Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
JoVE Science Education
Environmental Microbiology

A subscription to JoVE is required to view this content.
You will only be able to see the first 20 seconds.

Quantificazione di microrganismi e virus ambientali utilizzando qPCR
 
Click here for the English version

Quantificazione di microrganismi e virus ambientali utilizzando qPCR

Overview

Fonte: Laboratori del Dr. Ian Pepper e del Dr. Charles Gerba - Università dell'Arizona
Autore dimostrativo: Bradley Schmitz

La reazione a catena quantitativa della polimerasi (qPCR), nota anche come REAL-TIME PCR, è una tecnica molecolare ampiamente utilizzata per enumerare i microrganismi nell'ambiente. Prima di questo approccio, la quantificazione dei microrganismi era limitata in gran parte alle tecniche classiche basate sulla coltura. Tuttavia, la coltura di microbi da campioni ambientali può essere particolarmente impegnativa e si è generalmente ritenuto che solo dall'1 al 10% dei microrganismi presenti all'interno dei campioni ambientali siano rilevabili utilizzando queste tecniche. L'avvento della qPCR nella ricerca sulla microbiologia ambientale ha quindi fatto avanzare notevolmente il campo consentendo una determinazione più accurata delle concentrazioni di microrganismi come gli agenti patogeni che causano malattie nei campioni ambientali. Tuttavia, un importante limite della qPCR come tecnica microbiologica applicata è che le popolazioni viventi e vitali non possono essere differenziate dalle popolazioni inattive o non viventi.

Questo video dimostra l'uso di qPCR per rilevare il virus della chiazzare lieve del pepe da un campione di acqua ambientale.

Principles

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I principi di base alla base della qPCR sono gli stessi della normale PCR: cicli ripetuti di ricottura del primer al modello, allungamento del prodotto PCR e denaturazione del prodotto dal modello, portando all'amplificazione esponenziale di una sequenza target di interesse, nota come "amplicon", da un pool di materiale di partenza. L'innovazione della qPCR sta nell'aggiunta di sostanze chimiche fluorescenti nella reazione, che consente di visualizzare direttamente la sintesi del prodotto PCR ad ogni ciclo in "tempo reale" da termociclatori specializzati, rendendo possibile quantificare la quantità di sequenza del modello nel campione originale. La quantità viene solitamente misurata in termini di ciclo di soglia (Ct, noto anche come ciclo di quantificazione o Cq), che è il ciclo PCR in cui la quantità di prodotti fluorescenti supera il livello di fondo.

La quantificazione può essere relativa, dove il valore Ct di una sequenza viene confrontato con quello di un'altra sequenza standard o di controllo. In alternativa, se una serie di DNA di quantità nota viene eseguita insieme ai campioni nella reazione, è possibile produrre una "curva standard" che confronta il valore di fluorescenza con la quantità di DNA e consente di quantificare assolutamente il DNA del campione.

In un metodo qPCR, un breve tratto di DNA, noto come sonda, è progettato contro una specifica sequenza target di interesse. La sonda è chimicamente attaccata a un colorante fluorescente e a una molecola "quencher" che sopprime il segnale di fluorescenza dal colorante quando si trova nelle immediate vicinanze. L'enzima polimerasi, che sintetizza il prodotto del DNA, ha un'attività di degradazione del DNA che causerebbe il rilascio della molecola fluorescente dalla sonda, separando così il colorante dal quencher e consentendo di rilevare il segnale di fluorescenza. I livelli di fluoroforo sono misurati quantitativamente dopo ogni ciclo PCR, con una maggiore potenza del segnale correlata a livelli più elevati di sequenze target amplificate (denominate "ampliconi") presenti all'interno del campione ambientale.

Subscription Required. Please recommend JoVE to your librarian.

Procedure

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Raccolta dei campioni

  1. Raccogli il terreno usando una coclea o una pala a una determinata profondità. Se si raccoglie il terreno dalla rizosfera, raccogliere il terreno solo entro 7 mm intorno alla radice della pianta, colpendo il terreno in eccesso dalla radice e raschiando il terreno desiderato in un barile di raccolta.
  2. Mettere un flacone sterile di Nalgene nel bastoncino da immersione. Tenere l'estremità del bastone e raccogliere l'acqua immergendo la bottiglia. Metti la bottiglia in un dispositivo di raffreddamento con ghiaccio.
  3. Trasferire i campioni al laboratorio.

2. Estrazione degli acidi nucleici

  1. Per isolare i microrganismi dai campioni raccolti e per estrarre DNA e/ o RNA da essi, si prega di vedere il video Di JoVE Science Education sull'estrazione di acidi nucleici della comunità.

3. Trascrizione inversa

  1. Se il materiale genetico da dosare è l'RNA, deve essere utilizzato per generare DNA complementare (cDNA) tramite trascrizione inversa prima di procedere alla PCR. Per i dettagli, fare riferimento al video Di JoVE Science Education su RT-PCR.

4. Impostazione di qPCR

  1. Recuperare i reagenti conservati a -20 °C e scongelarli sul ghiaccio o a temperatura ambiente all'interno di una cappa pulita. I reagenti utilizzati in questo esempio includono la miscela di reazione qPCR (dipendente dalla macchina qPCR utilizzata; contiene DNA polimerasi), primer avanti e indietro e la sonda TaqMan. Le sequenze di primer e sonda sono progettate con sequenze specifiche per l'organismo che viene enumerato. Fare riferimento alla letteratura corrente per trovare sequenze di interesse. In questo esempio, verrà utilizzato il sistema di reagenti Roche Light Cycler 480 Probes Mix. Il virus della mottle lieve del pepe sarà enumerato nel campione di acqua. 1,2 Vedere la Tabella 1 per le sequenze di primer e sonda.
  2. Scongelamento estratto (c)DNA da campioni e il DNA di controllo positivo (che consiste in sequenze specifiche dell'organismo clonate in plasmidi batterici) a temperatura ambiente.
  3. Preparare un modello di tabella a 96 celle simile alla piastra qPCR a 96 pozzetti. Etichettare ogni cella con la reazione che verrà caricata sulla piastra. Includere reazioni per ogni campione e standard in triplice copia, nonché per il controllo positivo e il controllo negativo, come una reazione senza DNA.
  4. Calcolare i volumi di reagenti necessari per una reazione "master mix", che include tutti i reagenti che sono costanti tra le reazioni, in base alle istruzioni del produttore e alla letteratura. Preparare un mix master sufficiente per le reazioni triplicate per tutti i campioni più i controlli e un ulteriore 10% per tenere conto dell'errore di pipettaggio. Per una ricetta di master mix di esempio, fare riferimento alla Tabella 2.
  5. Lavorando all'interno di una cappa pulita, una volta che tutti i reagenti sono completamente scongelati, aggiungere la quantità calcolata di ciascun reagente in un tubo di microfuga a bassa legatura da 1,5 ml per creare una miscela principale. Vortice e minicentrifugare brevemente ogni reagente prima di aggiungere. Cambiare la punta della pipetta tra ciascun reagente per evitare la contaminazione e garantire concentrazioni corrette. Dopo che tutti i reagenti sono stati aggiunti, vortice e minicentrifuga tubo con la miscela master per garantire l'omogeneità.
  6. Aliquotare il volume appropriato della miscela master in ciascun pozzo designato nella piastra PCR a 96 pozzi.
  7. Aggiungere il volume appropriato di (c) campione di DNA, plasmide di controllo positivo e controllo negativo (acqua di grado molecolare) in pozzi designati.
  8. Una volta aggiunti tutti i campioni e i controlli, sigillare la piastra con la pellicola sigillante. Utilizzare uno strumento di tenuta per spingere l'aria fuori da sotto la lamina e prevenire le bolle. Strappare con cura i bordi della lamina.
  9. Centrifugare la piastra sigillata a 96 pozzetti in una centrifuga con un portapiatti per raccogliere la miscela sul fondo di ciascun pozzettino. Assicurarsi di utilizzare una piastra di contrappeso per garantire che la centrifuga sia adeguatamente bilanciata durante la rotazione. Centrifuga a impulsi fino a 1000 giri/min, quindi lascia che la centrifuga si fermi lentamente senza freni.

5. Funzionamento qPCR

  1. Posizionare la piastra sigillata a 96 pozzi nella macchina qPCR. Assicurarsi che la macchina indichi che è pronta per l'avvio.
  2. Seguire le istruzioni della macchina qPCR per inserire correttamente tutte le informazioni necessarie al software, quindi impostare la macchina qPCR per l'esecuzione.
  3. Dopo che la macchina ha completato l'esecuzione, il software sarà in grado di utilizzare le concentrazioni note del controllo positivo per calcolare la quantità di cDNA in ogni reazione. La quantità di virus nel campione originale può quindi essere calcolata, in base ai processi di diluizione, filtrazione, concentrazione, amplificazione e / o estrazione eseguiti per ottenere il campione di DNA.
Reagente Sequenza (5' → 3') Volume (μL / bene) Finale Conc.
Primer in avanti GAGTGGTTTGACCTTAACGTTTGA 2.25 900 nM
Primer inverso TTGTCGGTTGCAATGCAAGT 2.25 900 nM
Sonda FAM-CCTACCGAAGCAAATG-BHQ1 1.0 200 nM

Tabella 1. Sequenze di primer e sonda per il rilevamento del virus del pepe lieve.

Reagente Volume (μL / bene) Numero di pozzi Volume master mix (μL)
LC 480 Mix 12.5 26 325
Molecolare H2O 4.5 117
Primer in avanti 2.25 58.5
Primer inverso 2.25 58.5
Sonda 1.0 26
Totale 22.5 585

Tabella 2. Volumi di reagenti per reazioni individuali e master mix.

L'avvento della reazione a catena quantitativa della polimerasi, o qPCR, ha permesso di determinare quantitativamente la quantità di qualsiasi microrganismo in un campione ambientale.

Come la PCR standard, la qPCR identifica i microrganismi rilevando la presenza o l'assenza di sequenze di DNA specifiche per gli organismi di interesse. Ciò consente il rilevamento di microbi che non possono essere coltivati in laboratorio, rendendo possibile il dosaggio di una gamma molto più ampia di organismi ambientali. Inoltre, la qPCR consente di valutare quantitativamente la quantità di DNA. Ma allo stesso tempo, le metodologie PCR rilevano il DNA da tutti gli organismi vivi o morti, limitando la capacità di cercare solo microbi in crescita attiva nel campione.

Questo video esaminerà le innovazioni chimiche che distinguono la qPCR dalla PCR regolare, spiegherà come la qPCR può essere utilizzata per misurare quantitativamente il DNA, dimostrerà un protocollo per l'utilizzo della qPCR per rilevare un virus a RNA da campioni di suolo e, infine, mostrerà come la qPCR viene applicata alla microbiologia ambientale oggi.

I principi di base alla base della qPCR sono gli stessi della normale PCR: cicli ripetuti di ricottura del primer al modello, allungamento del prodotto PCR e denaturazione del prodotto dal modello, portando all'amplificazione esponenziale di una sequenza target di interesse, nota come amplicon, da un pool di materiale di partenza.

L'innovazione della qPCR sta nell'aggiunta di sostanze chimiche fluorescenti nella reazione, che consente di visualizzare direttamente la sintesi del prodotto PCR ad ogni ciclo in "tempo reale" da termociclatori specializzati, rendendo possibile quantificare la quantità di sequenza del modello nel campione originale. La quantità viene solitamente misurata in termini di ciclo di soglia, abbreviato Ct, noto anche come ciclo di quantificazione o Cq, che è il ciclo PCR in cui la quantità di prodotti fluorescenti supera il livello di fondo.

La quantificazione può essere relativa, dove il valore Ct di una sequenza viene confrontato con quello di un'altra sequenza standard o di controllo; la quantità relativa è pari a due elevata alla potenza della differenza in Ct. In alternativa, se una serie di DNA di quantità nota viene eseguita insieme ai campioni nella reazione, è possibile produrre una curva standard che confronta il valore di fluorescenza con la quantità di DNA e consente di quantificare assolutamente il DNA del campione.

Esistono due grandi tipi di molecole fluorescenti utilizzate nella qPCR. In un caso, i coloranti fluorescenti che si legano specificamente al DNA a doppio filamento sono inclusi nella reazione. Il colorante fluoresce solo quando legato al DNA, consentendo così di quantificare la quantità di prodotto a doppio filamento di DNA.

Nell'altro metodo, un breve tratto di DNA, noto come sonda, è progettato contro una specifica sequenza target di interesse. La sonda è chimicamente attaccata a un colorante fluorescente e a una molecola "quencher" che sopprime il segnale di fluorescenza dal colorante quando si trova nelle immediate vicinanze. L'enzima polimerasi, che sintetizza il prodotto del DNA, ha un'attività di degradazione del DNA che causerebbe il "rilascio" della molecola fluorescente dalla sonda, separando così il colorante dal quencher e consentendo di rilevare il segnale di fluorescenza.

Ora che hai capito i principi alla base della qPCR, diamo un'occhiata a un protocollo per l'utilizzo di questa tecnica per identificare un virus a RNA che infetta le piante, il virus della chiazzare lieve del pepe, da campioni di suolo.

In questa dimostrazione, il campione sarà raccolto dalla rizosfera, la zona di terreno di circa 7 mm intorno alle radici delle piante che è influenzata dalle radici e dai loro microrganismi simbiotici.

Per raccogliere il terreno della rizosfera, prima estrai con cura la pianta di interesse dal terreno e colpiscila per rimuovere il più possibile il terreno sfuso in eccesso. Imballare l'impianto per un'ulteriore lavorazione in laboratorio.

Dopo aver riportato i campioni in laboratorio, utilizzare una spatola sterile per rottamare il terreno desiderato in un recipiente di raccolta. Quindi, raccogliere il virus dal terreno ed estrarre l'RNA.

Una volta che l'RNA viene raccolto dal campione, convertirlo in complementare o cDNA tramite trascrizione inversa. Si prega di fare riferimento al video JoVE SciEd sulla trascrizione inversa-PCR per i dettagli di questa procedura.

Quando sei pronto per eseguire la qPCR, scongelare i reagenti congelati a temperatura ambiente all'interno di una cappa a flusso laminare dedicata e metterli sul ghiaccio una volta scongelati. I componenti del reagente contenenti l'enzima DNA polimerasi devono essere sempre tenuti sul ghiaccio.

Scongelare il cDNA campione e un DNA di controllo positivo, come un pezzo circolare di DNA noto come plasmide che ha l'amplicon di interesse clonato in esso.

Prima di assemblare le reazioni in una piastra qPCR a 96 pozzetti, preparare un modello di tabella a 96 celle su carta ed etichettare ogni cella con la reazione che verrà caricata nella piastra. Includere reazioni per ogni campione e standard in triplice copia, nonché per il controllo positivo e il controllo negativo, come una reazione senza DNA.

Calcolare i volumi di reagenti necessari per una reazione "master mix", che include tutti i reagenti che sono costanti tra le reazioni. Preparare un mix master sufficiente per le reazioni triplicate per tutti i campioni più i controlli e un ulteriore 10% per tenere conto dell'errore di pipettaggio.

Una volta scongelati i reagenti, assemblare la miscela principale in un tubo microfugo a basso adsorbimento da 1,5 mL. Per fare ciò, vortice brevemente ogni reagente per mescolare accuratamente, raccogliere qualsiasi liquido sul lato dei tubi usando una mini-centrifuga e pipettare il reagente nel tubo del microfugo. Assicurarsi di utilizzare nuove punte per pipette per ogni componente di reazione. Dopo che tutti i reagenti sono stati aggiunti, vortice per mescolare e centrifugare. Quindi, aliquotare la quantità appropriata di miscela master nei pozzi designati sulla piastra PCR.

Successivamente, vortice e centrifuga ogni tubo con campione e DNA di controllo e pipetta la quantità appropriata nei rispettivi pozzi sulla piastra PCR. Una volta aggiunti i campioni, sigillare la piastra con un foglio sigillante e utilizzare lo strumento di tenuta per appiattire completamente la guarnizione ed estrarre eventuali bolle d'aria. Strappare con cura le linguette non adesive dalle estremità del sigillo.

Per raccogliere completamente la miscela di reazione sul fondo dei pozzetti, posizionare la piastra di reazione in una centrifuga con un supporto per piastre e bilanciare correttamente il rotore con una piastra di contrappeso. Centrifugare a impulsi la piastra fino a 1.000 giri /min, quindi lasciare che la centrifuga si fermi lentamente senza freni.

Posizionare la piastra di reazione nella macchina qPCR. Impostare il programma PCR in base alle specifiche del produttore, impostando la temperatura di fusione in base alla coppia di primer utilizzata. Impostare il programma di reazione per l'esecuzione.

Una volta completato il programma qPCR, il software sarà in grado di utilizzare le concentrazioni note del controllo positivo per calcolare la quantità di cDNA in ogni reazione. È quindi possibile calcolare la quantità di virus nel campione originale.

Una volta completato il programma qPCR, il software sarà in grado di utilizzare le concentrazioni note del controllo positivo per calcolare la quantità di cDNA in ogni reazione.

Con i risultati della qPCR, il volume trasferito nei pozzi, l'estrazione dal suolo e il fattore dalla trascrizione inversa, è possibile calcolare il numero di virus nel campione di terreno iniziale.

Ora che sai come viene eseguita la qPCR, diamo un'occhiata a come può essere utilizzata per analizzare diversi campioni ambientali.

qPCR può essere utilizzato per quantificare la quantità di virus recuperati da molti diversi tipi di campioni. In questa applicazione, due diversi tipi di adenovirus sono stati concentrati da campioni di acqua con una serie di metodi diversi. Il DNA è stato quindi estratto dai virus e sottoposto a qPCR, per valutare l'efficienza relativa dei metodi di concentrazione.

Un'altra applicazione per l'enumerazione microbica basata su qPCR è quantificare il contenuto batterico in campioni alimentari e agricoli - in questo esempio, campioni fecali e di rifiuti provenienti da allevamenti di polli. Piuttosto che prendere di mira singole specie, gli scienziati hanno eseguito la qPCR utilizzando primer contro un gene altamente conservato trovato in tutti i batteri e quantificato la comunità batterica totale trovata nei campioni.

Infine, come accennato in precedenza, uno svantaggio della metodologia qPCR tradizionale è che i microbi vivi e morti non possono essere distinti. Tuttavia, aggiungendo una sostanza chimica nota come monoazide di propidio, o PMA, che può entrare nelle cellule morte solo dove si lega al DNA per inibire le successive reazioni enzimatiche come la PCR, i ricercatori qui sono stati in grado di distinguere tra colture vive e morte di E. coli O157: H7, un ceppo patogeno comune trovato in alimenti e acqua contaminati.

Hai appena visto l'introduzione di JoVE alla quantificazione di microrganismi e virus ambientali utilizzando qPCR. Ora dovresti capire come funziona qPCR, come usare qPCR per misurare la quantità di un microbo in un campione ambientale e alcune applicazioni di questa tecnica. Grazie per l'attenzione!

Subscription Required. Please recommend JoVE to your librarian.

Applications and Summary

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La capacità di quantificare copie mirate del segmento genomico utilizzando la tecnica qPCR è importante in una serie di campi scientifici. Le applicazioni di esempio includono:

(1) Enumerare gli agenti patogeni in acqua, suolo, cibo, superfici, ecc.

La PCR in tempo reale viene utilizzata per enumerare gli agenti patogeni in vari ambienti. Durante le epidemie, i campioni di acqua e suolo possono essere analizzati per l'agente patogeno di interesse per trovare la fonte che causa la diffusione. La fonte può quindi essere ulteriormente analizzata per enumerare la concentrazione dell'agente patogeno e determinare la quantità di contaminazione. Ad esempio, durante un focolaio di norovirus su una nave da crociera che ha causato grave gastroenterite, vomito e diarrea tra i passeggeri, i campioni di acqua e cibo possono essere sottoposti a PCR in tempo reale per identificare la fonte del virus, ad esempiol'acqua che non è stata adeguatamente trattata e conteneva un'elevata contaminazione fecale.

(2) Misurare la riduzione dei microbi patogeni mediante il trattamento delle acque reflue

L'acqua di scarico grezza contiene un'abbondanza di microrganismi che causano malattie e quindi deve essere trattata al fine di proteggere la salute pubblica. I campioni d'acqua possono essere raccolti in diversi punti lungo un treno di trattamento delle acque reflue e analizzati utilizzando qPCR per determinare la riduzione dei livelli di microrganismi patogeni, inclusi i virus. Le riduzioni calcolate forniscono quindi preziose informazioni sull'efficacia dei processi di trattamento delle acque reflue e sulle potenziali applicazioni di riutilizzo dell'acqua.

(3) Misurazione dei marcatori genetici funzionali nell'ambiente

Le comunità microbiche sono soggette a cambiamenti nell'appartenenza e fluttuazioni nell'attività a causa di pressioni ambientali. Questi spostamenti possono essere monitorati tramite l'analisi di geni funzionali che potrebbero essere attivati da particolari fattori di stress ambientale. La PCR in tempo reale può essere utilizzata per quantificare l'espressione di questi geni nei campioni per monitorare i cambiamenti nell'attività della comunità microbica. Ad esempio, la qPCR consente agli ecologi microbici di quantificare l'espressione di geni attivati per le vie di biodegradazione in presenza di contaminanti prodotti dall'uomo presenti nei suoli.

Subscription Required. Please recommend JoVE to your librarian.

References

  1. Zhang, T., Breitbart, M., et al. RNA Viral Community in Human Feces: Prevalence of Plant Pathogenic Viruses. PLoS Biology. 4, e3 (2005).
  2. Haramoto, E., et al. Occurrence of Pepper Mild Mottle in Drinking Water Sources in Japan. Applied Environmental Microbiology. 79, 7413-7418 (2013).

Transcript

Please note that all translations are automatically generated.

Click here for the English version.

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter