RESEARCH
Peer reviewed scientific video journal
Video encyclopedia of advanced research methods
Visualizing science through experiment videos
EDUCATION
Video textbooks for undergraduate courses
Visual demonstrations of key scientific experiments
BUSINESS
Video textbooks for business education
OTHERS
Interactive video based quizzes for formative assessments
Products
RESEARCH
JoVE Journal
Peer reviewed scientific video journal
JoVE Encyclopedia of Experiments
Video encyclopedia of advanced research methods
EDUCATION
JoVE Core
Video textbooks for undergraduates
JoVE Science Education
Visual demonstrations of key scientific experiments
JoVE Lab Manual
Videos of experiments for undergraduate lab courses
BUSINESS
JoVE Business
Video textbooks for business education
Solutions
Language
English
Menu
Menu
Menu
Menu
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Research Article
Yan Du*1, Taiqiang Jiao*2, Wenli Ma3, Bo Zhou1, Yang Niu4,5, Chunyang Mao4,5
1School of Traditional Chinese Medicine,Ningxia Medical University, 2The First Clinical College,Nanjing University of Chinese Medicine, 3Ningxia Chinese Medicine Research Center, 4Key Laboratory of Dryness Syndrome in Chinese Medicine, Ministry of Education,Ningxia Medical University, 5Ningxia Regional Key Laboratory of Integrated Traditional Chinese and Western Medicine for Prevention and Treatment of Regional High Incidence Disease,Ningxia Medical University
Erratum Notice
Important: There has been an erratum issued for this article. View Erratum Notice
Retraction Notice
The article Assisted Selection of Biomarkers by Linear Discriminant Analysis Effect Size (LEfSe) in Microbiome Data (10.3791/61715) has been retracted by the journal upon the authors' request due to a conflict regarding the data and methodology. View Retraction Notice
We applied animal and cell experiments to verify the effect of Qingzao Jiufei Decoction (QJD) on idiopathic pulmonary fibrosis (IPF). The findings of this study showed that QJD delays and reverses IPF progression by inhibiting the TGF-β/Smad signaling pathway.
This study aimed to investigate the therapeutic effects of Qingzao Jiufei Decoction (QJD) on idiopathic pulmonary fibrosis (IPF) and its regulatory mechanism involving the TGF-β/Smad signaling pathway.
Rats were divided into six groups: control, model, pifenidone (PFD), QJD Low Dose (QJD-L), QJD Medium Dose (QJD-M), and QJD High Dose (QJD-H). IPF was induced using bleomycin. Histopathological and ultrastructural changes in the lung tissue were analyzed. Levels of α-smooth muscle actin (α-SMA), collagen I (COL-1), fibronectin (FN1), TGF-β1, Smad2/3, and p-Smad2/3 proteins were measured. A TGF-β1-induced HFL-1 cell model was used to investigate the effects of QJD on the expression of α-SMA, COL-1, and FN1. Additionally, the TGF-β1 signaling agonist SRI-011381 was used to further determine the role of the TGF-β/Smad signaling pathway.
Results: In vivo, compared with the control group, rats in the model group showed significantly reduced dietary and water intake, along with an increased lung coefficient. Lung tissue showed infiltration of inflammatory cells, thickening of alveolar walls, and marked signs of fibrosis. Additionally, edematous alveolar type II epithelial cells with severe fibrosis were observed, characterized by swollen and deformed intracellular organelle structures and a reduced number of rough endoplasmic reticulum. Levels of α-SMA, COL-1, FN1, TGF-β1, and p-Smad2/3 were significantly elevated. Treatment with QJD or PFD markedly alleviated BLM-induced symptoms. In vitro, whereas TGF-β1 induction significantly upregulated the expression of FN1, COL-1, and α-SMA, these effects were significantly attenuated by QJD treatment. Activation of the TGF-β/Smad signaling pathway with the TGF-β1 agonist SRI-011381 increased FN1, COL-1, and α-SMA expression and aggravated pulmonary fibrosis. However, QJD reversed the fibrotic effects induced by SRI-011381, suggesting that QJD ameliorates pulmonary fibrosis by inhibiting TGF-β/Smad signaling pathway.
The findings of this study suggest that QJD attenuates and reverses the progression of pulmonary fibrosis by modulating the TGF-β/Smad signaling pathway.
Idiopathic pulmonary fibrosis (IPF), a chronic interstitial lung disease of unknown etiology with an annual prevalence of (2-29)/100,000 and average survival time of 3.2 years, is characterized by cough, sputum, exertional dyspnea, and progressive exacerbation1,2,3. Given the poor prognosis and short survival span, the primary therapeutic focus is to prevent and inhibit its further progression. Although current therapeutic approaches, such as nidazanib and pirfenidone, effectively delay disease progression, they do not reduce the mortality rate4,5. Furthermore, their widespread use is limited by side effects and high cost6. Thus, new therapies able to treat IPF with fewer side effects are required.
IPF is categorized in traditional Chinese medicine (TCM) under "pulmonary atrophy" and "pulmonary obstruction", characterized by a complex pathogenesis involving both deficiency and excess. As a delicate and yin-deficient organ, the lung thrives on moisture and is vulnerable to dryness. When dryness predominates, it readily damages body fluids, impairing the lung's ability to maintain proper moisturizing function. This disrupts the transport of fluids within the lung lobules, leading to the withering and dysfunction of lung tissue, and ultimately the onset of disease7.
Qingzao Jiefei Decoction (QJD) is a classic TCM formula used for treating lung disorders. It consists of Morus indica L. (Sang Ye), CaSO4·2H2O (Shi Gao), Glycyrrhiza uralensis Fisch. (or Glycyrrhiza inflata Bat., or Glycyrrhiza glabra L.) (Gan Cao), Panax ginseng C.A.Mey. (Ren Shen), Sesamum indicum L. (Hu Ma Ren), Equus asinus L. (E Jiao), Ophiopogon japonicus (Linn. f.) Ker-Gawl. (Mai Dong), Prunus armeniaca L. var. ansu Maxim. (or P. sibirica L., or P. mandshurica (Maxim. ) Koehne, or P. armeniaca L.) (Xing Ren), and Eriobotrya japonica (Thunb.) Lindl. (Pi Pa Ye). It clears dryness, moisturizes the lungs, nourishes yin, and replenishes qi. Although QJD is widely used for the treatment of IPF with remarkable clinical efficacy8, the underlying mechanisms are still unclear. Therefore, previous studies lack in vivo and in vitro experiments, and this study aims to fill the gap.
Previous network pharmacology predictions suggest that QJD may influence the pathogenesis of IPF by regulating the TGF-β/Smad signaling pathway through its active components, quercetin and β-sitosterol9. Research indicates that QJD exerts a "moistening dryness" effect by alleviating pulmonary inflammation, reducing Mycoplasma pneumoniae (MP) toxin levels, and increasing levels of bioactive substances in lung tissue10. Zhao et al. reported that QJD treatment in IPF patients enhances anti-inflammatory activity and promotes lung tissue repair, while lowering serum MMP-7, osteopontin, and KL-6 levels, thereby improving exercise endurance, quality of life, and clinical outcomes for IPF patients11. Although other commonly used clinical formulas, such as Bu Fei Tang and Shen Long Decoction, have also been shown in preliminary studies to ameliorate the progression of pulmonary fibrosis in mice by regulating the TGF-β1/Smad signaling pathway, these formulas primarily focus on tonifying lung qi and promoting blood circulation to remove stasis12,13. Considering that the TGF-β/Smad signaling pathway was previously shown being involved in the pathological process of pulmonary fibrosis14, we used the PFD-induced rat model and the TGF-β1-induced HFL-1 model to verify the involvement of the TGF-β/Smad pathway in the positive effect of QJD on IPF. To the best of our knowledge, this study is the first to demonstrate, through both in vivo and in vitro models, that QJD demonstrates anti-fibrotic effects by modulating the TGF-β/Smad signaling pathway, thereby revealing a potential molecular mechanism underlying its therapeutic action in IPF. The overall experimental workflow is illustrated in Figure 1.
Animal experiments were conducted in accordance with the principles of the ARRIVE Guidelines. All experimental procedures were reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of Ningxia Medical University (Approval No. IACUC-NYLAC-2022-151). Cell experiments using human embryonic lung fibroblasts (HFL-1) that are commercially available, thus ethical approval was waived.
Experimental preparation
Experimental animals
Sprague Dawley (SD) (n = 60, SPF grade, 6-8 weeks, 180-200 g, 50% male and 50% female) were purchased at the Animal Experimentation Center (Ningxia Medical University, License No. SCXK (Ningxia)2020-0001) and housed in the Animal Barrier Center of Ningxia Medical University at 23-26 °C, 40-60% humidity, and 12 h light and darkness cycles. The rats were allowed free access to food and water.
Cell culture
Human embryonic lung fibroblasts (HFL-1) were grown in Ham's F-12K culture medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (P/S) at 37 °C, 5% CO2, and 95% air. For experiments, cells in the logarithmic phase were used.
Preparation of QJD
QJD is composed of Sang Ye (9 g), Shi Gao (8 g), Gan Cao (3 g), Ren Shen (2 g), Hu Ma Ren (3 g), E Jiao (3 g), Mai Dong (4 g), Xing Ren (2 g), Pi Pa Ye (3 g). All components were authenticated by Professor Gao Xiaojuan, School of Medicine, Ningxia Medical University.
The herbs were soaked in 10 times their volume of water for 1 h, then boiled for 30 min to obtain the first extract. Then an additional 8 times volume of water was added to the residue and boiled for another 30 min to obtain the second extract. The two extracts were mixed and filtered through gauze, and concentrated to 1.12 g/mL.
Experimental procedures
In vivo experiments
Animal grouping and drug administration
After having a normal diet for 1 week of adaptive feeding, 60 rats were randomly assigned to 6 groups of 10 animals (control, model group, pifenidone group (PFD, 162 mg/kg), QJD-L, QJD-M, and QJD-H.
Except for the control group, all animals were anaesthetized by intraperitoneal injection of 2% pentobarbital sodium solution (40 mg/kg), fixed on a rat plate with the head upwards, and laryngoscopic intubation was performed. The rats received BLM (5 mg/kg), while control animals received an equal volume of saline. Then, the rats were held upright and rotated along the longitudinal axis for 3 min in order to diffuse the drug in the lungs15. After successful modeling, administration of the drug started on the following day. Considering the clinical QJD and PFD doses (37 g/day and 1800 mg/day, respectively) and based on the equivalent dose of the drug in humans and rats according to the body surface area, the PFD group received 162 mg/kg PFD while the QJD-L, QJD-M, and QJD-H groups received 1.65 g/kg, 3.3 g/kg, and 6.6 g/kg QJD, respectively. Control and model groups received saline for 4 weeks13.
Anesthesia and sampling of animals
After the last administration, the rats had only access to water for 12 h. At the time of sampling, rats were anaesthetized with 2% pentobarbital sodium solution (40 mg/kg) through intraperitoneal injection. Lungs were excised, washed with pre-cooled physiological saline to remove blood stains and residual connective tissues, weighed, and the lung coefficient was calculated (lung coefficient = lung wet weight (mg)/body mass (g) × 100%). The upper lobe was fixed in 4% paraformaldehyde for hematoxylin and eosin (HE), Masson staining, and immunofluorescence. The lower lobe of the left lung was cut and fixed in 2.5% glutaraldehyde for transmission electron microscopy observation. The right lung was stored at -80 °C for future analysis.
General condition of the animal
During the experimental period, the rats were observed daily for mental status, respiration condition, behavior, and coat luster. In case of death, the date and time of death were recorded.
Histopathological observations of the lungs
The collected lung tissues were fixed in 4% paraformaldehyde for 24 h, dehydrated, embedded, and sectioned. HE and Masson staining were performed according to the kit instructions. The degree of alveolar inflammation was evaluated with the Szapiel scale, and the severity of fibrosis was assessed with the Ashcroft scale16.
Ultrastructural observation of lung tissue
The collected lung tissues were fixed in 2.5% glutaraldehyde for more than 4 h, washed with PBS, and fixed with 1% osmium tetroxide for 1.5 h. Then, they were dehydrated with ethanol and acetone gradients, followed by impregnation, embedding, trimming, sectioning, and staining. Finally, they were observed under a transmission electron microscope to observe the ultrastructural changes.
Immunofluorescence of lung tissue
The paraffin sections were dewaxed and subjected to antigen retrieval. Then, they were blocked at room temperature for 1 h, and the sections were incubated with the corresponding primary antibodies (α-SMA, COL 1, FN1, TGF-β1, Smad2/3, and p-Smad2/3; dilution: 1:200) overnight at 4 °C. Then, the sections were washed with PBS and incubated with the secondary antibody (Goat Anti-Rabbit IgG (H+L) Cy3 conjugate; dilution: 1: 1000) for 1 h at room temperature. Finally, the sections were washed with PBS, and the nuclei were counterstained with 4',6-diamidino-2-phenylindole (DAPI) in the dark for 10 min at room temperature. Finally, the sections were observed under a fluorescence microscope, and images were captured.
Western blot (WB) analysis of lung tissue
Approximately 10 mg of frozen lung tissue was minced and lysed in 100 µL of strong radioimmunoprecipitation assay (RIPA) lysis buffer containing protease and phosphatase inhibitors. The tissue was thoroughly homogenized using a homogenizing rod and incubated on ice for 30 min. The lysates were then centrifuged at 10,625 g for 15 min at 4°C, then the supernatant was collected. Protein concentration in the supernatant was determined using the bicinchoninic acid (BCA) assay, and the samples were normalized accordingly. After electrophoresis, membrane transfer, and blocking, the membranes were incubated with primary antibodies (α-SMA, COL-1, FN1, TGF-β1, Smad2/3, and p-Smad2/3; dilution: 1:1000) at 4 °C overnight and then with secondary antibodies (Goat Anti-Rabbit IgG (H+L) HRP; dilution: 1: 10,000) at room temperature for 2 h. Subsequently, luminescent-mediated imaging was performed on a gel imaging system. Gray-scale scanning analysis was conducted using ImageJ software. All experiments were independently repeated three times.
In vitro tests
CCK- 8 analysis
HFL-1 cells grown in log phase were taken and inoculated in 96-well plates at 1×104 cells per well. The next day, the cells were treated with different concentrations of TGF-β1 (0, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 µg/L) for 12, 24, and 36 h. Then, 10 µL of CCK-8 solution was added, the plates were incubated at 37 °C for 2 h, and optical density (OD) was detected at 450 nm. The optimal TGF-β1 concentration and intervention time were selected for subsequent experiments.
Next, HFL-1 cells were inoculated in 96-well plates at 1 × 104 cells per well, QJD was added with or without TGF-β1, and incubated for 24 h at 37 °C. Then, 10 µL of CCK-8 solution was added and incubated at 37 °C for 2 h. The OD was detected at 450 nm, and cell viability was estimated as cell proliferation viability (%) = ([OD experimental group - OD blank]/[OD control - OD blank]) × 100.
Cell grouping
Cells were grouped as Control (conventional culture), Model (10 µg/L TGF-β1), QJD (model group with 50 mg/L QJD), SRI-011381 (model group with 10 mg/L SRI-011381), and QJD + SRI-011381 (model group with 10 mg/L SRI-011381 and 50 mg/L QJD). Cells in each group were treated as outlined above and cultured for 24 h.
WB analysis
Collected cells were lysed in 100 µL of strong RIPA lysis buffer containing protease and phosphatase inhibitors. The lysate was thoroughly mixed and incubated on ice for 30 min. Samples were then centrifuged at 10,625 g for 15 min at 4 °C, and the supernatant was collected. Protein concentration in the supernatant was determined using the BCA assay, and samples were normalized accordingly. After electrophoresis, membrane transfer, blocking, membranes were incubated with primary antibodies (α-SMA, COL-1, FN1, TGF-β1, Smad2/3, and p-Smad2/3; dilution: 1:1000) at 4 °C for overnight, and secondary antibodies (Goat Anti-Rabbit IgG (H+L) HRP; dilution: 1: 10,000) at room temperature for 2 h. Subsequently, a luminescent solution was added, and imaging was performed on a gel imaging system. Gray-scale scanning analysis was conducted using ImageJ software. All experiments were independently repeated three times.
RT-qPCR analysis
Total RNA was extracted from the collected cells using Trizol lysis buffer (1 mL per dish). The lysate was thoroughly mixed and incubated at room temperature for 5 min. Then 200 µL chloroform was added, vortexed vigorously for 15 s, and incubated for 3 min at room temperature. Samples were then centrifuged at 10,625 g for 15 min at 4 °C, and the aqueous phase was collected. An equal volume of isopropanol was added, mixed thoroughly, and incubated for 10 min at room temperature. The mixture was centrifuged at 10,625 g for 10 min at 4 °C, and the supernatant was discarded. A white RNA pellet was visible at the bottom of the tube. The pellet was washed with 1 mL of pre-chilled 75% ethanol by gently inverting the EP tube, then centrifuged at 4150 g for 5 min at 4 °C. The supernatant was discarded, and the pellet was air-dried for 5 min at room temperature. The RNA was then dissolved in 20-50 µL of RNase-free water and stored at -80 °C. Total RNA was purified using a commercial RNA extraction kit. The concentrations were normalized prior to reverse transcription, and RT-qPCR was performed. Primers used in this study are listed in Table 1.
Statistical analysis
Data were represented as mean ± standard deviation (x̅±s). Excel and GraphPad Prism 8 were used for analysis and figure generation. Student's t-test was used between two groups, and one-way ANOVA was used for comparison between multiple groups. A P<0.05 was considered statistically significant.
In vivo experiments
Effects of QJD on the general condition of IPF rats
Rats in the control group had normal food and water intake, were in good spirits, had calm and smooth breathing, had lustrous fur, and moved about normally. Compared to the control group, rats in the model group had reduced food and water intake, were listless, had shortness of breath, rough and yellowish fur, were lethargic, and preferred to lie down. Compared to the model group, the above-described abnormal symptoms were significantly alleviated in both the QJD-dose and the PFD groups.
Before modeling, there was no significant difference in body weight between the rats in each group. Compared to the control group, the body mass in the model group was significantly reduced before sampling (P < 0.01). Compared to the model group, there was a significantly higher body mass in rats of the PFD group (P < 0.01) and a dose-dependent, significantly higher body mass in rats of the QJD dose groups (P < 0.05 or P < 0.01) (Figure 2A).
Compared to control, animals in the model group had significantly higher lung coefficients (P < 0.01). Compared to the model group, there was a significantly lower lung coefficient in rats of the PFD group (P < 0.05) and a significantly lower lung coefficient in rats of the QJD dose groups in a dose-dependent manner (P < 0.01) (Figure 2B).
Effect of QJD on the pathological morphology of the lung tissue of IPF rats
Lung tissues of control animals were clear and intact, without thickening of alveolar septa, and no obvious inflammation (Figure 3A). In the model group, the lung tissues showed obvious signs of damage with thickened alveolar septa and enlarged or atrophied alveoli, and infiltration of a large number of inflammatory cells in the alveolar cavities. Compared to the model group, the above-described abnormal symptoms were significantly alleviated in both the QJD-dose and the PFD groups.
Compared to control, the model group had a significantly higher Szapiel score (P<0.01). Compared to the model group, there was a significantly lower Szapiel score in rats of the PFD group (P < 0.01) and significantly lower Szapiel score in rats of the QJD dose groups in a dose-dependent manner (P < 0.05 or P < 0.01) (Figure 3B).
Rats in the control group had a normal lung tissue structure with no obvious deposition of blue-stained collagen fibers (Figure 4A). Compared to control, the lung tissue structure of the model group was severely damaged with significant proliferation and collagen deposition. Compared to the model group, lung tissue structure of the QJD-dose and PFD groups was relatively clear with significantly less collagen fiber deposition.
Compared to the control group, the Ashcroft score of the model group was significantly higher (P<0.001). Compared to the model group, there was a significantly lower Ashcroft score in rats of the PFD group (P < 0.001) and a dose-dependent, significantly lower Ashcroft score in rats of the QJD dose groups (P < 0.01 or P < 0.001) (Figure 4B).
Effect of QJD on the ultrastructure of lung tissue of rats with IPF
Transmission electron microscopy revealed a normal lung cell structure in control (Figure 5). The alveolar type I epithelial cells were flattened and long shuttle-shaped, with intact cell membranes and homogeneous cytoplasm. The overall structure of type II epithelial cells was relatively normal, with intact cell membranes, clear boundaries, and homogeneous cytoplasm. Most organelles had normal structures. The microvilli were abundant in number, elongated in structure, rich in intercellular tight junctions, and with longer dense areas. The nuclei were irregularly shaped, with intact nuclear membranes, normal nuclear peripheral gaps, homogeneous chromatin, and larger nucleoli. The mitochondria were slightly swollen, and the matrix inside the membrane was slightly faded, with the cristae arranged parallel to one another. The rough endoplasmic reticulum was not significantly expanded, and ribosomes could be seen attached to the surface. The structure of lamellipodia was acceptable, and the lamellipodia were arranged in parallel. The Golgi apparatus was not significantly proliferated or hypertrophied. No typical autophagic structures were observed in this field of view. More erythrocyte aggregates were seen in the capillary lumen, while the lungs were bruised. The endothelial cells had a fair structure with intact membranes, uniform matrix, and normal organelle structure.
Compared to control, the rat alveolar type II epithelial cells in the model group were heavily edematous with heavy fibrosis. A large number of collagen fibers were densely distributed around the cells, the cell membranes were complete, microvilli were reduced and disappeared, the intracellular matrix was sparse, and the intracellular organelles were heavily swollen and disintegrated. The nuclei of the cells were irregularly shaped, with homogeneous chromatin, intact nuclear membranes, and normal nuclear periphery. The mitochondria were heavily swollen, with dissolved matrix, disappeared cristae, and altered vacuoles. Rough endoplasmic reticulum was less in number, obviously expanded, and most of the membranes were disintegrated. Golgi vesicle membranes were broken. Lamellipodia were swollen, with a loose and disorganized structure. Compared to the model group, the above-described anomalies were significantly improved in the PFD group and dose-dependently in the QJD groups.
Effect of QJD on lung tissue immunofluorescence of IPF rats
Compared to control, lung tissue of the model group had significantly elevated α-SMA, COL-1, FN1, TGF-β, and Smad2/3 protein levels (P < 0.01) (Figure 6). Compared to the model group, protein expression levels of α-SMA, COL-1, FN1, TGF-β, and Smad2/3 were significantly lower in lung tissue of rats of the PFD group and significantly lower in lung tissue in rats of the QJD dose groups in a dose-dependent manner.
Effect of QJD on TGF-β/Smad signaling pathway in lung tissue of rats with IPF
Similar to the immunofluorescence results, western blot revealed significantly elevated expression levels of α-SMA, COL-1, FN1, TGF-β, and p-Smad2/3 in lung tissue of animals in the model group compared to control (P < 0.01) (Figure 7). Compared to the model group, protein expression levels of α-SMA, COL-1, FN1, TGF-β, and Smad2/3 were significantly lower in lung tissue of rats of the PFD group and significantly lower in lung tissue in rats of the QJD dose groups in a dose-dependent manner. Of note, Smad2/3 protein expression levels were similar in all groups (P> 0.05).
In vitro experiments
Effect of QJD on HFL-1 cell viability
Previously, 10 µg/L for 24 h was described as the optimal concentration and time for TGF-β1-induction of HFL1 cell 13 17. Indeed, the viability of HFL1 cells was significantly elevated after TGF-β1 induction with the highest cell viability at a concentration of 10 µg/L (Figure 8A), so this was used as the optimal intervention concentration and time in the subsequent experiments.
At concentrations below 50 mg/L, QJD has a beneficial effect on HFL1 cell proliferation (Figure 8B). At concentrations above 80 mg/L, QJD has an inhibitory effect on the proliferation of HFL1 cells. Of note, at 50 mg/L, no significant difference between QJD-treated cells and control was observed (P > 0.05) (Figure 8B).
Compared to control, TGF-β1 induction significantly increased the viability of HFL-1 cells in the model group (Figure 8C). Compared to the model group, no significant effect of QJD on cell viability was observed with QJD concentrations below 8 mg/L. At concentrations between 10 and 50 mg/L, QJD remarkably inhibited the TGF-β1-induced HFL1 cell viability increase with a gradual, dose-dependent recovery to the normal cell viability. At concentrations above 50 mg/L, the cell viability was below the normal level. Based on these results, the following groupings were established: control group: normal culture; model group: HFL1 cells treated with 10 µg/L TGF-β1 for 24 h; QJD group: model group treatment supplemented with 50 mg/L QJD.
Effect of QJD on fibrotic protein expression in HFL-1 cells after TGF-β1 induction
Differentiation of fibroblasts into myofibroblasts is one of the key steps in the pathogenesis of IPF 18,19. Thus, expression levels of fibrosis-related markers FN1, COL-1, and α-SMA were used to evaluate the modelling and the effectiveness of QJD on HFL-1 cells after TGF-β1 induction.
Compared to control, TGF-β1 induction resulted in significantly higher FN1, COL-1, and α-SMA expression levels in HFL-1 cells (P < 0.001). Compared to the model, QJD could significantly attenuate FN1, COL-1 and α-SMA in the cells after modelling (P < 0.01) (Figure 9). These observations suggest that QJD can significantly reduce the TGF-β1-induced expression of fibrosis-related markers in HFL-1 cells.
Effects of QJD and SRI-011381 on protein expression in HFL-1 cells after TGF-β1 induction
Next, the involvement of the TGF-β/Smad signaling pathway on QJD-mediated inhibition of IPF development was confirmed with the TGF-β1 agonist SRI-011381.
Compared to model, SRI-011381 significantly elevated expression of α-SMA, COL1, FN1, TGF-β, and p-Smad2/3 proteins (P < 0.01), indicating that activation of the TGF-β/Smad signaling pathway promoted the development of IPF (Figure 10). Adding QJD to the SRI-011381 group significantly reduced α-SMA, COL-1, FN1, TGF-β, and p-Smad2/3 expression levels in HFL-1 cells (P < 0.01), suggesting that QJD antagonizes with SRI-011381 and that QJD inhibits IPF development through TGF-β/Smad signaling pathway inhibition.
Effects of QJD and SRI-011381 on mRNA expression in HFL-1 cells after TGF-β1 induction
Compared to control, the model group had significantly increased α-SMA, COL-1, FN1, TGF-β, Smad2, and Smad3 mRNA expression levels (P < 0.01) (Figure 11). Compared to model, QJD significantly reduced α-SMA, COL-1, FN1, TGF-β, Smad2, and Smad3 mRNA expression levels (P < 0.01), while SRI-011381 intensified the expression levels of these genes (P < 0.01). Of note, co-administration of QJD and SRI-011381 had a significant antagonistic effect.
DATA AVAILABILITY:
The dataset used in this study has been publicly released and is available for fellow researchers to access and validate. The dataset is hosted on figshare and can be accessed via the following DOI link: 10.6084/m9.figshare.30454436.

Figure 1: Experimental workflow. Please click here to view a larger version of this figure.

Figure 2: General condition of rats in each group. (A) change process of body weight from before modelling to before sampling in each group of rats (n = 10). (B) The lung coefficients of rats in each group (n = 10).###P < 0.001 vs Control; *P < 0.05, **P < 0.01, and ***P < 0.001 vs Model; nsP > 0.05 vs Model. Please click here to view a larger version of this figure.

Figure 3: HE staining results and Szapiel scores of lung tissues of rats in each group.
(A) HE staining results of lung tissues of rats in each group (H&E, x200, n = 5). (B) Szapiel scores for lung tissue damage of rats in each group (n = 5). ###P < 0.001 vs Control; *P < 0.05, **P < 0.01, and ***P < 0.001 vs Model; nsP > 0.05 vs Model. Please click here to view a larger version of this figure.

Figure 4: Masson staining results and Ashcroft scores of lung tissues of rats in each group. (A) Masson staining results of lung tissues of rats in each group (Masson, ×200, n = 5). (B) Ashcroft scores for lung tissue injury of rats in each group (n = 5).###P < 0.001 vs Control; *P < 0.05 vs Model, **P < 0.01 vs Model, ***P < 0.001 vs Model, nsP > 0.05 vs Model. Please click here to view a larger version of this figure.

Figure 5: Electron microscopy results of rat lung tissue in each group. Top panels: 4000x. The red square indicates a magnified region (EM, 10000×). Please click here to view a larger version of this figure.

Figure 6: Immunofluorescence detection results of rat lung tissue in each group. (A) α-SMA fluorescence staining. (B) COL-1 fluorescence staining. (C) FN1 fluorescence staining. (D) Smad2/3 fluorescence staining. (E) TGF-β fluorescence staining (IF, ×100, n = 5).###P < 0.001 vs Control; *P < 0.05, **P < 0.01, and ***P < 0.001 vs Model; nsP > 0.05 vs Model. Please click here to view a larger version of this figure.

Figure 7: The results of TGFβ/Smad signaling pathway and fibrosis-related protein expression in rat lung tissues of each group. ###P < 0.001 vs Control; *P < 0.05, **P < 0.01, and ***P < 0.001 vs Model; nsP > 0.05 vs Model. Please click here to view a larger version of this figure.

Figure 8: Effects of TGF-β1 and QJD on HFL-1 cell viability. (A) Effects of TGF-β1 on the viability of HFL-1 cells. (B) Effects of different concentrations of QJD on HFL-1 cell viability. (C) Effect of QJD on HFL-1 cell viability after TGF-β1 stimulation. ###P < 0.001 vs Control; *P < 0.05, **P < 0.01, and ***P < 0.001 vs Model, nsP > 0.05 vs Model. Please click here to view a larger version of this figure.

Figure 9: Effect of QJD on fibrosis-related markers in HFL-1 cells after TGF-β1 stimulation. ###P < 0.001 vs Control; *P < 0.05, **P < 0.01, ***P < 0.001 vs Model; nsP > 0.05 vs Model. Please click here to view a larger version of this figure.

Figure 10: Effect of QJD and SRI-011381 on the expression of TGF-β/Smad pathway proteins andfibrosis-related proteins in HFL-1 cells after TGF-β1 stimulation. ###P < 0.001 vs Control; *P < 0.05, **P < 0.01, and ***P < 0.001 vs Model, nsP > 0.05 vs Model. Please click here to view a larger version of this figure.

Figure 11: Effect of QJD and SRI-011381 on the expression of TGF-β/Smad pathway mRNA and fibrosis-related mRNA in HFL-1 cells after TGF-β1 stimulation. ###P < 0.001 vs Control; *P < 0.05, **P < 0.01, and ***P < 0.001 vs Model; nsP > 0.05 vs Model. Please click here to view a larger version of this figure.
| Gene names | Forward primers | Reverse primers |
| α-SMA | ACCATCGGGAATGAACGCTT | CTGTCAGCAATGCCTGGGTA |
| COL-1 | CGTGGAAACCTGATGTATGCTTG | CCTATGACTTCTGCGTCTGGTGA |
| FN1 | AAACCTCTACGGGTCGCTG | GCGCTGGTGGTGAAGTCAAA |
| TGF-β1 | GCTGAACCAAGGAGACGGAATA | GCAGGTGTTGAGCCCTTTCC |
| Smad2 | ACTGCCGCCTCTGGATGACTAT | AGAGAGTGGTAGGAGACAGTTCAGC |
| Smad3 | TTTGGTGCTCCATCTCCTACTACG | TGCCGCCTTGTAAGCTCCAC |
| GAPDH | GGAAGCTTGTCATCAATGGAAATC | TGATGACCCTTTTGGCTCCC |
Table 1: Primer sequences used for RT-qPCR.
IPF is a chronic interstitial lung disease characterized by high mortality and complex course. In China, the prevalence of IPF has been steadily increasing, largely due to the factors such as population aging, environmental pollution, and a large smoking population20. The inflammatory response triggered by early lung injury is considered one of the major contributing factors in the development of pulmonary fibrosis21. Dysregulated repair of AECs induces EMT, stimulating pulmonary fibroblasts to differentiate into myofibroblasts. This leads to excessive ECM deposition and abnormal remodeling of lung tissue, ultimately resulting in pulmonary fibrosis22. Elevated oxidative stress, excessive production of reactive oxygen species (ROS), and impaired antioxidant defense mechanisms in the lung tissue of IPF patients collectively contribute to cellular injury and apoptosis, thereby promoting pulmonary fibrosis23,24. Current treatment methods are scarce and of limited efficacy1. Traditional Chinese medicine, with its multi-pathway, multi-level and multi-target characteristics, has demonstrated its unique advantages in improving the symptoms and quality of life of IPF patients25,26.
QJD is from "Yi Men Fa Lu". While it is a classic formula for the treatment of dryness-mediated lung damage, clinical studies indicated that QJD has an overall effective rate as high as 96 % in the treatment of IPF which is exemplified by effective symptom alleviation and survival quality improvement27,28. Previous studies indicated that ginsenoside R1 of ginseng29, 18β-glycyrrhizinic acid30 of licorice, ophiopogonin D of Ophiopogon japonicus31, and bitter amygdalin of almonds 32 effectively delay IPF progression. However, the specific mechanism of the combination of many traditional Chinese medicines in the formula for IPF treatment is still unclear. Previous network pharmacology predictions indicated that QJD may be involved in IPF development via the TGF-β/Smad signaling pathway9. In fact, as a classic signaling pathway in the study of IPF, the TGF-β/Smad pathway was confirmed being involved in the pathological process of pulmonary fibrosis 14,33,34. Therefore, the current study verified if QJD mediates IPF development through the TGF-β/Smad signaling pathway.
Previously, the American Thoracic Society Symposium reported the bleomycin (BLM) model as the best animal model for preclinical experiments of pulmonary fibrosis 35. Due to its simplicity, strong reproducibility, and avoidance of surgical infection risk compared with tracheal exposure methods, the single non-invasive tracheal intubation drip is the most commonly used IPF modeling method36. Considering that the common dose of BLM for the preparation of IPF model in rats is 5-10 mg/kg36, a single non-invasive tracheal intubation drip of 5 mg/kg was used to induce IPF in rats in the present study. One of the common indicators for evaluating the efficacy of drugs is weight change. As BLM causes inflammatory reactions and fibrosis in lung, model group rats were listless, consumed less food and water, and showed a decreased weight gain. The lung coefficient is a simple and feasible method to evaluate pulmonary edema, and reflects to a certain extent the degree of lung damage. The increased lung coefficient in the model group indicated BLM-induced pulmonary edema and serious lung injury. Also, HE staining evidenced inflammatory cell infiltration and thickening of alveolar wall while Masson staining showed a significant increase of lung fibrosis. These observations indicated that the pathological changes of lung tissue in BLM-induced IPF rats included extensive alveolar inflammation, structural destruction of the lung tissue, and increase of collagen secretion. Moreover, transmission electron microscopy evidenced severe edema accompanied with fibrosis and swelling and deformation of intracellular organelles.
The degree of pulmonary fibrosis correlates with main markers of pulmonary fibrosis such as α-SMA, a marker of fibroblasts, COL-1, a structural protein in the extracellular matrix, and fibronectin (FN1)37,38. Consequently, immunofluorescence and WB evidenced significantly elevated BLM-induced α-SMA, COL-1 and FN1 expression levels. Moreover, significantly elevated TGF-β1 and p-Smad2/3 levels further suggested TGF-β/Smad pathway activation. Similar to PFD, administration of QJD significantly delayed or reversed the BLM-induced symptoms. This indicates that QJD effectively attenuates lung tissue injury and reduces inflammation, fibroblast differentiation, as well as collagen fiber production and deposition through the TGF-β/Smad pathway. Next, TGF-β1-induced HFL-1 fibroblasts were used to construct an in vitro lung fibrosis model, and the effectiveness of QJD was evaluated by cell viability and the expression levels of fibrosis-related markers FN1, COL-1 and α-SMA. Whereas TGF-β1 induction significantly increased the expression levels of FN1, COL-1, and α-SMA, these effects were significantly attenuated upon QJD administration. Moreover, TGF-β1 agonist SRI-011381-mediated activation of the TGF-β/Smad pathway increased FN1, COL-1, and α-SMA expression and aggravated pulmonary fibrosis. However, QJD reversed the SRI-011381-induced effects, suggesting that QJD ameliorates pulmonary fibrosis through TGF-β/Smad pathway inhibition. Emerging evidence suggests critical roles of EMT in the transformationof AECs into myofibroblasts and the progression of pulmonary fibrosis. TGF-β1, as a key molecule in activating fibrogenesis, primarily exerts its effects by regulating myofibroblast differentiation, proliferation, and ECM deposition39. Research indicates that QJD effectively reduces inflammatory cell infiltration in mouse lung tissue and alleviates oxidative stress, thereby exerting anti-fibrotic effects40. One of its major constituents, ophiopogon polysaccharide, may inhibit myofibroblast differentiation by interfering with the TGF-β/Smad signaling pathway 41. Moreover, an active component in QJD, quercetin, inhibits both Smad and MAPK signaling pathways, thereby reducing collagen production and ECM deposition42,43. Additionally, KMP has been shown to suppress ECM-receptor interactions by upregulating PPARG expression and inhibiting TNC expression, ultimately reducing inflammatory infiltration and collagen deposition in the lungs of IPF mice44. These findings suggest that QJD alleviates pulmonary fibrosis by regulating the TGF-β/Smad signaling pathway.
In summary, QJD effectively attenuates IPF-induced lung tissue injury by regulating the TGF-β/Smad signalling pathway, reducing the level of inflammation, and decreasing fibroblast differentiation as well as collagen fiber production and deposition. Although the experiments demonstrated that QJD antagonizes the effects of the TGF-β pathway agonist SRI-011381 and modulates key proteins involved in this pathway, thereby suggesting that its action is associated with inhibition of the TGF-β/Smad signaling cascade, a limitation of this study is the lack of reverse validation using specific pathway inhibitors (such as SB431542) or gene knockdown approaches. In future work, we plan to conduct these experiments to provide more direct evidence supporting the causal relationship between QJD and the TGF-β/Smad signaling regulation.
All authors state that they have no conflicts of interest regarding the publication of this paper.
The authors acknowledge the2024 Autonomous Region Young Science and Technology Talent Support and Development Program [Ningxia Association for Science and Technology Document [2025] No. 2]; Yinchuan Municipal Science and Technology Bureau Youth Science and Technology Talent Development - Basic Research Guidance Program [2025RC20]; National Natural Science Foundation of China Joint Fund for Regional Innovation Development [U20A20404]; National Administration of Traditional Chinese Medicine's Project of High-level Construction of Key TCM Disciplines [zyyzdxk-2023209].
| Apricot kernel | Ningxia Mingde Chinese Herbal Pieces Co., Ltd | 2301003 | |
| Bleomycin (BLM) | Shanghai Yuanye Biotechnology Co., Ltd | 11056-06-7 | A glycopeptide antibiotic?used to induce IPF animal models |
| COL-1 | Affinity Biosciences | AF7001 | Primary antibody (RRID: AB_86351) |
| Fetal bovine serum | Beijing Rongxing Biotechnology Company Limited | 10099141C | Serum (RRID: AB_2354062) |
| FN1 | Affinity Biosciences | AF5335 | Primary antibody (RRID: AB_10616058) |
| Fried linseed (Hu Ma Ren) | Ningxia Mingde Chinese Herbal Pieces Co., Ltd | 2401260 | |
| GAPDH | Affinity Biosciences | AF7021 | Primary antibody (RRID: AB_2721282) |
| Ginseng | Ningxia Mingde Chinese Herbal Pieces Co., Ltd | 2405123 | |
| Goat anti-Rabbit | Affinity Biosciences | S0001 | secondary antibody (RRID: AB_10774538) |
| Gypsum | Ningxia Mingde Chinese Herbal Pieces Co., Ltd | 2405236 | |
| Hematoxylin-eosin staining (HE) | Wuhan Servicebio Biotechnology Co | G1076 | Test kit |
| Human embryonic lung fibroblasts (HFL-1) | Wuhan Pricella Biotechnology | CL-0106 | Cell |
| Licorice | Ningxia Mingde Chinese Herbal Pieces Co., Ltd | 2312322 | |
| Loquat leaf | Ningxia Mingde Chinese Herbal Pieces Co., Ltd | 2405027 | |
| Masson staining kit | Wuhan Servicebio Biotechnology Co | G1006 | Test kit |
| Mulberry leaf | Ningxia Mingde Chinese Herbal Pieces Co., Ltd | 2406235 | |
| Ophiopogon japonicus | Ningxia Mingde Chinese Herbal Pieces Co., Ltd | 2403378 | |
| Pirfenidone (PFD) | Beijing Contini Pharmaceutical Co., Ltd | H20133376 | A new pyridone compound with broad-spectrum anti fibrotic effects |
| p-Smad2/3 | Affinity Biosciences | AF3367 | Primary antibody |
| Real Colla Corii Asini (Ejiao) | Ningxia Mingde Chinese Herbal Pieces Co., Ltd | 20240103 | |
| Recombinant human TGF-β1 | Peprotech | 100-21 | A growth factor that induces fibroblast growth in rodents (RRID: AB_2910510) |
| Smad2/3 | Affinity Biosciences | AF6367 | Primary antibody (RRID: AB_398162) |
| Sodium pentobarbital | Merck | 11715 | Anesthetic |
| SRI-011381 | MedChemExpress | HY-100347 | An activator of the TGF-β signalling pathway |
| TGF-β1 | Affinity Biosciences | AF1027 | Primary antibody (RRID: AB_2737614) |
| total RNA extraction kit | Wuhan Servicebio Biotechnology Co | G3607 | Test kit |
| whole protein extraction kit | Wuhan Servicebio Biotechnology Co | G2002 | Test kit |
| α-SMA | Affinity Biosciences | AF1032 | Primary antibody (RRID: AB_2847835) |