Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Isolement et culture de cellules souches mésenchymateuses de moelle osseuse mandibulaire chez le rat

doi: 10.3791/61532 Published: August 25, 2020
* These authors contributed equally

Summary

Cet article présente une méthode qui combine l’adhérence entière de moelle et le tri cytometry d’écoulement pour isoler, cultiver, trier, et identifier des cellules souches mésenchymateuses de moelle des mâchoires de rat.

Abstract

Nous présentons ici une méthode efficace pour isoler et cultiver des cellules souches mésenchymateuses de moelle osseuse mandibulaire (mBMSCs) in vitro afin d’obtenir rapidement de nombreuses cellules de haute qualité pour des exigences expérimentales. MBMSCs pourrait être largement utilisé dans des applications thérapeutiques comme cellules d’ingénierie tissulaire en cas de maladies craniofaciales et de régénération cranio-maxillofaciale à l’avenir en raison de l’excellente capacité d’auto-renouvellement et du potentiel de différenciation multi-lignée. Par conséquent, il est important d’obtenir des mBMSCs en grand nombre.

Dans cette étude, la moelle a été rincée de la mâchoire inférieure et mBMSCs primaires ont été isolés par la culture adhérente entière de moelle. De plus, les CD29+CD90+CD45 mBMSCs ont été purifiés par tri des cellules fluorescentes. La deuxième génération de mBMSCs purifiés a été employée pour davantage d’étude et a montré le potentiel en différenciant en osteoblasts, adipocytes, et chondrocytes. En utilisant ce modèle in vitro, on peut obtenir un nombre élevé de mBMSCs prolifératifs, ce qui peut faciliter l’étude des caractéristiques biologiques, la réaction subséquente au microenvironnement, et d’autres applications des mBMSCs.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Les cellules souches mésenchymateuses de la moelle osseuse (BMSC) sont des cellules souches non hématopoïétiques dérivées de la moelle osseuse qui manifestent une forte capacité de prolifération et un potentiel de différenciation multi-lignée1,2,3,4. En effet, les BMSC ont été considérés comme un candidat idéal pour l’ingénierie et la régénération des tissus osseux depuis leur découverte. Pendant des années, la crête iliaque ou les longs os tels que le tibia et le fémur ont été la source la plus commune de BMSCs pour la régénération craniofacial. Cependant, les BMSC orofaciales, telles que les BMSCs mandibulaires (mBMSCs), montrent quelques différences par rapport aux BMSCs d’os long, telles que l’origine embryonnaire différente et le modèle de développement. Les mâchoires-nez résultent des cellules neurales de crête de la couche de germe de neuroectoderm et subissent l’ossification intramembranous, alors que les squelettes axiaux et appendiculaires sont du mesoderm et subissent l’ossification endochondral. De plus, les observations cliniques et les études expérimentales sur les animaux ont constamment indiqué qu’il existe des différences fonctionnelles entre les BMSC orofaciales et iliaques5,6,7,8. Les rapports ont prouvé que BMSCs dérivé de l’os craniofacial tel que la mâchoire inférieure, l’os maxillaire, et l’os alvéolaire ont montré la prolifération supérieure, la durée, et la capacité de différentiation que ceux des os axiaux et appendiculaires9. Les mBMSCs sont donc considérés comme les ressources privilégiées pour les futures applications thérapeutiques des maladies craniofaciales telles que le chérubinisme, la tumeur de la mâchoire, l’ostéoporose de l’os de la mâchoire et le défaut du tissu parodontal10,11,12. Pour comprendre le potentiel de traitement dans les expériences précliniques, il est essentiel d’établir une méthode pour isoler et cultiver rapidement les mBMSCs in vitro.

Dans cette étude, le but était d’obtenir des mBMSCs purifiés par l’adhérence entière de moelle et le tri cytométrique de flux. La morphologie anatomique de la mâchoire inférieure de rat, clairement observée par la micro tomographie calculée (Micro-CT) et les sections histologiques, a prouvé que l’os trabecular de la mâchoire inférieure était entre l’espace médullaire d’incisives et l’os alvéolaire. La moelle osseuse de l’os trabéculaire a été rincée pour obtenir des cellules mandibulaires de la moelle osseuse, mais les cellules ainsi cultivées n’étaient pas des mBMSCs purs et étaient susceptibles d’être constituées de multiples types de cellules aux puissances incertaines et aux lignées diverses telles que les cellules des cellules osseuses, adipeuses et endothéliales13,14. La prochaine étape de la purification cellulaire était particulièrement importante. La cytométrie en flux filtre les cellules en reconnaissant une combinaison de protéines cellule-surface et a été largement adoptée dans l’enrichissement des cellules souches mésenchymateuses. L’homogénéité cellulaire est le principal avantage de la cytométrie en flux, mais le processus ne détermine pas la viabilité cellulaire et peut entraîner un rendement cellulaire limité. Dans cette étude, les mBMSCs P0 obtenus à partir de l’adhérence entière de moelle ont été triés par cytométrie de flux pour obtenir des mBMSCs avec la haute pureté et la capacité forte de prolifération.

Cette étude introduit un protocole reproductible et fiable pour l’isolement, la culture, et la différenciation de BMSCs mandibulaire de rat utilisant une combinaison d’adhérence entière de moelle et de tri cytometry d’écoulement. C’est une méthode fiable et pratique à utiliser pour les chercheurs dans des domaines connexes.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Toutes les procédures expérimentales animales dans ce document ont été approuvées par le Comité de soins aux animaux du neuvième hôpital populaire de Shanghai, École de médecine de l’Université Jiao Tong de Shanghai.

1. Préparation

  1. Utilisez deux rats Sprague Dawley mâles de 5 semaines pour l’expérience.
  2. Stérilisez tous les instruments, y compris les porte-aiguilles, les pinces et les ciseaux à haute température ou immergés dans de l’éthanol à 75% pendant 10 min.
    REMARQUE: L’immersion à l’éthanol ne doit pas être trop longue pour éviter les dommages aux cellules.
  3. Préparer au préalable les milieux de culture, dont la composition est fournie dans le tableau 1. Complétez chaque support comme décrit ci-dessous.
    1. Préparation du milieu de culture α-MEM (avec 10% FBS): Compléter l’alpha du milieu essentiel minimum (α-MEM) avec 10% de sérum fœtal bovin et 1% de pénicilline et de streptomycine.
    2. Préparation du milieu de différenciation ostéogénique: Compléter le milieu basal de différenciation ostéogénique avec 10% de sérum fœtal bovin, 1% de glutamine, 1% de pénicilline-streptomycine, 0,20% d’acide ascorbique, 1% de β-glycérophosphate et 0,01% dexaméthasone.
    3. Préparation du milieu d’induction ostéogénique: Mélanger 70% α-MEM milieu de culture (avec 10% FBS) et 30% milieu de différenciation ostéogénique.
    4. Préparation du milieu de différenciation adipogène A: Compléter le milieu basal de différenciation adipogène avec 10% de sérum fœtal bovin, 1% de glutamine, 1% de pénicilline-streptomycine, 0,20% d’insuline, 0,10% IBMX, 0,10% rosiglitazone et 0,01% de dexaméthasone.
    5. Préparation du milieu B de différenciation adipogène: supplément de milieu basal de différenciation adipogène avec 10% de sérum bovin fœtal, 1% de glutamine, 1% de pénicilline-streptomycine et 0,20% d’insuline.
    6. Préparation du milieu de différenciation chondrogène: Compléter le milieu basal de différenciation chondrogène avec 0,01% de dexaméthasone, 0,30% d’acide ascorbique, 1% ITS, 0,10% pyruvate de sodium, 0,10% proline et 1% TGF-β3.
      REMARQUE: Le milieu de différenciation ostéogénique doit être utilisé dans le mois suivant la configuration. La période effective du milieu de différenciation chondrogène configuré est de 12 h.

2. Isolement et culture des mBMSC de rat

NOTA : Toutes les opérations expérimentales devraient être effectuées sur la glace dans la mesure du possible pour maintenir la viabilité des cellules.

  1. Récolte des mandibules de rat
    1. Euthanasier deux rats mâles de Sprague Dawley âgés de 5 semaines par asphyxie de CO2. Assurez-vous que la respiration de l’animal est arrêtée avant de poursuivre l’expérience.
    2. Rincez ces rats dans un bécher contenant 75% d’éthanol pendant 3 min.
    3. Placez le rat à l’intérieur d’une hotte propre pour récolter les mandibules.
      REMARQUE: Stériliser la hotte par rayonnement ultraviolet pendant 30 min avant utilisation.
    4. Placez le rat en décubitus dorsal. Incise les peaux et les muscles buccinateurs de l’oris bilatéral d’angulus à la région postérieure de la mâchoire inférieure, qui est le seul os mobile avec l’inciseur inférieure.
      REMARQUE: Il est recommandé de faire une incision de 2 cm de chaque côté de l’oris angulus pour obtenir un champ d’opération clair.
    5. Ouvrez la bouche du rat en poussant les incisives maxillaires et mandibulaires vers la direction opposée avec les deux pouces pour exposer les dents mandibulaires, qui sont attachées à la mandibule.
    6. Déconnectez complètement les muscles buccaux et les tendons attachés aux coracoïdes et à la bordure inférieure de la mandibule.
      REMARQUE: Une mobilité accrue de la mandibule est observée au cours de cette étape en raison de l’absence de tension musculaire.
    7. Appuyez sur les dents postérieures mandibulaires et tournez vers l’arrière et vers le bas jusqu’à ce que les condyles des deux côtés soient clairement exposés.
      REMARQUE: Cette étape est effectuée pour ouvrir artificiellement la bouche du rat dans toute la mesure du possible pour disloquer le condyle. La mandibule est reliée au crâne par des condyles bilatéraux, de sorte que l’exposition des condyles conduit à la déconnexion entre le crâne et la mandibule.
    8. Séparez le corps de la mandibule du crâne.
    9. Nettoyez les tissus mous adhérents sur la surface osseuse à l’aide d’une gaze humide.
    10. Placez l’os dans un plat en verre stérile de 10 cm rempli de α milieu essentiel minimum (α-MEM) ou de tampon phosphate salin (PBS) pré-frais pré-tampon sur la glace pour préserver la viabilité.
  2. Isolement et culture des mBMSCs
    1. Couper l’os antérieur le long du bord mésial de la première molaire du corps mandibulaire. Enlever le ramus mandibulaire comprenant la coracoïde et le condyle le long du bord distal de la troisième molaire pour exposer la cavité de moelle /courgette.
    2. Remplissez un plat en verre stérile de 10 cm avec 10 mL de α-MEM (avec 10% fbs).
    3. Utilisez une seringue de 1 mL pour aspirer α-MEM. Avec l’aiguille de la seringue insérée dans la cavité de la moelle osseuse, rincer à plusieurs reprises la moelle osseuse dans le plat. Rincer la cavité osseuse au moins 3 fois des côtés mésial et distal de l’os, respectivement, jusqu’à ce que l’os soit devenu blanc.
      REMARQUE: Il s’agit de l’étape la plus critique, car la cavité de la moelle osseuse d’une mandibule de rat n’est pas aussi évidente que dans l’os long et le point approprié pour insérer l’aiguille doit être déterminé empiriquement. Tous les échantillons expérimentaux ci-dessus doivent être stockés sur de la glace pour maintenir la viabilité cellulaire et donc le temps de fonctionnement ne doit pas dépasser 2 h.
    4. Transférer le support contenant les cellules rincées dans un tube à centrifuger de 15 mL et centrifuger à 800 x g dans 4 °C pendant 5 min. Jetez le surnageant.
    5. Ressuscitez les cellules avec 3 mL de α-MEM (avec 10% FBS). Plaquer les cellules dans un nouveau plat de culture de 10 cm et incuber à 37 °C dans un incubateur à 5 % deCO2.
    6. Vérifiez les changements morphologiques et la croissance de ces cellules le 3ème jour de culture. Retirer le milieu de culture avec des cellules non ahérientes et des fragments de tissu. Ajouter doucement 10 mL de α-MEM frais (avec 10% fbs).
    7. Après 7 jours de culture, les MBMSC P0 ont atteint 70% à 80% de confluence.
  3. Tri des cellules de flux
    REMARQUE: Les mBMSC P0 ont été identifiés phénotypiquement et principalement purifiés par tri des cellules d’écoulement.
    1. Aspirez et jetez le milieu de culture, puis lavez le plat avec du PBS. Jetez le système de fourchettes de prix.
    2. Ajouter 1 mL de trypsine à 0,25 % avec 0,02 % d’EDTA dans le plat. Digérer les cellules à 37 °C pendant 5 min, puis ajouter 2 mL de α-MEM (avec 10 % de FBS) pour arrêter la réaction.
    3. Transférer la suspension des cellules dans un tube à centrifuger de 15 mL et centrifuger à 800 x g pendant 5 min.
    4. Ressusciter les cellules dans 120 μL de PBS (avec 10% fbs) après centrifugation.
    5. Bloquer ces suspensions cellulaires avec 1 μL d’anticorps contre CD16/CD32 à 4 °C pendant 15 min.
    6. Transférer 100 μL de la suspension cellulaire dans un nouveau tube microcentrifuge, colorer les cellules avec de l’anticorps conjugué à la phycoérythrine (PE) contre CD45, de l’anticorps conjugué à la fluorescéine-isothiocyanate (FITC) contre le CD90 et de l’anticorps allophycocyanique (APC)-contre le CD29 à 4 °C pendant 1 h dans l’obscurité13,15. La concentration d’anticorps utilisés dans cette expérience est indiquée dans le tableau 2. Utilisez les 20 μL de suspension cellulaire autres comme témoin négatif non coloré.
    7. Ensuite, centrifugez les tubes à 800 x g pendant 5 min, jetez la suspension et ressuscitez les cellules dans 0,5 mL de PBS (avec 10% fbs).
    8. Ajouter 10 μL de DAPI de 0,01 mg/mL pendant 10 min avant l’analyse.
    9. Utilisez des filtres de 40 nm placés sur des tubes à centrifuger pour filtrer les cellules.
    10. Analysez les cellules sur le trieur de cellules activé par fluorescence. Définissez les panneaux comme suit. Tout d’abord, retirez les cellules mortes du nombre total de cellules en gating DAPI- cellules, puis porte CD29+CD90+CD45- dans les cellules sélectionnées en tant que mBMSCs ciblés.
    11. Recueillir les cellules triées CD29+CD90+CD45dans un tube centrifuge de 15 mL avec 3 mL de α-MEM (avec 10% FBS) pré-préparé.
    12. Centrifuger les tubes à 800 x g pendant 5 min. Retirez le tampon de collecte et ajoutez 1 mL de α-MEM frais (avec 10% FBS) pour ressusciter les cellules. Ensuite, plaquez-les dans un plat de culture de 6 cm.

3. Capacité de formation des colonies

Remarque : Cette étape a été effectuée pour vérifier la capacité de division des mBMSCs. 15 ans

  1. Sélectionnez les mBMSC de deuxième passage (P2) pour cette expérience. Lorsque la confluence cellulaire a atteint 80% à 90%, réenseménagé les cellules dans un gradient sériel dans une plaque de 6 puits pour évaluer leur capacité de prolifération clonale.
    NOTA: Il est recommandé de définir le gradient de 1 x 102 à 1 x 103 cellules par puits, mais les dilutions finales de différentes lignées cellulaires d’origine humaine ou animale ont été déterminées empiriquement.
  2. Culturez les cellules dans α-MEM (avec 10% FBS) pendant environ deux semaines jusqu’à ce qu’un bon nombre d’unités formant colonies puissent être vues au microscope optique. Actualisez le support de culture tous les 3 jours.
  3. Aspirer et jeter le milieu de culture, laver les puits avec du PBS deux fois pendant 5 min à la fois. Ensuite, ajoutez une solution de paraformaldéhyde à 4% à chaque puits et fixez pendant au moins 10 min.
  4. Retirer le paraformaldéhyde et rincer les puits deux fois avec du PBS.
  5. Colorer les cellules avec une solution de coloration cristalline violette et les incuber à 37 °C pendant environ 10 min.
    REMARQUE: Le temps de coloration ajusté de manière appropriée jusqu’à ce que l’ombre souhaitée soit atteinte.
  6. Retirez la solution de coloration et lavez les échantillons avec de l’eau distillée pour arrêter la réaction.
  7. Image sous stéréomicroscope et comptage des colonies de cellules dispersées qui se composaient d’au moins 50 cellules.

4. Différenciation multilinéaire des MBMSC

NOTA : Les MBMSC P2 ont été utilisés pour des expériences subséquentes, sauf indication contraire.

  1. Induction ostéogénique de mBMSCs
    1. Digérer les mBMSCs comme décrit ci-dessus. Cellules de semence à une densité de 2,5 x 105/cm2 dans une plaque de 12 puits complétée par 1 mL α-MEM (avec 10% FBS).
    2. Lorsque la confluence cellulaire a atteint 60-70%, changez le milieu en milieu d’induction ostéogénique à 30%. Culturez les cellules avec α-MEM (avec 10% FBS) comme contrôle négatif et changez le milieu tous les 2 jours.
      REMARQUE: Après l’apparition d’un grand nombre de nodules de calcium au cours de l’ostéogenèse, il est recommandé de changer le modèle d’échange moyen à un échange moyen à demi-volume tous les 2 jours, afin d’empêcher les ostéoblastes de flotter.
    3. Après culture pendant sept jours, évaluer la calcification de ces cellules par coloration phosphatase alcaline16,17.
    4. Retirer le milieu de culture et fixer les cellules avec 4% de paraformaldéhyde pendant 10 min. Rincer les cellules à l’aide de 1 mL de PBS par puits pendant 3 min deux fois.
    5. Ensuite, colorez les cellules avec une solution de coloration de phosphatase alcaline et incuber à 37 ° C pendant 10-30 min.
      REMARQUE: L’incubation peut être effectuée pendant la nuit à température ambiante pour obtenir la couleur requise.
    6. Lavez les puits avec de l’eau distillée pour arrêter la réaction. Prenez des photos au microscope optique. Les granules pigmentés rouges représentent l’activité de la phosphatase alcaline (ALP).
    7. Après avoir culture les cellules restantes pendant encore 7 jours, effectuez une coloration rouge à l’alizarine pour évaluer la capacité de minéralisation des cellules.
    8. Colorer les cellules avec une solution de coloration rouge à 0,5% d’alizarine après fixation cellulaire pendant 10 min16,18. Arrêtez la réaction chromogène avec de l’eau distillée après 3-5 min.
      REMARQUE: Le temps de réaction peut être prolongé en fonction de la couleur développée.
    9. Enfin, placez la plaque de culture sous le microscope optique pour observer l’effet de la coloration ostéogénique; les nodules rouges indiquent des dépôts de calcium de ces cellules.
  2. Induction adipogène de mBMSCs
    1. Semences P2 mBMSC dans une plaque de 12 puits comme décrit ci-dessus.
    2. Après le puits devenir 90% confluent, culturez les cellules avec le milieu de différenciation adipogène A. Utilisez des cellules cultivées dans α-MEM milieu de culture (avec 10% FBS) comme contrôle négatif.
    3. Après 2 jours d’induction, aspirer le milieu A du puits et ajouter 1 mL de milieu de différenciation adipogène B dans chaque puits.
    4. Après une journée, retirez le milieu B et recommencez le cycle avec le milieu A rajouté dans le puits. Culturer les cellules alternativement en utilisant le milieu A et B.
    5. Appliquer alternativement le milieu de différenciation A et B pendant trois cycles et détecter l’adipogenèse de ces cellules par coloration huile rouge O16,18.
      REMARQUE: Beaucoup de gouttelettes lipidiques rondes et grosses peuvent être observées en cultivant ces cellules avec le milieu de différenciation B pendant 2 à 3 jours supplémentaires.
    6. Retirez le milieu et fixez les cellules avec du paraformaldéhyde à 4% pendant 10 min. Laver les cellules avec du PBS.
    7. Colorer les cellules avec une solution de coloration au rouge O d’huile et incuber à 37 °C pendant environ 3 min.
    8. Retirez la solution de coloration et lavez les puits avec de l’eau distillée.
    9. Observer l’adipogenèse au microscope optique.
  3. Induction de chondrogenèse de mBMSCs
    1. Graines P2 mBMSC dans un tube à centrifuger de 15 mL à une densité de 5 x 105/cm2.
    2. Centrifuger les tubes à 300 x g pendant 5 min. Jetez le surnageant.
    3. Ressuscitez les cellules avec 0,5 ml de milieu de différenciation chondrogenic. Centrifuger les cellules à 300 x g pendant 5 min.
    4. Desserrez le capuchon du tube à centrifuger et incuber à 37 °C dans un incubateur à 5 % de CO2. Renouveler le support tous les 2 jours.
      REMARQUE: Les cellules commencent à enrober après 24 h. Il est recommandé de ne pas déplacer le tube de centrifugation pendant 48 h. Veillez à ne pas aspirer la pastille cellulaire lors du changement de milieu.
    5. Après 21 jours d’induction, fixer les pastilles cellulaires avec du paraformaldéhyde à 4%, suivi de déshydratation, d’encastrement de paraffine et de sectionnement.
    6. Après déparaffination et hydratation, colorer les lames dans une solution bleue d’Alcian pendant au moins 15 min18,19,20,21,puis laver à l’eau distillée pour arrêter la réaction. Capturez les photographies au microscope optique.
    7. Pour la coloration immunofluorescente du collagène de type II, effectuez les étapes ci-dessous.
      1. Incuber les lames avec 5 μg/mL de protéinase K pendant 15 min à 37 °C après l’étape de déparaffination et d’hydratation.
      2. Incuber les lames dans un tampon de blocage pendant 1 h à 37 °C.
      3. Appliquer 1 μL d’anticorps de collagène de type II dans 200 μL de tampon de blocage sur les lames et incuber pendant la nuit à 4 °C.
      4. Le lendemain, lavez deux fois les lames avec du PBS et incuber avec des anticorps secondaires à 37 °C pendant 1 h.
      5. Incuber les tranches avec 40,6-diamidino-2-phenylindole (DAPI) pendant 10 min.
    8. Prenez des photos de chaque lame sous microscopie à fluorescence.

5. PCR en temps réel

  1. Extraire l’ARN total des mBMSCs à l’aide d’un réactif disponible dans le commerce à base d’isothiocyanate de guanidium.
  2. Effectuer la transcription inverse de l’ARN en ADN complémentaire à l’aide d’un kit disponible dans le commerce. Les conditions de réaction de la transcription inverse étaient les suivantes : 65 °C pendant 5 min, 37 °C pendant 15 min, 85 °C pendant 15 s.
  3. Effectuer une PCR en temps réel pour détecter des gènes spécifiques à l’ostéogenèse et à l’adipogenèse à l’aide d’amorces énumérées dans le tableau 3. La procédure d’amplification par PCR était la suivante : 95 °C pendant 5 min. 95 °C pendant 5 s, 60 °C pendant 30 s pendant 40 cycles.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

En utilisant ce protocole, une grande partie des cellules ont adhéré à la plaque le troisième jour après la culture initiale. Typiquement, après 3-4 jours supplémentaires de culture, la confluence cellulaire a atteint 70 à 80% (Figure 1B). Avec le tri des cellules fluorescentes, DAPI-CD29+CD90+CD45 mBMSCs ont été purifiés18,22,ce qui représentait environ 81,1% dans les cellules P0(Figure 1C).

Après l’ensemencement de P2 mBMSCs à 100 cellules dans chaque puits de 6 plaques de puits pendant une semaine, une quantité importante d’unités formant colonies a été observée, ce qui suggère la capacité significative de formation de colonies de mBMSCs (Figure 1D).

Pour évaluer la capacité de différentiation de multi-lignée, les mBMSCs ont été induits en osteo-, chondro- et adipo-lignées, respectivement, dans 12 plaques de puits. Les mBMSCs ont montré la capacité osteogenic forte de différentiation. L’activité accrue de l’ALP, les nodules calcifiés rouges distribués sporadiquement sous la coloration rouge d’alizarine, et l’expression accrue des gènes spécifiques ostéogéniques Runx2, Alp, Bsp et Ocn (figure 2) ont indiqué l’induction oestogenic. Pour l’adipogenesis, identifié par la souillure huile-rouge-O, de nombreuses vacuoles lipide-riches étaient évidentes après 9 jours d’induction. De même, l’expression des gènes spécifiques adipogènes Pparγ1 et Cebpa a montré une augmentation significative (Figure 3). Pour l’observation microscopique des lames chondrogenic de différentiation, les échantillons ont montré la souillure positive pour le bleu d’Alcian. En outre, l’immunomarquage avec de l’anticorps anti-collagène de type II a montré une accumulation accrue de la matrice cartilagineuse(figure 4).

milieu de culture composant Concentration finale
Milieu de culture 1.α-MEM (avec 10% FBS) α-minimum de milieu essentiel
Sérum fœtal bovin 10%
Pénicilline et streptomycine 1%
2.Milieu d’induction ostéogénique α-MEM (avec 10% FBS) 70%
Milieu de différenciation ostéogénique 30%
3.Milieu de différenciation ostéogénique Différenciation ostéogénique milieu basal
Sérum fœtal bovin 10%
glutamine 1%
Pénicilline-streptomycine 1%
acide ascorbique 0.20%
β-Glycérophosphate 1%
dexaméthasone 0.01%
4.Milieu de différenciation adipogène A Milieu basal de différenciation adipogène
Sérum fœtal bovin 10%
glutamine 1%
Pénicilline-streptomycine 1%
insuline 0.20%
IBMX 0.10%
Rosiglitazone 0.10%
dexaméthasone 0.01%
5.Milieu de différenciation adipogène B: Milieu basal de différenciation adipogène
Sérum fœtal bovin 10%
glutamine 1%
Pénicilline-streptomycine 1%
insuline 0.20%
6.Milieu de différenciation chondrogénique: Chondrogenèse différenciation milieu basial
dexaméthasone 0.01%
acide ascorbique 0.30%
son 1%
Pyruvate de sodium 0.10%
proline 0.10%
TGF-β3 1%

Tableau 1 : Composantes du milieu de culture et du milieu de différenciation.

anticorps concentration
CD90.1 (Thy-1.1) Anticorps monoclonal 0,5 mg/mL
Anticorps monoclonal CD45 0,2 mg/mL
Anticorps CD29 0,2 mg/mL
Anticorps polyclonal de lapin CollagenII 5mg/mL
Chèvre Anti-Lapin IgG H&L (Alexa Fluor® 488) 1mg/mL

Tableau 2 : Concentration d’anticorps utilisée dans cette étude.

amorce Séquence(5' à 3')
Gapdh Foward: CGGCAAGTTCAACGGCACAGTCAAGG
Inverse : ACGACATACTCAGCACCAGCATCACC
Runx2 Foward: GCCTTCAAGGTTGTAGCCCT
Inverse : TGAACCTGGCCACTTGGTTT
Alp Vers l’avant: AAACTCGCTTATGGTCCCCG
Inverse : TGGGTTTGAATTCCTGCGGT
BPS Foward: GCACGGTTGAGTATGGGGAA
Inverse : ATCCTGACCCTCGTAGCCTT
Ocn Vers l’avant :CAACCCCAATTGTGACGAGC
Inverse:GGCAACACATGCCCTAAACG
Cebpa Vers l’avant: AGTCGGTGGATAAGAACAGCAACG
Inverse : CGGTCATTGTCACTGGTCAACTCC
Pparγ1 Foward: CCATCGAGGACATCCAAGACAACC
Inverse : GTGCTCTGTGACAATCTGCCTGAG

Tableau 3 : Amorces utilisées en PCR en temps réel.

Figure 1
Figure 1 : Isolement et culture des MBMSC. (A) Schéma du protocole. Des mBMSCs ont été isolés et plaqués le jour 0 et incubés avec le milieu de culture α-MEM. Le jour 7, les mBMSCs P0 ont été purifiés par le tri cytometry d’écoulement et les cellules triées ont été plaquées sur une nouvelle boîte de culture. Le jour 14, des MBMSC P1 ont été recueillis et plaqués sur une plaque de 12 puits. Le jour 15, des mBMSCs P2 ont été induits dans des osteoblasts, des cellules adipogenic et des chondroblasts sous le milieu correspondant d’induction. (B) Modèle schématique de la moelle osseuse mandibulaire de rat et observation microscopique de P0 mBMSCs. (C) Tri par cytométrie de flux des mBMSC de rat. L’analyse cytometry d’écoulement montre que ces cellules étaient positives pour CD29 et CD90, mais négatives pour CD45, qui est congruent avec des caractéristiques bmsc. De ces derniers, 1.4 x 106 cellules ont été triées, qui ont représenté convenablement 80% des cellules totales. (D) Image représentative de clones P2 mBMSC colorés en violet cristallin. Veuillez cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2 : Potentiel de différenciation ostéogénique des mBMSC. (A) Après 7 jours d’induction ostéogénique, le changement de l’activité d’ALP a été visualisé. Un grand nombre de nodules minéralisées ont été souillés sous la souillure rouge d’alizarin à 14 jours après induction de différentiation ostéogénique. (B,C) Le secteur positif de l’ALP et de la souillure rouge d’alizarine ont été évalués utilisant le logiciel de l’image J. (C-G) L’expression de l’ARNm des marqueurs osteoblast-spécifiques Runx2, Alp, Bsp et Ocn a augmenté de manière significative après 7 jours d’ostéogenèse. Veuillez cliquer ici pour voir une version plus grande de cette figure.

Figure 3
Figure 3 : Potentiel de différenciation adipogène des mBMSCs après neuf jours d’induction. (A) Une grande quantité de gouttelettes lipidiques se forment et des adipocytes ont été souillés par huile-rouge-O. (B,C) L’expression de l’ARNm des marqueurs adipogènes Cebpa et Pparγ1 a augmenté remarquablement après 9 jours d’adipogenèse. Veuillez cliquer ici pour voir une version plus grande de cette figure.

Figure 4
Figure 4 : Vue stéréoscope de l’effet de différenciation chondrogène. (A) mBMSCs après 21 jours d’induction chondrogenic a montré le positif pour la souillure bleue alcian. (B) Image d’immunofluorescence de l’agrégat chondrogenic souillé avec de l’anti-type collagène d’II. Veuillez cliquer ici pour voir une version plus grande de cette figure.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ce protocole décrit une méthode pour isoler bmscs des mâchoires de rat in vitro en combinant l’adhérence entière de moelle et le tri de cellules fluorescentes, qui est un moyen simple et fiable d’obtenir mBMSCs prolifératifs avec la capacité forte de différenciation. Cette méthode pourrait purifier à titre préliminaire les mBMSC par tri des cellules d’écoulement, mais s’il y a des exigences plus élevées en matière d’homogénéité cellulaire, des méthodes de purification plus précises peuvent être nécessaires.

Actuellement, il existe quatre techniques principales utilisées pour isoler les mBMSC, y compris l’adhérence de la moelle osseuse entière, la centrifugation par gradient de densité, le tri des cellules fluorescentes et le tri des cellules activéesmagnétiquement 22. L’adhérence de la moelle osseuse entière et la centrifugation par gradient de densité sont les méthodes les plus courantes et les plus faciles utilisées pour obtenir des mBMSCs en peu de temps, cependant, la faible pureté des mBMSCs récoltés est leur principal inconvénient. Les deux dernières méthodes peuvent isoler les mBMSCs hautement purifiés grâce à des techniques immunologiques, mais ont les défauts d’être coûteuses, de prendre beaucoup de temps et d’altérer la viabilité cellulaire. Dans cette étude, les avantages de l’adhérence de moelle osseuse entière et de la méthode de tri des cellules fluorescentes ont été combinés pour obtenir un nombre suffisant de mBMSCs prolifératifs en peu de temps.

Sans doute, une des étapes les plus critiques dans ce protocole est la dissection de la mâchoire inférieure de rat, qui est tout à fait distincte de ceux des os axiaux et appendiculaires. Il est essentiel de comprendre l’anatomie de la mandibule du rat pour obtenir un échantillon intact. Semblable à l’homme, la mandibule de rat se trouve sous le maxillaire supérieur, maintient les dents inférieures en place et est reliée au crâne par des condyles bilatéraux. Étant donné que la mandibule est le seul os qui peut se déplacer dans le crâne, il existe de nombreux muscles attachés à la mandibule, qui contrôlent son mouvement. Ce n’est qu’en enlevant complètement ces tissus mous et en ouvrant la bouche au maximum que les condyles se connectant au crâne peuvent être exposés. Il convient également de mentionner que le cou condylienne est une faiblesse physique dans la mâchoire inférieure et est facile à fracturer. Si une résistance excessive est constatée lors de la rotation de la mandibule vers le bas, cela signifie que les muscles masticatoires peuvent ne pas être complètement enlevés. Lorsque cela est observé, ne le tournez pas de manière contrainte, sinon il est facile de casser le cou condylienne, ce qui entraîne une contamination cellulaire. D’autres difficultés dans la séparation et la culture des mBMSCs comprennent une faible teneur en moelle osseuse, une activité cellulaire délicate, une faible pureté, une faible fréquence cellulaire et une contamination des cellules hématopoïétiques18,23. Pour obtenir des MBMSC avec une bonne croissance et un potentiel de différenciation relativement élevé, il est d’une importance cruciale d’assurer l’activité des mBMSCs. Il y a plusieurs étapes clés, y compris l’utilisation de rats âgés de quatre semaines pour cette expérience et les expériences suivantes, car les jeunes rats sont préférés pour maintenir une bonne viabilité. De nombreuses études ont confirmé que l’activité des mBMSCs est liée à l’âge des animaux de laboratoire. Ces mBMSCs provenant de donneurs plus âgés peuvent entraîner une activité de prolifération plus faible, un potentiel de différenciation et une durée de vieplus faibles 2. Toutes les opérations pendant la récolte cellulaire doivent être effectuées sur la glace et le temps d’opération doit être aussi court que possible, de préférence dans les 2 heures. De plus, gardez le temps de digestion de la trypsine ne dépassant pas 3 minutes. Enfin, un autre défi de ce protocole est le processus de récolte des MBMSC. Il peut être gênant de rincer les mBMSCs de la cavité osseuse parce que la cavité de la mandibule de rat est très petite, il est donc très important de connaître la structure anatomique. Les images micro-CT peuvent être d’une grande aide à cet égard. En outre, il convient de noter que comme les os juvéniles sont minces et cassants, la rupture peut entraîner une contamination.

Se référant à la caractérisation immunophénotypique, les BMSC expriment plusieurs phénotypes, mais dont aucun ne leur est spécifique24. Il est généralement admis que les BMSC n’expriment pas CD11b, CD14, CD34 ou CD45, mais ils ont une expression élevée de Sca-1, CD29, CD90 et CD105. Cette étude a choisi les marqueurs largement acceptés de CD29, CD90 et CD45 pour le tri des cellules fluorescentes13,14,25. Elle a révélé que les cellules CD29+CD90+CD45 représentaient de manière appropriée 80 % du nombre total de cellules, ce qui était suffisant pour la culture cellulaire et la recherche subséquentes.

Pendant des décennies, la thérapie par cellules souches est largement utilisée dans le traitement de diverses maladies, telles que les maladies du système immunitaire, les maladies hématologiques systémiques, les cancers ou les traumatismes. Sans aucun doute, les mBMSC, en tant que substitut aux BMSCs, peuvent être utilisés comme un outil plus sûr et plus puissant dans la thérapie par cellules souches en raison de leurs caractéristiques supérieures. La culture cellulaire et l’expansion des mBMSCs deviennent donc particulièrement importantes pour obtenir un nombre suffisant de cellules pour le traitement.

En résumé, cette étude a démontré un protocole prometteur et fiable pour récolter des mBMSCs abondants avec une grande homogénéité et une capacité de multi-différenciation dans un court laps de temps.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Tous les auteurs déclarent qu’ils n’ont pas de conflits d’intérêts.

Acknowledgments

Nous remercions le Laboratoire de stomatologie numérisée et le Centre de recherche sur les anomalies craniofaciales du neuvième hôpital populaire de Shanghai. Le travail de ce manuscrit est soutenu par des subventions de la National Natural Science Foundation of China (NSFC) [81570950,81870740,81800949], Shanghai Summit &Plateau Disciplines, le fonds SHIPM-mu de Shanghai Institute of Precision Medicine, Shanghai Ninth People’s Hospital, Shanghai Jiao Tong University School of Medicine [JC201809], le projet d’incitation de l’équipe d’innovation de haut niveau pour Shanghai Jiao Tong University School of Medicine. Et L.J. est un chercheur du programme de développement des jeunes talents médicaux exceptionnels, du programme de développement des jeunes « Rising Stars of Medical Talent » de Shanghai et du projet « Chen Xing » de l’Université Jiaotong de Shanghai.

Materials

Name Company Catalog Number Comments
0.25% Trypsin-EDTA(1X) Gibco 25200072
10cm culture dish Corning
acutenaculum
Adipogenic differentiation medium Cyagen biosciences inc. MUBMX-90031
Alcian Blue Beyotime Biotechnology
Alizarin red Sigma-Aldrich A5533
Alkaline Phosphatase Color Development Kit Beyotime Biotechnology C3206
alpha-Minimum essential medium GE Healthcare HyClone Cell Culture SH30265.01B
Anti -CollagenII Rabbit pAb Abcam ab34712
Antibodies against CD16/CD32
Antifade Mounting Medium with DAPI Beyotime Biotechnology P0131
APC anti-mouse/rat CD29 Antibody biolegend inc 102215
Biosafety cabinet Esco AC2-4S8-CN
CD45 Monoclonal Antibody (OX1), PE, eBioscience Invitrogen 12-0461-82
CD90.1 (Thy-1.1) Monoclonal Antibody (HIS51), FITC, eBioscience Invitrogen 11-0900-85
Centrifuge cence L500
Chondrogenesis differentiation medium cyagen biosciences inc.
Confocal laser scanning microscope Zeiss LSM880
Countess II FL Automated Cell Counter Invitrogen AMQAF1000
Crystal Violet Staining Solution Beyotime Biotechnology C0121
Fetal Bovine Serum GE Healthcare HyClone Cell Culture SH30084.03
Goat Anti-Rabbit IgG H&L (Alexa Fluor 488) abcam ab150077
Incubator Esco CCL-170B-8
Inverted microscope olympus CKX53
Magzol reagent(Trizol reagent) Magen
micropipettor Eppendorf
Oil Red O
Osteogenic differentiation medium cyagen biosciences inc. MUBMX-90021
Penicillin-Streptomycin Gibco 15070063
Phosphate-buffered saline(1X) Gibco 20012027
PrimeScript RT Master Kit TakaRa Bio Inc RR036A
Proteinase K Sigma-Aldrich P6556
QuickBlock Blocking Buffer Beyotime Biotechnology P0260
scissor
SYBR1 Premix TakaRa Bio Inc
Toluidine Blue Beyotime Biotechnology
Trypan Blue Solution, 0.4% Gibco 15250061

DOWNLOAD MATERIALS LIST

References

  1. Jin, C., et al. Stem cell education for medical students at Tongji University: Primary cell culture and directional differentiation of rat bone marrow mesenchymal stem cells. Biochemistry and Molecular Biology Education. 46, (2), 151-154 (2018).
  2. Chu, D. T., et al. An Update on the Progress of Isolation, Culture, Storage, and Clinical Application of Human Bone Marrow Mesenchymal Stem/Stromal Cells. International Journal of Molecular Sciences. 21, (3), 708 (2020).
  3. Jin, Z., Chen, J., Shu, B., Xiao, Y., Tang, D. Bone mesenchymal stem cell therapy for ovariectomized osteoporotic rats: a systematic review and meta-analysis. BMC Musculoskeleton Disorder. 20, (1), 556 (2019).
  4. Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, (6893), 41-49 (2002).
  5. Musina, R. A., Bekchanova, E. S., Belyavskii, A. V., Sukhikh, G. T. Differentiation potential of mesenchymal stem cells of different origin. Bulletin of Experimental Biology and Medicine. 141, (1), 147-151 (2006).
  6. Lloyd, B., et al. Similarities and differences between porcine mandibular and limb bone marrow mesenchymal stem cells. Archives in Oral Biology. 77, 1-11 (2017).
  7. Zhang, W., et al. Comparison of the use of adipose tissue-derived and bone marrow-derived stem cells for rapid bone regeneration. Journal of Dental Research. 92, (12), 1136-1141 (2013).
  8. Stefanik, D., et al. Disparate osteogenic response of mandible and iliac crest bone marrow stromal cells to pamidronate. Oral Disorders. 14, (5), 465-471 (2008).
  9. Aghaloo, T. L., et al. Osteogenic potential of mandibular vs. long-bone marrow stromal cells. Journal of Dental Research. 89, (11), 1293-1298 (2010).
  10. Kaigler, D., et al. Stem cell therapy for craniofacial bone regeneration: a randomized, controlled feasibility trial. Cell Transplantation. 22, (5), 767-777 (2013).
  11. Li, C., Wang, F., Zhang, R., Qiao, P., Liu, H. Comparison of proliferation and osteogenic differentiation potential of rat mandibular and femoral bone marrow mesenchymal stem cells in vitro. Stem Cells Development. 2020, 1941629 (2020).
  12. Matsubara, T., et al. Alveolar bone marrow as a cell source for regenerative medicine: differences between alveolar and iliac bone marrow stromal cells. Journal of Bone and Mineral Research. 20, (3), 399-409 (2005).
  13. Chan, C. K. F., et al. Identification of the Human Skeletal Stem Cell. Cell. 175, (1), 43-56 (2018).
  14. Bianco, P., Riminucci, M., Gronthos, S., Robey, P. G. Bone marrow stromal stem cells: nature, biology, and potential applications. Stem Cells. 19, (3), 180-192 (2001).
  15. Franken, N. A., Rodermond, H. M., Stap, J., Haveman, J., van Bree, C. Clonogenic assay of cells in vitro. Nature Protocol. 1, (5), 2315-2319 (2006).
  16. Xu, H., et al. Icariin prevents oestrogen deficiency-induced alveolar bone loss through promoting osteogenesis via STAT3. Cell Proliferation. 53, (2), 12743 (2020).
  17. Zhang, P., Wu, Y., Jiang, Z., Jiang, L., Fang, B. Osteogenic response of mesenchymal stem cells to continuous mechanical strain is dependent on ERK1/2-Runx2 signaling. Internation Journal of Molecular Medicine. 29, (6), 1083-1089 (2012).
  18. Zhu, H., et al. A protocol for isolation and culture of mesenchymal stem cells from mouse compact bone. Nature Protocol. 5, (3), 550-560 (2010).
  19. Lach, M. S., et al. Chondrogenic Differentiation of Pluripotent Stem Cells under Controllable Serum-Free Conditions. International Journal of Molecular Sciences. 20, (11), 2711 (2019).
  20. Huang, X., Zhong, L., Hendriks, J., Post, J. N., Karperien, M. The Effects of the WNT-Signaling Modulators BIO and PKF118-310 on the Chondrogenic Differentiation of Human Mesenchymal Stem Cells. International Journal of Molecular Sciences. 19, (2), 561 (2018).
  21. Gale, A. L., Linardi, R. L., McClung, G., Mammone, R. M., Ortved, K. F. Comparison of the Chondrogenic Differentiation Potential of Equine Synovial Membrane-Derived and Bone Marrow-Derived Mesenchymal Stem Cells. Frontiers in Veterinary Sciences. 6, 178 (2019).
  22. Li, X., Zhang, Y., Qi, G. Evaluation of isolation methods and culture conditions for rat bone marrow mesenchymal stem cells. Cytotechnology. 65, (3), 323-334 (2013).
  23. Kagami, H., Agata, H., Tojo, A. Bone marrow stromal cells (bone marrow-derived multipotent mesenchymal stromal cells) for bone tissue engineering: basic science to clinical translation. International Journal of Biochemistry and Cell Biology. 43, (3), 286-289 (2011).
  24. Chamberlain, G., Fox, J., Ashton, B., Middleton, J. Concise review: mesenchymal stem cells: their phenotype, differentiation capacity, immunological features, and potential for homing. Stem Cells. 25, (11), 2739-2749 (2007).
  25. Abdallah, B. M., Alzahrani, A. M., Abdel-Moneim, A. M., Ditzel, N., Kassem, M. A simple and reliable protocol for long-term culture of murine bone marrow stromal(mesenchymal) stem cells that retained their in vitro and in vivo stemness in long-term culture. Biology Proceedings Online. 21, 3 (2019).
Isolement et culture de cellules souches mésenchymateuses de moelle osseuse mandibulaire chez le rat
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).More

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter