin red Sigma-Aldrich A5533
Alkaline Phosphatase Color Development Kit Beyotime Biotechnology C3206
alpha-Minimum essential medium GE Healthcare HyClone Cell Culture SH30265.01B
Anti -CollagenII Rabbit pAb Abcam ab34712
Antibodies against CD16/CD32
Antifade Mounting Medium with DAPI Beyotime Biotechnology P0131
APC anti-mouse/rat CD29 Antibody biolegend inc 102215
Biosafety cabinet Esco AC2-4S8-CN
CD45 Monoclonal Antibody (OX1), PE, eBioscience Invitrogen 12-0461-82
CD90.1 (Thy-1.1) Monoclonal Antibody (HIS51), FITC, eBioscience Invitrogen 11-0900-85
Centrifuge cence L500
Chondrogenesis differentiation medium cyagen biosciences inc.
Confocal laser scanning microscope Zeiss LSM880
Countess II FL Automated Cell Counter Invitrogen AMQAF1000
Crystal Violet Staining Solution Beyotime Biotechnology C0121
Fetal Bovine Serum GE Healthcare HyClone Cell Culture SH30084.03
Goat Anti-Rabbit IgG H&L (Alexa Fluor 488) abcam ab150077
Incubator Esco CCL-170B-8
Inverted microscope olympus CKX53
Magzol reagent(Trizol reagent) Magen
micropipettor Eppendorf
Oil Red O
Osteogenic differentiation medium cyagen biosciences inc. MUBMX-90021
Penicillin-Streptomycin Gibco 15070063
Phosphate-buffered saline(1X) Gibco 20012027
PrimeScript RT Master Kit TakaRa Bio Inc RR036A
Proteinase K Sigma-Aldrich P6556
QuickBlock Blocking Buffer Beyotime Biotechnology P0260
scissor
SYBR1 Premix TakaRa Bio Inc
Toluidine Blue Beyotime Biotechnology
Trypan Blue Solution, 0.4% Gibco 15250061

DOWNLOAD MATERIALS LIST

References

  1. Jin, C., et al. Stem cell education for medical students at Tongji University: Primary cell culture and directional differentiation of rat bone marrow mesenchymal stem cells. Biochemistry and Molecular Biology Education. 46, (2), 151-154 (2018).
  2. Chu, D. T., et al. An Update on the Progress of Isolation, Culture, Storage, and Clinical Application of Human Bone Marrow Mesenchymal Stem/Stromal Cells. International Journal of Molecular Sciences. 21, (3), 708 (2020).
  3. Jin, Z., Chen, J., Shu, B., Xiao, Y., Tang, D. Bone mesenchymal stem cell therapy for ovariectomized osteoporotic rats: a systematic review and meta-analysis. BMC Musculoskeleton Disorder. 20, (1), 556 (2019).
  4. Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, (6893), 41-49 (2002).
  5. Musina, R. A., Bekchanova, E. S., Belyavskii, A. V., Sukhikh, G. T. Differentiation potential of mesenchymal stem cells of different origin. Bulletin of Experimental Biology and Medicine. 141, (1), 147-151 (2006).
  6. Lloyd, B., et al. Similarities and differences between porcine mandibular and limb bone marrow mesenchymal stem cells. Archives in Oral Biology. 77, 1-11 (2017).
  7. Zhang, W., et al. Comparison of the use of adipose tissue-derived and bone marrow-derived stem cells for rapid bone regeneration. Journal of Dental Research. 92, (12), 1136-1141 (2013).
  8. Stefanik, D., et al. Disparate osteogenic response of mandible and iliac crest bone marrow stromal cells to pamidronate. Oral Disorders. 14, (5), 465-471 (2008).
  9. Aghaloo, T. L., et al. Osteogenic potential of mandibular vs. long-bone marrow stromal cells. Journal of Dental Research. 89, (11), 1293-1298 (2010).
  10. Kaigler, D., et al. Stem cell therapy for craniofacial bone regeneration: a randomized, controlled feasibility trial. Cell Transplantation. 22, (5), 767-777 (2013).
  11. Li, C., Wang, F., Zhang, R., Qiao, P., Liu, H. Comparison of proliferation and osteogenic differentiation potential of rat mandibular and femoral bone marrow mesenchymal stem cells in vitro. Stem Cells Development. 2020, 1941629 (2020).
  12. Matsubara, T., et al. Alveolar bone marrow as a cell source for regenerative medicine: differences between alveolar and iliac bone marrow stromal cells. Journal of Bone and Mineral Research. 20, (3), 399-409 (2005).
  13. Chan, C. K. F., et al. Identification of the Human Skeletal Stem Cell. Cell. 175, (1), 43-56 (2018).
  14. Bianco, P., Riminucci, M., Gronthos, S., Robey, P. G. Bone marrow stromal stem cells: nature, biology, and potential applications. Stem Cells. 19, (3), 180-192 (2001).
  15. Franken, N. A., Rodermond, H. M., Stap, J., Haveman, J., van Bree, C. Clonogenic assay of cells in vitro. Nature Protocol. 1, (5), 2315-2319 (2006).
  16. Xu, H., et al. Icariin prevents oestrogen deficiency-induced alveolar bone loss through promoting osteogenesis via STAT3. Cell Proliferation. 53, (2), 12743 (2020).
  17. Zhang, P., Wu, Y., Jiang, Z., Jiang, L., Fang, B. Osteogenic response of mesenchymal stem cells to continuous mechanical strain is dependent on ERK1/2-Runx2 signaling. Internation Journal of Molecular Medicine. 29, (6), 1083-1089 (2012).
  18. Zhu, H., et al. A protocol for isolation and culture of mesenchymal stem cells from mouse compact bone. Nature Protocol. 5, (3), 550-560 (2010).
  19. Lach, M. S., et al. Chondrogenic Differentiation of Pluripotent Stem Cells under Controllable Serum-Free Conditions. International Journal of Molecular Sciences. 20, (11), 2711 (2019).
  20. Huang, X., Zhong, L., Hendriks, J., Post, J. N., Karperien, M. The Effects of the WNT-Signaling Modulators BIO and PKF118-310 on the Chondrogenic Differentiation of Human Mesenchymal Stem Cells. International Journal of Molecular Sciences. 19, (2), 561 (2018).
  21. Gale, A. L., Linardi, R. L., McClung, G., Mammone, R. M., Ortved, K. F. Comparison of the Chondrogenic Differentiation Potential of Equine Synovial Membrane-Derived and Bone Marrow-Derived Mesenchymal Stem Cells. Frontiers in Veterinary Sciences. 6, 178 (2019).
  22. Li, X., Zhang, Y., Qi, G. Evaluation of isolation methods and culture conditions for rat bone marrow mesenchymal stem cells. Cytotechnology. 65, (3), 323-334 (2013).
  23. Kagami, H., Agata, H., Tojo, A. Bone marrow stromal cells (bone marrow-derived multipotent mesenchymal stromal cells) for bone tissue engineering: basic science to clinical translation. International Journal of Biochemistry and Cell Biology. 43, (3), 286-289 (2011).
  24. Chamberlain, G., Fox, J., Ashton, B., Middleton, J. Concise review: mesenchymal stem cells: their phenotype, differentiation capacity, immunological features, and potential for homing. Stem Cells. 25, (11), 2739-2749 (2007).
  25. Abdallah, B. M., Alzahrani, A. M., Abdel-Moneim, A. M., Ditzel, N., Kassem, M. A simple and reliable protocol for long-term culture of murine bone marrow stromal(mesenchymal) stem cells that retained their in vitro and in vivo stemness in long-term culture. Biology Proceedings Online. 21, 3 (2019).
Isolatie en teelt van mandibulaire beenmerg mesenchymale stamcellen bij ratten
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).More

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter