Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Isolasjon og dyrking av mandibulær benmarg Mesenchymale stamceller hos rotter

doi: 10.3791/61532 Published: August 25, 2020
* These authors contributed equally

Summary

Denne artikkelen presenterer en metode som kombinerer hele benmargstilslutning og strømningscytometrisortering for isolering, dyrking, sortering og identifisering av benmargmesenchymale stamceller fra rottemanidibler.

Abstract

Her presenterer vi en effektiv metode for å isolere og dyrke mandibulær benmarg mesenchymale stamceller (mBMSCs) in vitro for raskt å oppnå mange celler av høy kvalitet for eksperimentelle krav. mBMSC kan være mye brukt i terapeutiske applikasjoner som vevsteknikkceller i tilfelle kraniofaciale sykdommer og kranio-maxillofacial regenerering i fremtiden på grunn av den utmerkede selvfornyelsesevnen og multi-lineage differensieringspotensialet. Derfor er det viktig å skaffe mBMSCer i stort antall.

I denne studien ble benmarg spylt fra mandible og primære mBMSCs ble isolert gjennom hele benmarg tilhenger dyrking. Videre ble CD29+CD90+CD45 mBMSC renset gjennom fluorescerende cellesortering. Den andre generasjonen rensede mBMSCer ble brukt til videre studier og viste potensial for å differensiere til osteoblaster, adipocytter og kondrocytter. Ved hjelp av denne in vitro-modellen kan man få et høyt antall proliferative mBMSCer, noe som kan lette studiet av de biologiske egenskapene, den påfølgende reaksjonen på mikromiljøet og andre anvendelser av mBMSCer.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Benmarg mesenchymale stamceller (BMSCer) er ikke-hematopoietiske stamceller avledet fra benmarg som manifesterer sterk spredningsevne og multi-lineage differensieringspotensial1,2,3,4. Faktisk har BMSC-er blitt ansett som en ideell kandidat for beinvevsteknikk og regenerering helt siden de ble oppdaget. I årevis har iliac crest eller lange bein som tibia og lårben vært den vanligste kilden til BMSC for kraniofacial regenerering. Orofaciale BMSCer, for eksempel mandibulære BMSCer (mBMSCer), viser imidlertid noen forskjeller fra lange ben-BMSCer, for eksempel forskjellig embryonal opprinnelse og utviklingsmønster. Mandibler oppstår fra nevrale kamceller i nevroectoderm bakterielaget og gjennomgår intramembranøs ossifikasjon, mens aksiale og appendikulære skjeletter er fra mesodermet og gjennomgår endokondriell ossifikasjon. Videre har kliniske observasjoner og eksperimentelle dyrestudier konsekvent indikert at det er funksjonelle forskjeller mellom orofacial og iliac crest BMSCs5,6,7,8. Rapporter har vist at BMSC-er avledet fra kraniofacial bein som mandibel, maksillærben og alveolarben viste overlegen spredning, levetid og differensieringsevne enn de fra aksiale og appendikulære bein9. mBMSCs anses derfor å være de foretrukne ressursene for fremtidige terapeutiske anvendelser av kraniofaciale sykdommer som cherubisme, kjevetumor, osteoporose av kjeveben og periodontal vevsfeil10,11,12. For å forstå behandlingspotensialet i prekliniske eksperimenter, er det viktig å etablere en metode for raskt å isolere og dyrke mBMSCs in vitro.

I denne studien var målet å oppnå rensede mBMSCer ved hele benmargstilslutning og strømningscytometrisortering. Den anatomiske morfologien til rottemanidibel, tydelig observert gjennom mikroberegnet tomografi (Micro-CT) og histologiske seksjoner, viste at det trabekulære beinet i mandibelen var mellom snittet medullært rom og alveolarbenet. Benmargen fra trabekulære bein ble spylt for å oppnå mandibulære margceller, men cellene som ble dyrket på denne måten var ikke rene mBMSCer og var sannsynlig å bestå av flere typer celler med usikre potenser og forskjellige avstamninger som celler fra bein-, fett- og endotelceller13,14. Det neste trinnet i cellerensing var spesielt viktig. Flow cytometri filtrerer celler ved å gjenkjenne en kombinasjon av celleoverflateproteiner og har blitt mye vedtatt i berikelsen av mesenchymale stamceller. Cellehomogenitet er den største fordelen med strømningscytometri, men prosessen bestemmer ikke cellens levedyktighet og kan resultere i et begrenset celleutbytte. I denne studien ble P0 mBMSC oppnådd fra hele benmargstilslutning sortert etter strømningscytometri for å oppnå mBMSCer med høy renhet og sterk spredningskapasitet.

Denne studien introduserer en reproduserbar og pålitelig protokoll for isolasjon, kultur og differensiering av rotte mandibulære BMSCer ved hjelp av en kombinasjon av hele benmargs overholdelse og strømning cytometri sortering. Det er en pålitelig og praktisk metode for forskere i relaterte felt å bruke.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle eksperimentelle prosedyrer for dyr i denne artikkelen ble godkjent av Animal Care Committee of Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine.

1. Forberedelse

  1. Bruk to 5 uker gamle mannlige Sprague Dawley rotter for eksperimentet.
  2. Steriliser alle instrumentene, inkludert nåleholdere, pinsett og saks ved høy temperatur eller nedsenket i 75% etanol i 10 minutter.
    MERK: Nedsenking av etanol bør ikke være for lang til å unngå celleskader.
  3. Forbered kulturmedier på forhånd, hvis sammensetning er gitt i tabell 1. Suppler hvert medium som beskrevet nedenfor.
    1. Tilberedning av α-MEM kulturmedium (med 10% FBS): Supplement minimum essensiell medium alfa (α-MEM) med 10% foster bovint serum og 1% penicillin og streptomycin.
    2. Fremstilling av osteogen differensieringsmedium: Supplere osteogen differensiering basal medium med 10% foster bovint serum, 1% glutamin, 1% penicillin-streptomycin, 0,20% askorbinsyre, 1% β-glycerofosfat og 0,01% deksametason.
    3. Fremstilling av osteogen induksjonsmedium: Bland 70% α-MEM kulturmedium (med 10% FBS) og 30% osteogen differensieringsmedium.
    4. Fremstilling av adipogene differensieringsmedium A: Supplement adipogenic differensiering basal medium med 10% foster bovint serum, 1% glutamin, 1% penicillin-streptomycin, 0,20% insulin, 0,10% IBMX, 0,10% Rosiglitazone og 0,01% Dexahasone.
    5. Fremstilling av adipogene differensieringsmedium B: supplement adipogenic differensiering basal medium med 10% foster bovint serum, 1% glutamin, 1% penicillin-streptomycin og 0,20% insulin.
    6. Tilberedning av kondrogene differensieringsmedium: Supplement kondrogene differensiering basal medium med 0,01% Deksametason, 0,30% Askorbinsyre, 1% ITS, 0,10% natriumpyuvat, 0,10% prolin og 1% TGF-β3.
      MERK: Det osteogene differensieringsmediet må brukes opp innen en måned etter konfigurasjon. Den effektive perioden for det konfigurerte kondrogene differensieringsmediet er 12 timer.

2. Isolering og dyrking av rotte mBMSCs

MERK: Alle eksperimentelle operasjoner bør utføres på is så mye som mulig for å opprettholde celle levedyktighet.

  1. Høsting av rotte mandibler
    1. Euthanize to 5 uker gamle mannlige Sprague Dawley rotter av CO2 kvelning. Forsikre deg om at dyrets pust stoppes før du fortsetter med eksperimentet.
    2. Skyll disse rottene i et beger som inneholder 75% etanol i 3 min.
    3. Plasser rotten inne i en ren avtrekkshette for å høste mandibler.
      MERK: Steriliser avtrekkshetten med ultrafiolett lysstråling i 30 minutter før bruk.
    4. Plasser rotten i en liggende stilling. Incise skinn og buccinator muskler fra bilateral angulus oris til bakre regionen av mandibelen, som er det eneste bevegelige beinet med lavere snitt.
      MERK: Det anbefales å lage et snitt på 2 cm på hver side av angulus oris for å få et klart operasjonsfelt.
    5. Åpne rottens munn ved å skyve de maksillære og mandibulære snittene mot motsatt retning med begge tommelen for å eksponere mandibulære tenner, som er festet til mandibelen.
    6. Koble helt fra bukkale muskler og sener festet til coracoidene og den dårligere grensen til mandibel.
      MERK: En økt mobilitet av mandibelen observeres i løpet av dette trinnet på grunn av mangel på muskelspenning.
    7. Trykk de mandibulære bakre tennene og roter tilbake og nedover til kondylene på begge sider er tydelig eksponert.
      MERK: Dette trinnet utføres for å kunstig åpne rottens munn i størst mulig grad for å dislokere kondylen. Mandibelen er koblet til skallen gjennom bilaterale kondyler, slik at eksponeringen av kondylene fører til frakobling mellom skallen og mandibelen.
    8. Skill den mandible kroppen fra skallen.
    9. Rengjør det festende bløtvevet på beinoverflaten ved hjelp av en våt gasbind.
    10. Legg benet i en 10 cm steril glassfat fylt med ferdigkjølt minimum essensiell middels α (α-MEM) eller fosfatbuffer saltvann (PBS) på is for å bevare levedyktigheten.
  2. Isolering og dyrking av mBMSC-ene
    1. Klipp av det fremre beinet langs den flerårige kanten av den første molaren fra den mandibulære kroppen. Fjern mandibulær ramus inkludert coracoid og condyle langs den distale kanten av den tredje molaren for å eksponere marghulen.
    2. Fyll en 10 cm steril glassfat med 10 ml α-MEM (med 10% FBS).
    3. Bruk 1 ml sprøyte for å aspirere α-MEM kulturmedium. Med sprøytenålen satt inn i benmargshulen, skyll benmargen gjentatte ganger inn i parabolen. Skyll beinhulen minst 3 ganger fra henholdsvis mesiale og distale sider av beinet til beinet ble hvitt.
      MERK: Dette er det mest kritiske trinnet, da benmargshulen til en rottemanidibel ikke er så åpenbar som i langt bein, og riktig punkt for å sette inn nålen må bestemmes empirisk. Alle eksperimentelle prøver ovenfor bør lagres på is for å opprettholde celle levedyktighet, og derfor må driftstiden ikke være lenger enn 2 timer.
    4. Overfør mediet som inneholder de skyllede cellene til et 15 ml sentrifugerør og sentrifuger ved 800 x g i 4 °C i 5 minutter. Kast supernatanten.
    5. Resuspend cellene med 3 ml α-MEM (med 10% FBS). Legg cellene i en ny 10 cm kulturrett og inkuber ved 37 °C i en 5 % CO 2-inkubator.
    6. Sjekk de morfologiske endringene og veksten av disse cellene på den tredje kulturdagen. Fjern kulturmediet med ikke-sammenhengende celler og vevsfragmenter. Tilsett forsiktig 10 ml fersk α-MEM (med 10% FBS).
    7. Etter 7 dager med kultur nådde P0 mBMSCs 70% til 80% samløp.
  3. Sortering av flytceller
    MERK: P0 mBMSC ble fenotypisk identifisert og primært renset gjennom strømningscellesortering.
    1. Aspirer og kast kulturmediet og vask deretter parabolen med PBS. Kast PBS.
    2. Tilsett 1 ml 0,25% trypsin med 0,02% EDTA i parabolen. Fordøye cellene ved 37 °C i 5 minutter, og tilsett deretter 2 ml α-MEM (med 10 % FBS) for å stoppe reaksjonen.
    3. Overfør cellene suspensjon til en 15 ml sentrifuge rør og sentrifuge på 800 x g i 5 min.
    4. Resuspend cellene i 120 μL AV PBS (med 10% FBS) etter sentrifugering.
    5. Blokker disse cellesuspensjonene med 1 μL antistoff mot CD16/CD32 ved 4 °C i 15 minutter.
    6. Overfør 100 μL av cellefjæringen til et nytt mikrosenterrør, flekk cellene med Phycoerythrin (PE)-konjugert antistoff mot CD45, fluorescein-isothiocyanate (FITC)-konjugert antistoff mot CD90 og Allophycocyanin (APC)-antistoff mot CD29 ved 4 °C i 1 time i mørket13,15. Konsentrasjonen av antistoffer som brukes i dette eksperimentet er vist i tabell 2. Bruk de andre 20 μL celleoppheng som unstained negativ kontroll.
    7. Sentrifuger deretter rørene ved 800 x g i 5 minutter, kast suspensjonen og resuspend cellene i 0,5 ml PBS (med 10% FBS).
    8. Tilsett 10 μL 0,01 mg/ml DAPI i 10 minutter før analyse.
    9. Bruk 40 nm filtre plassert på sentrifugerør for å filtrere cellene.
    10. Analyser cellene på fluorescensaktivert cellesortering. Still inn panelene på følgende måte. For det første, fjern døde celler fra totalt celleantall ved å gating DAPI- celler, deretter gate CD29+CD90+CD45- i de merkede cellene som målrettede mBMSCs.
    11. Samle sortert CD29+CD90+CD45- celler i et 15 ml sentrifugerør med 3 ml α-MEM (med 10% FBS) forhåndsforberedt.
    12. Sentrifuger rørene på 800 x g i 5 min. Fjern oppsamlingsbufferen og tilsett 1 ml fersk α-MEM (med 10 % FBS) for å bruke cellene på nytt. Deretter tallerken dem i en 6 cm kulturrett.

3. Kolonidannelsesevne

MERK: Dette trinnet ble utført for å se etter divisjonsevnen til mBMSCer. 15

  1. Velg MBMSCer (P2) for andre passasje for dette eksperimentet. Når cellesamløpet nådde 80% til 90%, reseed cellene i en seriell gradient i en 6 brønnplate for å evaluere deres kloniske spredning evne.
    MERK: Det anbefales å stille inn gradienten fra 1 x 102 til 1 x 103 celler per brønn, men de endelige fortynningene av forskjellige cellelinjer av menneskelig eller animalsk opprinnelse ble empirisk bestemt.
  2. Kultur cellene i α-MEM (med 10% FBS) i ca to uker til et stort antall kolonidannende enheter kunne sees under lysmikroskop. Oppdater kulturmediet hver tredje dag.
  3. Aspirer og kast kulturmediet, vask brønnene med PBS to ganger i 5 min om gangen. Deretter legger du til 4% paraformaldehydløsning til hver brønn og fikser i minst 10 min.
  4. Fjern paraformaldehyden og skyll brønnene to ganger med PBS.
  5. Flekk cellene med krystallfiolett fargingsløsning og inkuber dem i 37 °C i ca. 10 minutter.
    MERK: Fargingstiden justeres på riktig måte til ønsket nyanse er oppnådd.
  6. Fjern fargingsløsningen og vask prøvene med destillert vann for å stoppe reaksjonen.
  7. Bilde under et stereomikroskop og tell spredte cellekolonier som besto av minst 50 celler.

4. Differensiering av mBMSC-er med flere sperring

MERK: P2 mBMSC-ene ble brukt til påfølgende eksperimenter med mindre annet er beskrevet.

  1. Osteogen induksjon av mBMSC
    1. Fordøy mBMSCene som beskrevet ovenfor. Frøceller med en tetthet på 2,5 x 105/cm2 i en 12 brønnplate supplert med 1 ml α-MEM (med 10% FBS).
    2. Når cellesamløpet nådde 60-70%, endre mediet til 30% osteogene induksjonsmedier. Kultur cellene med α-MEM (med 10% FBS) som en negativ kontroll og endre mediet hver annen dag.
      MERK: Etter at et stort antall kalsiumknutler vises under osteogenese, anbefales det å endre middels utvekslingsmønster til et halvt volum middels utveksling hver annen dag, for å forhindre at osteoblaster flyter.
    3. Etter dyrking i syv dager, vurder forkalkningen av disse cellene ved alkalisk fosfatasefarging16,17.
    4. Fjern kulturmediet og fest cellene med 4% paraformaldehyd i 10 min. Skyll cellene med 1 ml PBS per brønn i 3 minutter to ganger.
    5. Deretter flekker cellene med alkalisk fosfatasefargingsløsning og inkuberer ved 37 °C i 10-30 min.
      MERK: Inkubasjon kan utføres over natten ved romtemperatur for å oppnå ønsket farge.
    6. Vask brønnene med destillert vann for å stoppe reaksjonen. Ta bilder under lysmikroskop. Røde pigmenterte granulater representerer alkalisk fosfatase (ALP) aktivitet.
    7. Etter å ha dyrket de resterende cellene i ytterligere 7 dager, utfør alizarin rød farging for å evaluere mineraliseringskapasiteten til cellene.
    8. Flekk cellene med 0,5% alizarin rød farging løsning etter cellefiksering i 10 min16,18. Stopp den kromogene reaksjonen med destillert vann etter 3-5 min.
      MERK: Reaksjonstiden kan forlenges avhengig av hvilken farge som er utviklet.
    9. Til slutt, plasser kulturplaten under lysmikroskopet for å observere effekten av osteogen farging; røde knuter indikerer kalsiumavsetninger av disse cellene.
  2. Adipogene induksjon av mBMSCs
    1. Frø P2 mBMSCs i en 12 brønnplate som beskrevet ovenfor.
    2. Etter at brønnen har blitt 90% sammenfallende, kultur cellene med adipogene differensiering medium A. Bruk celler dyrket i α-MEM kultur medium (med 10% FBS) som negativ kontroll.
    3. Etter 2 dager med induksjon aspirerer du medium A fra brønnen og tilsetter 1 ml adipogene differensieringsmedium B i hver brønn.
    4. Etter en dag, fjern medium B og start syklusen igjen med middels A lagt tilbake i brønnen. Kultur cellene vekselvis ved hjelp av medium A og B.
    5. Påfør differensieringsmediet A og B vekselvis i tre sykluser og oppdag adipogenesen til disse cellene ved oljerød O-farging16,18.
      MERK: Mange runde og store lipiddråper kan observeres ved å dyrke disse cellene med differensieringsmedium B i ytterligere 2 til 3 dager.
    6. Fjern mediet og fest cellene med 4% paraformaldehyd i 10 min. Vask ut cellene med PBS.
    7. Flekk cellene med oljerød O fargingsløsning og inkuber ved 37 °C i ca. 3 min.
    8. Fjern fargingsløsningen og vask brønnene med destillert vann.
    9. Observer adipogenese under lysmikroskop.
  3. Kondrogenese induksjon av mBMSCs
    1. Frø P2 mBMSC i 15 ml sentrifugerør med en tetthet på 5 x 105/cm2.
    2. Sentrifuger rørene på 300 x g i 5 min. Kast supernatanten.
    3. Resuspend cellene med 0,5 ml kondrogene differensieringsmedium. Sentrifuger cellene på 300 x g i 5 min.
    4. Løsne lokket på sentrifugerøret og inkuber det ved 37 °C i en 5 % CO 2-inkubator. Forny mediet annenhver dag.
      MERK: Cellene begynner å pelletere etter 24 timer. Det anbefales ikke å flytte sentrifugerøret i 48 timer. Vær forsiktig så du ikke aspirerer cellepellet når du endrer mediet.
    5. Etter 21 dager med induksjon, fest cellepellets med 4% paraformaldehyd, etterfulgt av dehydrering, parafininnstøtning og seksjonering.
    6. Etter deparaffinering og hydrering, flekk lysbildene i alciansk blå løsning i minst 15 min18,19,20,21, vask deretter med destillert vann for å stoppe reaksjonen. Ta bildene under lysmikroskopet.
    7. For immunfluorescerende farging av kollagen type II, utfør trinnene nedenfor.
      1. Inkuber lysbildene med 5 μg/ml proteinase K i 15 min ved 37 °C etter deparaffinerings- og hydreringstrinnet.
      2. Inkuber lysbildene i blokkeringsbufferen i 1 time ved 37 °C.
      3. Påfør 1 μL kollagen type II antistoff i 200 μL blokkeringsbuffer på lysbildene og inkuber over natten ved 4 °C.
      4. Neste dag, vask lysbildene med PBS to ganger og inkuber med sekundære antistoffer ved 37 °C i 1 time.
      5. Inkuber skivene med 40,6-diamidino-2-fenylindole (DAPI) i 10 min.
    8. Ta bilder av hvert lysbilde under fluorescensmikroskopi.

5. PCR i sanntid

  1. Trekk ut totalt RNA fra mBMSC ved hjelp av et guanidium isothiocyanate basert kommersielt tilgjengelig reagens.
  2. Utfør omvendt transkripsjon av RNA i komplementært DNA ved hjelp av et kommersielt tilgjengelig sett. Reaksjonsforholdene for omvendt transkripsjon var som følger: 65 °C i 5 minutter, 37 °C i 15 minutter, 85 °C i 15 s.
  3. Utfør PCR i sanntid for å oppdage osteogenese og adipogenesespesifikke gener ved hjelp av primere oppført i tabell 3. PCR-forsterkningsprosedyren var som følger: 95 °C i 5 min. 95 °C i 5 s, 60 °C i 30 s i 40 sykluser.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ved hjelp av denne protokollen holdt en stor andel celler seg til platen på den tredje dagen etter den første kulturen. Vanligvis, etter ytterligere 3-4 dager med kultur, nådde cellesamløpet til 70 til 80% (Figur 1B). Med fluorescerende cellesortering ble DAPI-CD29+CD90+CD45 mBMSC renset18,22, som utgjorde ca. 81,1 % i P0-cellene (figur 1C).

Etter sådd P2 mBMSC ved 100 celler i hver brønn på 6 brønnplater i en uke, ble det observert en betydelig mengde kolonidannende enheter, noe som antydet den betydelige koloniformingsevnen til mBMSCs (Figur 1D).

For å vurdere multi-lineage differensieringsevnen ble mBMSCene indusert i henholdsvis osteo-, kondro- og adipo-avstamninger i 12 brønnplater. mBMSCene viste sterk osteogen differensieringsevne. Økt aktivitet av ALP, røde kalsifiserte knuter distribuert sporadisk under alizarin rød farging, og økt uttrykk for osteogene spesifikke gener Runx2, Alp, Bsp og Ocn (Figur 2) indikerte oestogen induksjon. For adipogenese, identifisert av olje-rød-O farging, var mange lipidrike vakuoler tydelige etter 9 dager med induksjon. På samme måte viste uttrykket av adipogene spesifikke gener Pparγ1 og Cebpa en betydelig økning (figur 3). For mikroskopisk observasjon av kondrogene differensieringsskred viste prøvene positiv farging for alcianblå. I tillegg viste immundempende med anti-type II kollagenantistoff forbedret akkumulering av bruskmatrise (figur 4).

Kultur Medium komponent Endelig konsentrasjon
1.α-MEM kulturmedium (med 10% FBS) α minimum viktig medium
Fetal bovin serum 10%
Penicillin og streptomycin 1%
2.Osteogen induksjon medium α-MEM kulturmedium (med 10% FBS) 70%
Osteogen differensiering differensiering medium 30%
3.Osteogen differensiering medium Osteogen differensiering basal medium
Fetal bovin serum 10%
Glutamin 1%
Penicillin-Streptomycin 1%
Askorbinsyre 0.20%
β-Glyserofosfat 1%
Deksametason 0.01%
4.Adipogene differensieringsmedium A Adipogene differensiering basal medium
Fetal bovin serum 10%
Glutamin 1%
Penicillin-Streptomycin 1%
insulin 0.20%
IBMX 0.10%
Rosiglitazone 0.10%
Deksametason 0.01%
5.Adipogene differensieringsmedium B: Adipogene differensiering basal medium
Fetal bovin serum 10%
Glutamin 1%
Penicillin-Streptomycin 1%
insulin 0.20%
6.Chondrogenic differensiering medium: Kondrogenese differensiering basial medium
Deksametason 0.01%
Askorbinsyre 0.30%
dens 1%
Natrium pyruvat 0.10%
Proline 0.10%
TGF-β3 1%

Tabell 1: Komponenter i kulturmedium og differensieringsmedium.

antistoff konsentrasjon
CD90.1 (Tyde-1.1) Monoklonalt antistoff 0,5mg/ml
CD45 Monoklonalt antistoff 0,2mg/ml
CD29 antistoff 0,2mg/ml
KollagenII kanin polyklonalt antistoff 5mg/ml
Geit Anti-Kanin IgG H&L (Alexa Fluor® 488) 1mg/ml

Tabell 2: Antistoffkonsentrasjon som brukes i denne studien.

grunning Sekvens (5 til 3')
GAPDH Foward: CGGCAAGTTCAACGGCACAGTCAAGG
Bakside: ACGACATACTCAGCACCAGCATCACC
Kjørx2 Foward: GCCTTCAAGGTTGTAGCCCT
Omvendt: TGAACCTGGCCACTTGGTTT
Alp Foward: AAACTCGCTTATGGTCCCCG
Omvendt: TGGGTTTGAATTCCTGCGGT
Bps Foward: GCACGGTTGAGTATGGGGAA
Omvendt: ATCCTGACCCTCGTAGCCTT
Ocn Fremover:CAACCCCAATTGTGACGAGC
Omvendt:GGCAACACATGCCCTAAACG
Cebpa Foward: AGTCGGTGGATAAGAACAGCAACG
Omvendt: CGGTCATTGTCACTGGTCAACTCC
Pparγ1 Foward: CCATCGAGGACATCCAAGACAACC
Omvendt: GTGCTCTGTGACAATCTGCCTGAG

Tabell 3: Primere brukt i SANNTID PCR.

Figure 1
Figur 1: Isolering og kultur for mBMSCer. (A) Skjematisk diagram for protokollen. mBMSC ble isolert og belagt på dag 0 og inkubert med α-MEM kulturmedium. På dag 7 ble P0 mBMSC renset gjennom strømningscytometrisortering og de sorterte cellene ble belagt på en ny kulturrett. På dag 14 ble P1 mBMSC samlet inn og plating på 12-brønns plate. På dag 15 ble P2 mBMSCs indusert i osteoblaster, adipogene celler og kondroblaster under tilsvarende induksjonsmedium. (B) Skjematisk modell av rotte mandibulær benmarg og mikroskopisk observasjon av P0 mBMSCs. (C) Strømning cytometri sortering av rotte mBMSCs. Strømningscytometrianalysen viser at disse cellene var positive for CD29 og CD90, men negativt for CD45, som er kongruent med BMSC-egenskaper. Av disse ble 1,4 x 106 celler sortert, noe som utgjorde passende 80% av de totale cellene. (D) Representativt bilde av krystallfiolett farget P2 mBMSC kloner. Klikk her for å se en større versjon av denne figuren.

Figure 2
Figur 2: Osteogen differensieringspotensial for mBMSC. (A) Etter 7 dager med osteogen induksjon ble endringen av ALP-aktiviteten visualisert. Et stort antall mineraliserte knuter ble farget under alizarin rød farging på 14 dager etter induksjon av osteogen differensiering. (B,C) Det positive området av ALP og alizarin rød farging ble evaluert ved hjelp av Image J programvare. (C-G) MRNA-uttrykket for osteoblastspesifikke markører Runx2, Alp, Bsp og Ocn økte betydelig etter 7 dager med osteogenese. Klikk her for å se en større versjon av denne figuren.

Figure 3
Figur 3: Adipogene differensieringspotensial for mBMSCer etter ni dager med induksjon. (A) En stor mengde lipiddråper og adipocytter ble farget av oljerød-O. (B,C) MRNA-uttrykket av adipogene markører Cebpa og Pparγ1 økte bemerkelsesverdig etter 9 dager med adipogenese. Klikk her for å se en større versjon av denne figuren.

Figure 4
Figur 4: Stereoskopvisning av kondrogene differensieringseffekt. (A) mBMSC etter 21 dager kondrogene induksjon viste positivt for alcian blå flekker. (B) Immunfluorescence bilde av kondrogene aggregert farget med anti-type II kollagen. Klikk her for å se en større versjon av denne figuren.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Denne protokollen beskriver en metode for å isolere BMSCer fra rotte mandibles in vitro ved å kombinere hele benmargs overholdelse og fluorescerende celle sortering, som er en enkel og pålitelig måte å oppnå proliferative mBMSCs med sterk differensiering evne. Denne metoden kan foreløpig rense mBMSCer ved strømningscellesortering, men hvis det er høyere krav til cellehomogenitet, kan det være nødvendig med mer presise rensemetoder.

For tiden er det fire hovedteknikker som brukes til å isolere mBMSCer, inkludert hel benmargstilslutning, tetthet gradient sentrifugering, fluorescerende cellesortering og magnetisk aktivert cellesortering22. Hele benmargstilslutning og tetthet gradient sentrifugering er de vanligste og enkle metodene som brukes for å oppnå mBMSCs på kort tid, men den lave renheten til høstede mBMSCs er deres største ulempe. De to siste metodene kan isolere svært rensede mBMSCer gjennom immunologiske teknikker, men har manglene ved å være dyre, ta lang tid og nedsatt celle levedyktighet. I denne studien ble fordelene ved hele benmargstilslutning og fluorescerende cellesorteringsmetode kombinert for å oppnå nok antall proliferative mBMSCer på kort tid.

Utvilsomt er et av de mest kritiske trinnene i denne protokollen disseksjon av rottemanidibel, som er ganske forskjellig fra de av aksiale og appendicular bein. Det er viktig å forstå anatomien til rottemanidibel for å få en intakt prøve. I likhet med mennesket sitter rottemanidibel under maxillaen, holder de nedre tennene på plass og er koblet til skallen av bilaterale kondyler. Siden mandibelen er det eneste beinet som kan bevege seg i skallen, er det mange muskler festet til mandibel, som styrer bevegelsen. Bare ved å fjerne disse bløtvevene helt og snu munnen åpen maksimalt, kan kondylene som kobles til skallen bli utsatt. Det er også verdt å nevne at kondylarhalsen er en fysisk svakhet i mandibel og er lett å sprekke. Hvis det blir funnet overdreven motstand når du roterer mandibelen nedover, betyr det at masticatory musklene ikke kan fjernes helt. Når dette er observert, ikke roter det begrenset, ellers er det lett å bryte kondylarhalsen og dermed føre til celleforurensning. Andre vanskeligheter med separasjon og kultur av mBMSCs inkluderer lavt innhold i benmarg, delikat celleaktivitet, lav renhet, lav cellefrekvens og forurensning av hematopoietiske celler18,23. For å oppnå mBMSC med god vekst og relativt høyt differensieringspotensial, er det viktig å sikre aktiviteten til mBMSCer. Det er flere viktige trinn, inkludert bruk av fire uker gamle rotter for dette og etterfølgende eksperimenter, da unge rotter foretrekkes for å opprettholde god levedyktighet. Mange studier har bekreftet at aktiviteten til mBMSCs er relatert til alderen til eksperimentelle dyr. Disse mBMSCene fra eldre givere kan resultere i lavere spredningsaktivitet, differensieringspotensial og levetid2. Alle operasjoner under cellehøsting må fullføres på is og driftstiden skal være så kort som mulig, helst innen 2 timer. I tillegg, hold trypsin fordøyelsestiden ikke lenger enn 3 minutter. Til slutt, enda en utfordring i denne protokollen er prosessen med å høste mBMSCs. Det kan være plagsomt å skylle mBMSCs fra beinhulen fordi hulrommet av rottemanidibel er svært lite, så det er svært viktig å være kjent med den anatomiske strukturen. Micro-CT-bilder kan være til stor hjelp i denne forbindelse. Dessuten er det verdt å merke seg at ettersom juvenile bein er slanke og sprø, kan brudd føre til forurensning.

Med henvisning til immunofenotypisk karakterisering uttrykker BMSCer flere fenotyper, men ingen av dem er spesifikke for dem24. Det godtas vanligvis at BMSCer ikke uttrykker CD11b, CD14, CD34 eller CD45, men de har et høyt uttrykk for Sca-1, CD29, CD90 og CD105. Denne studien valgte de allment aksepterte markørene for CD29, CD90 og CD45 for fluorescerende cellesortering13,14,25. Den fant at CD29+CD90+CD45 celle utgjorde passende 80% av totale celler, noe som var nok for etterfølgende cellekultur og forskning.

I flere tiår er stamcelleterapi mye brukt til behandling av ulike sykdommer, for eksempel immunsystemsykdommer, hematologiske systemiske sykdommer, kreft eller traumer. Utvilsomt kan mBMSCer, som erstatning for BMSCer, brukes som et tryggere og kraftigere verktøy i stamcelleterapi på grunn av deres overlegne egenskaper. Cellekultur og utvidelse av mBMSC blir derfor spesielt viktig for å oppnå tilstrekkelig antall celler til behandling.

Oppsummert viste denne studien en lovende og pålitelig protokoll for å høste rikelig mBMSCs med høy homogenitet og multi-differensieringsevne på kort tid.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Alle forfattere oppgir at de ikke har noen interessekonflikter.

Acknowledgments

Vi takker for hjelpen fra Laboratoriet for digitalisert stomatologi og forskningssenter for kraniofaciale avvik ved Shanghai niende folkesykehus. Arbeidet med dette manuskriptet støttes av tilskudd fra National Natural Science Foundation of China (NSFC) [81570950,81870740,81800949], Shanghai Summit &Plateau Disciplines, SHIPM-mu-fondet fra Shanghai Institute of Precision Medicine, Shanghai Ninth People's Hospital, Shanghai Jiao Tong University School of Medicine [JC201809], insentivprosjektet til innovasjonsteamet på høyt nivå for Shanghai Jiao Tong University School of Medicine. Og L.J. er forsker på Outstanding Youth Medical Talents, Shanghai "Rising Stars of Medical Talent" Youth Development Program og "Chen Xing" -prosjektet fra Shanghai Jiaotong University.

Materials

Name Company Catalog Number Comments
0.25% Trypsin-EDTA(1X) Gibco 25200072
10cm culture dish Corning
acutenaculum
Adipogenic differentiation medium Cyagen biosciences inc. MUBMX-90031
Alcian Blue Beyotime Biotechnology
Alizarin red Sigma-Aldrich A5533
Alkaline Phosphatase Color Development Kit Beyotime Biotechnology C3206
alpha-Minimum essential medium GE Healthcare HyClone Cell Culture SH30265.01B
Anti -CollagenII Rabbit pAb Abcam ab34712
Antibodies against CD16/CD32
Antifade Mounting Medium with DAPI Beyotime Biotechnology P0131
APC anti-mouse/rat CD29 Antibody biolegend inc 102215
Biosafety cabinet Esco AC2-4S8-CN
CD45 Monoclonal Antibody (OX1), PE, eBioscience Invitrogen 12-0461-82
CD90.1 (Thy-1.1) Monoclonal Antibody (HIS51), FITC, eBioscience Invitrogen 11-0900-85
Centrifuge cence L500
Chondrogenesis differentiation medium cyagen biosciences inc.
Confocal laser scanning microscope Zeiss LSM880
Countess II FL Automated Cell Counter Invitrogen AMQAF1000
Crystal Violet Staining Solution Beyotime Biotechnology C0121
Fetal Bovine Serum GE Healthcare HyClone Cell Culture SH30084.03
Goat Anti-Rabbit IgG H&L (Alexa Fluor 488) abcam ab150077
Incubator Esco CCL-170B-8
Inverted microscope olympus CKX53
Magzol reagent(Trizol reagent) Magen
micropipettor Eppendorf
Oil Red O
Osteogenic differentiation medium cyagen biosciences inc. MUBMX-90021
Penicillin-Streptomycin Gibco 15070063
Phosphate-buffered saline(1X) Gibco 20012027
PrimeScript RT Master Kit TakaRa Bio Inc RR036A
Proteinase K Sigma-Aldrich P6556
QuickBlock Blocking Buffer Beyotime Biotechnology P0260
scissor
SYBR1 Premix TakaRa Bio Inc
Toluidine Blue Beyotime Biotechnology
Trypan Blue Solution, 0.4% Gibco 15250061

DOWNLOAD MATERIALS LIST

References

  1. Jin, C., et al. Stem cell education for medical students at Tongji University: Primary cell culture and directional differentiation of rat bone marrow mesenchymal stem cells. Biochemistry and Molecular Biology Education. 46, (2), 151-154 (2018).
  2. Chu, D. T., et al. An Update on the Progress of Isolation, Culture, Storage, and Clinical Application of Human Bone Marrow Mesenchymal Stem/Stromal Cells. International Journal of Molecular Sciences. 21, (3), 708 (2020).
  3. Jin, Z., Chen, J., Shu, B., Xiao, Y., Tang, D. Bone mesenchymal stem cell therapy for ovariectomized osteoporotic rats: a systematic review and meta-analysis. BMC Musculoskeleton Disorder. 20, (1), 556 (2019).
  4. Jiang, Y., et al. Pluripotency of mesenchymal stem cells derived from adult marrow. Nature. 418, (6893), 41-49 (2002).
  5. Musina, R. A., Bekchanova, E. S., Belyavskii, A. V., Sukhikh, G. T. Differentiation potential of mesenchymal stem cells of different origin. Bulletin of Experimental Biology and Medicine. 141, (1), 147-151 (2006).
  6. Lloyd, B., et al. Similarities and differences between porcine mandibular and limb bone marrow mesenchymal stem cells. Archives in Oral Biology. 77, 1-11 (2017).
  7. Zhang, W., et al. Comparison of the use of adipose tissue-derived and bone marrow-derived stem cells for rapid bone regeneration. Journal of Dental Research. 92, (12), 1136-1141 (2013).
  8. Stefanik, D., et al. Disparate osteogenic response of mandible and iliac crest bone marrow stromal cells to pamidronate. Oral Disorders. 14, (5), 465-471 (2008).
  9. Aghaloo, T. L., et al. Osteogenic potential of mandibular vs. long-bone marrow stromal cells. Journal of Dental Research. 89, (11), 1293-1298 (2010).
  10. Kaigler, D., et al. Stem cell therapy for craniofacial bone regeneration: a randomized, controlled feasibility trial. Cell Transplantation. 22, (5), 767-777 (2013).
  11. Li, C., Wang, F., Zhang, R., Qiao, P., Liu, H. Comparison of proliferation and osteogenic differentiation potential of rat mandibular and femoral bone marrow mesenchymal stem cells in vitro. Stem Cells Development. 2020, 1941629 (2020).
  12. Matsubara, T., et al. Alveolar bone marrow as a cell source for regenerative medicine: differences between alveolar and iliac bone marrow stromal cells. Journal of Bone and Mineral Research. 20, (3), 399-409 (2005).
  13. Chan, C. K. F., et al. Identification of the Human Skeletal Stem Cell. Cell. 175, (1), 43-56 (2018).
  14. Bianco, P., Riminucci, M., Gronthos, S., Robey, P. G. Bone marrow stromal stem cells: nature, biology, and potential applications. Stem Cells. 19, (3), 180-192 (2001).
  15. Franken, N. A., Rodermond, H. M., Stap, J., Haveman, J., van Bree, C. Clonogenic assay of cells in vitro. Nature Protocol. 1, (5), 2315-2319 (2006).
  16. Xu, H., et al. Icariin prevents oestrogen deficiency-induced alveolar bone loss through promoting osteogenesis via STAT3. Cell Proliferation. 53, (2), 12743 (2020).
  17. Zhang, P., Wu, Y., Jiang, Z., Jiang, L., Fang, B. Osteogenic response of mesenchymal stem cells to continuous mechanical strain is dependent on ERK1/2-Runx2 signaling. Internation Journal of Molecular Medicine. 29, (6), 1083-1089 (2012).
  18. Zhu, H., et al. A protocol for isolation and culture of mesenchymal stem cells from mouse compact bone. Nature Protocol. 5, (3), 550-560 (2010).
  19. Lach, M. S., et al. Chondrogenic Differentiation of Pluripotent Stem Cells under Controllable Serum-Free Conditions. International Journal of Molecular Sciences. 20, (11), 2711 (2019).
  20. Huang, X., Zhong, L., Hendriks, J., Post, J. N., Karperien, M. The Effects of the WNT-Signaling Modulators BIO and PKF118-310 on the Chondrogenic Differentiation of Human Mesenchymal Stem Cells. International Journal of Molecular Sciences. 19, (2), 561 (2018).
  21. Gale, A. L., Linardi, R. L., McClung, G., Mammone, R. M., Ortved, K. F. Comparison of the Chondrogenic Differentiation Potential of Equine Synovial Membrane-Derived and Bone Marrow-Derived Mesenchymal Stem Cells. Frontiers in Veterinary Sciences. 6, 178 (2019).
  22. Li, X., Zhang, Y., Qi, G. Evaluation of isolation methods and culture conditions for rat bone marrow mesenchymal stem cells. Cytotechnology. 65, (3), 323-334 (2013).
  23. Kagami, H., Agata, H., Tojo, A. Bone marrow stromal cells (bone marrow-derived multipotent mesenchymal stromal cells) for bone tissue engineering: basic science to clinical translation. International Journal of Biochemistry and Cell Biology. 43, (3), 286-289 (2011).
  24. Chamberlain, G., Fox, J., Ashton, B., Middleton, J. Concise review: mesenchymal stem cells: their phenotype, differentiation capacity, immunological features, and potential for homing. Stem Cells. 25, (11), 2739-2749 (2007).
  25. Abdallah, B. M., Alzahrani, A. M., Abdel-Moneim, A. M., Ditzel, N., Kassem, M. A simple and reliable protocol for long-term culture of murine bone marrow stromal(mesenchymal) stem cells that retained their in vitro and in vivo stemness in long-term culture. Biology Proceedings Online. 21, 3 (2019).
Isolasjon og dyrking av mandibulær benmarg Mesenchymale stamceller hos rotter
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).More

Hong, Y., Xu, H., Yang, Y., Zhou, S., Jin, A., Huang, X., Dai, Q., Jiang, L. Isolation and Cultivation of Mandibular Bone Marrow Mesenchymal Stem Cells in Rats. J. Vis. Exp. (162), e61532, doi:10.3791/61532 (2020).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter