Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
JoVE Science Education
Environmental Microbiology

A subscription to JoVE is required to view this content.
You will only be able to see the first 20 seconds.

qPCR을 사용하여 환경 미생물 및 바이러스 정량화
 
Click here for the English version

qPCR을 사용하여 환경 미생물 및 바이러스 정량화

Overview

출처: 이안 페퍼 박사와 찰스 게르바 박사의 연구소 - 애리조나 대학교
시연 저자: 브래들리 슈미츠

실시간 PCR이라고도 하는 정량적 폴리머라제 연쇄 반응(qPCR)은 환경에서 미생물을 포우밍하는 데 널리 사용되는 분자 기술이다. 이 접근법이전에는 미생물을 정량화하는 것이 주로 고전적인 배양 기반 기술로 제한되었다. 그러나, 환경 샘플에서 미생물의 배양은 특히 어려울 수 있으며, 일반적으로 환경 샘플 내에 존재하는 미생물의 1~10%가 이러한 기술을 사용하여 검출할 수 있다는 것을 간직하고 있다. 환경 미생물학 연구에서 qPCR의 출현은 환경 샘플에서 질병을 유발하는 병원균과 같은 미생물의 농도를 보다 정확하게 측정할 수 있게 함으로써 분야를 크게 발전시켰습니다. 그러나, 적용된 미생물 기술로 qPCR의 중요한 한계는 생활, 실행 가능한 인구는 비활성 또는 비생활 인구에서 구별될 수 없다는 것입니다.

이 비디오는 환경 용수 샘플에서 고추 순한 변기 바이러스를 감지하기 위해 qPCR을 사용하는 것을 보여줍니다.

Principles

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

qPCR의 기본 원칙은 일반 PCR과 동일합니다 – 템플릿에 대한 프라이머 어닐링의 반복 된 주기, PCR 제품의 신장 및 템플릿에서 제품의 거부, 시작 재료의 풀에서 "앰플리콘"으로 알려진 목표 순서의 지수 증폭으로 이어지는. qPCR의 혁신은 반응에 형광 화학 물질을 첨가하여 각 사이클에서 PCR 제품의 합성을 특수 열순환기에서 "실시간"으로 직접 시각화할 수 있게 하여 원래 샘플에서 템플릿 서열의 양을 정량화할 수 있게 합니다. 수량은 일반적으로 형광 제품의 양이 배경 수준을 초과하는 PCR 주기인 임계값 주기(Ct,정량화 주기 또는 Cq라고도함)의 관점에서 측정됩니다.

정량화는 한 시퀀스의 Ct 값이 다른 표준 또는 제어 시퀀스와 비교되는 상대적일 수 있습니다. 대안적으로, 알려진 양의 일련의 DNA가 반응의 샘플과 함께 실행되는 경우, 형광 값을 DNA 양과 비교하는 "표준 곡선"이 생성될 수 있으며, 샘플 DNA를 절대적으로 양화할 수 있게 한다.

하나의 qPCR 방법에서, 프로브로 알려진 DNA의 짧은 스트레칭은 관심의 특정 대상 순서에 대해 설계되었습니다. 프로브는 화학적으로 형광 염료뿐만 아니라 가까운 곳에있을 때 염료에서 형광 신호를 억제하는 "quencher"분자에 화학적으로 부착됩니다. DNA 생성물을 합성하는 폴리머라제 효소는 형광 분자가 프로브에서 방출되는 DNA 분해 활성을 가지며, 따라서 염료를 대기부로부터 분리하고 형광 신호를 검출할 수 있게 한다. 플루오로포어 수준은 각 PCR 주기 후에 정량적으로 측정되며, 환경 샘플 내에 존재하는 증폭 대상 서열("amplicons"이라고 불임)의 상부와 관련된 신호 강도가 증가합니다.

Subscription Required. Please recommend JoVE to your librarian.

Procedure

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. 샘플 수집

  1. 오거 나 삽을 사용하여 토양을 결정된 깊이로 수집합니다. 뿌리 부류에서 토양을 수집하는 경우, 뿌리에서 초과 토양을 타격하고 수집 배럴에 원하는 토양을 긁어, 식물 뿌리 주위에 7mm 이내에 토양을 수집합니다.
  2. 멸균 된 날진 병을 디핑 스틱에 넣습니다. 스틱의 끝을 잡고 병을 잠그고 물을 수집합니다. 병을 얼음으로 시원한 곳에 넣습니다.
  3. 샘플을 실험실로 옮기.

2. 핵산 추출

  1. 수집된 샘플에서 미생물을 분리하고 DNA 및/또는 RNA를 추출하려면 지역 사회 핵산 추출에 대한 JoVE 과학 교육 비디오를 참조하십시오.

3. 역전사

  1. 분석되는 유전 물질이 RNA인 경우 PCR로 진행하기 전에 역전사를 통해 상호 보완적인 DNA(cDNA)를 생성하는 데 사용해야 합니다. 자세한 내용은 RT-PCR의 JoVE 과학 교육 비디오를 참조하십시오.

4. qPCR 설정

  1. -20°C에 저장된 시약을 검색하고 얼음이나 깨끗한 후드 내부의 실온에서 해동하십시오. 이 예에서 사용되는 시약은 qPCR 반응 혼합(사용된 qPCR 기계에 의존; DNA 폴리머라아제 포함), 전방 및 역프라이머 및 TaqMan 프로브를 포함한다. 프라이머 및 프로브 서열은 열거되는 유기체에 특정한 서열로 설계되었습니다. 관심 있는 순서를 찾으려면 현재 문헌을 참조하십시오. 이 예에서는 로슈 라이트 사이클러 480 프로브 믹스 시약 시스템이 사용됩니다. 후추 온화한 걸레 바이러스는 물 견본에 내각화될 것입니다. 1,2 프라이머 및 프로브 시퀀스에 대한 표 1을 참조하십시오.
  2. 실온에서 추출된 (c) DNA를 샘플과 양성 대조군 DNA(세균 플라스미드로 복제한 유기체 특이적 서열로 구성된).
  3. 96웰 qPCR 플레이트와 유사한 96셀 테이블 템플릿을 준비합니다. 각 셀에 플레이트에 로드되는 반응으로 레이블을 지정합니다. 삼중항제의 각 샘플 및 표준에 대한 반응뿐만 아니라 DNA 반응과 같은 양성 제어 및 부정적인 제어를 포함한다.
  4. 제조업체의 지침과 문헌에 따라 반응 중 일정한 시약을 모두 포함하는 반응 "마스터 믹스"에 필요한 시약 볼륨을 계산합니다. 모든 샘플과 컨트롤에 대한 트리플리케이트 반응에 충분한 마스터 믹스를 준비하고, 파이펫팅 오류를 고려하여 추가 10%를 준비합니다. 샘플 마스터 믹스 레시피의 경우 표 2를참조하십시오.
  5. 모든 시약이 완전히 해동되면 깨끗한 후드 내부에서 작업하면 계산된 양의 계산된 양을 1.5mL 저결합 미세 분리 튜브에 추가하여 마스터 믹스를 만듭니다. 소용돌이와 짧게 작은 심근을 추가하기 전에 각 시약을 최소화합니다. 오염을 방지하고 정확한 농도를 보장하기 위해 각 시약 사이에 파이펫 팁을 변경합니다. 모든 시약이 추가 된 후, 소용돌이와 동질성을 보장하기 위해 마스터 믹스와 미니 원심 분리튜브.
  6. Aliquot 는 96웰 PCR 플레이트에서 지정된 각 에 마스터 믹스의 적절한 볼륨을 잘 지정합니다.
  7. 지정된 우물에 (c) DNA 샘플, 양성 제어 플라스미드 및 음수 조절(분자 등급 물)의 적절한 부피를 추가합니다.
  8. 모든 샘플과 컨트롤이 추가되면 밀봉 호일로 플레이트를 밀봉하십시오. 밀봉 도구를 사용하여 호일 아래에서 공기를 밀어 내고 거품을 방지하십시오. 호일의 가장자리를 조심스럽게 찢습니다.
  9. 원심 분리기 는 원심분리기에서 밀봉된 96웰 플레이트를 플레이트 홀더로 하여 각 우물의 바닥에 혼합물을 수집합니다. 카운터웨이트 플레이트를 사용하여 원심분리기가 회전하는 동안 제대로 균형을 이루도록 해야 합니다. 최대 1000rpm의 펄스 원심분리기를 한 다음 원심분리기를 브레이크 없이 천천히 멈춥시게 합니다.

5. qPCR 작동

  1. 밀봉 된 96 웰 플레이트를 qPCR 기계에 넣습니다. 컴퓨터가 시작할 준비가 되었는지 확인합니다.
  2. qPCR 기계 지침을 따라 소프트웨어에서 필요한 모든 정보를 올바르게 입력한 다음 qPCR 컴퓨터를 실행하도록 설정합니다.
  3. 기계가 실행을 완료한 후, 소프트웨어는 양수 제어의 알려진 농도를 사용하여 각 반응에서 cDNA의 양을 계산할 수 있습니다. 원래 샘플에서 바이러스의 양은 DNA 샘플을 얻기 위해 수행 희석, 여과, 농도, 증폭 및/또는 추출 공정에 기초하여 계산될 수 있다.
시약 시퀀스 (5' → 3') 부피(μL/웰) 최종 Conc.
포워드 프라이머 GAGTGGTTGACCTTAACGTTTGA 2.25 900 nM
역프라이머 TTGTCGGTTGCAATGCAAAAAGT 2.25 900 nM
탐침 FAM-CCTACCGAAGCAAATG-BHQ1 1.0 200 nM

표 1. 고추 온화한 걸레 바이러스를 검출하기위한 샘플 프라이머 및 프로브 시퀀스.

시약 부피(μL/웰) 우물 수 마스터 믹스 볼륨 (μL)
LC 480 믹스 12.5 26 325
분자 H2O 4.5 117
포워드 프라이머 2.25 58.5
역프라이머 2.25 58.5
탐침 1.0 26
합계 22.5 585

표 2. 개별 반응 및 마스터 믹스에 대한 시약 볼륨.

정량적 중합체 연쇄 반응 또는 qPCR의 출현으로 환경 샘플에서 임의의 미생물의 양을 정량적으로 결정할 수 있게 되었습니다.

표준 PCR과 마찬가지로 qPCR은 관심 있는 유기체에 특정한 DNA 서열의 존재 또는 부재를 감지하여 미생물을 식별합니다. 이것은 실험실에서 배양 될 수없는 미생물의 검출을 허용하여 훨씬 더 넓은 범위의 환경 유기체를 분석 할 수 있게합니다. 또한 qPCR은 DNA의 양을 정량적으로 평가할 수 있게 합니다. 그러나 동시에, PCR 방법론은 모든 유기체에서 DNA를 검출하고, 시료에서 적극적으로 성장하는 미생물을 찾는 능력을 제한합니다.

이 비디오는 qPCR을 일반 PCR과 구별하는 화학 혁신을 검토하고, qPCR이 DNA를 정량적으로 측정하는 데 어떻게 사용될 수 있는지 설명하고, qPCR을 사용하여 토양 샘플에서 RNA 바이러스를 검출하는 프로토콜을 시연하고, 마지막으로 qPCR이 오늘날 환경 미생물학에 어떻게 적용되는지 보여줍니다.

qPCR의 기본 원칙은 일반 PCR과 동일합니다 - 템플릿에 대한 프라이머 어닐링의 반복 된 주기, PCR 제품의 신장 및 템플릿에서 제품의 거부, 시작 재료의 풀에서 앰플콘으로 알려진 목표 시퀀스의 기하 급수증폭으로 이어지는.

qPCR의 혁신은 반응에 형광 화학 물질을 첨가하여 각 사이클에서 PCR 제품의 합성을 특수 열순환기에서 "실시간"으로 직접 시각화할 수 있게 하여 원래 샘플에서 템플릿 서열의 양을 정량화할 수 있게 합니다. 수량은 일반적으로 형광 제품의 양이 배경 수준을 초과하는 PCR 주기인 정량화 주기 또는 Cq라고도하는 임계값 주기, 축약 된 Ct의관점에서 측정됩니다.

정량화는 한 서열의 Ct 값이 다른 표준 또는 제어 시퀀스와 비교되는 상대적일 수 있습니다. 상대수량은Ct의차이의 힘에 대해 2와 같습니다. 대안적으로, 알려진 양의 일련의 DNA가 반응의 샘플과 함께 실행되는 경우, 형광 값을 DNA 양과 비교하는 표준 곡선이 생성될 수 있으며, 샘플 DNA가 절대적으로 양화될 수 있게 한다.

qPCR에 사용되는 형광 분자의 두 가지 광범위한 유형이 있습니다. 한 경우, 이중 좌초 된 DNA에 특별히 결합형 형광 염료가 반응에 포함됩니다. 염료는 DNA에 바인딩될 때만 형광을 하므로 이중 좌초 된 DNA 제품의 양이 양화 될 수 있습니다.

다른 방법에서, 프로브로 알려진 DNA의 짧은 스트레칭은 관심의 특정 표적 순서에 대해 설계되었습니다. 프로브는 화학적으로 형광 염료뿐만 아니라 가까운 곳에있을 때 염료에서 형광 신호를 억제하는 "quencher"분자에 화학적으로 부착됩니다. DNA 생성물을 합성하는 폴리머라제 효소는 형광 분자가 프로브로부터 "방출"되는 DNA 분해 활성을 가지므로, 따라서 담수에서 염료를 분리하고 형광 신호를 검출할 수 있게 한다.

이제 qPCR의 원리를 이해하게 되었으므로 이 기술을 사용하여 토양 샘플에서 식물, 후추 순한 난기 바이러스를 감염시키는 RNA 바이러스를 식별하는 프로토콜을 살펴보겠습니다.

이 데모에서, 견본은 뿌리와 그들의 공생 미생물에 의해 영향을 받는 식물 뿌리 의 주위에 대략 7 mm 토양의 지역, 뿌리에서 집합될 것입니다.

뿌리 줄기권 토양을 수집하려면 먼저 관심있는 식물을 조심스럽게 추출하여 가능한 한 많은 과도한 벌크 토양을 제거하십시오. 실험실에서 추가 처리를 위해 공장을 포장합니다.

샘플을 실험실로 다시 가져온 후 멸균 주걱을 사용하여 원하는 토양을 수집 용기로 폐기하십시오. 이어서, 토양으로부터 바이러스를 수집하고 RNA를 추출한다.

RNA가 샘플에서 수집되면 역전사를 통해 상호 보완적 또는 cDNA로 변환합니다. 이 절차에 대한 자세한 내용은 역 전사-PCR에서 JoVE SciEd 비디오를 참조하십시오.

qPCR을 수행할 준비가 되면 전용 라미나르 유동 후드 내부의 실온에서 냉동 시약을 해동하고 해동한 후 얼음 위에 놓습니다. DNA 폴리머라제 효소를 함유한 시약 성분은 항상 얼음 위에 보관되어야 합니다.

샘플 cDNA 및 양극 대조DNA를 해동하여, 그 중에도 관심의 증폭을 가지고 있는 플라스미드로 알려진 DNA의 원형 조각과 같은 양극대조군 DNA를 해동한다.

96웰 qPCR 플레이트에서 반응을 조립하기 전에 종이에 96셀 테이블 템플릿을 준비하고 각 셀에 플레이트에 로드되는 반응으로 레이블을 지정합니다. 삼중항제의 각 샘플 및 표준에 대한 반응뿐만 아니라 DNA 반응과 같은 양성 제어 및 부정적인 제어를 포함한다.

반응 중 일정한 모든 시약을 포함하는 반응 "마스터 믹스"에 필요한 시약 볼륨을 계산합니다. 모든 샘플과 컨트롤에 대한 트리플리케이트 반응에 충분한 마스터 믹스를 준비하고, 파이펫팅 오류를 고려하여 추가 10%를 준비합니다.

시약이 해동되면 1.5mL 저흡착 마이크로퓨지 튜브에 마스터 믹스를 조립합니다. 이렇게하려면 각 시약이 철저히 섞이고 미니 원심분리기를 사용하여 튜브 측면의 액체를 수집하고 시약을 미세 분리 튜브로 피펫합니다. 각 반응 구성 요소에 대해 새 파이펫 팁을 사용해야 합니다. 모든 시약이 추가 된 후, 혼합 소용돌이와 원심 분리기. 그런 다음, PCR 플레이트의 지정된 우물에 적절한 양의 마스터 믹스를 알리쿼트한다.

다음으로, 샘플 및 제어 DNA를 가진 각 튜브와 소용돌이 및 원심분리기, PCR 플레이트의 각 우물내로 적절한 양을 피펫한다. 샘플이 추가되면 밀봉 호일로 플레이트를 밀봉하고 밀봉 도구를 사용하여 씰을 완전히 평평하게 하고 기포를 밀어내도록 하십시오. 물개 끝에서 접착제가 없는 탭을 조심스럽게 떼어낸다.

반응 혼합물을 우물 바닥에 완전히 수집하려면 반응 플레이트를 플레이트 홀더와 원심분리기에 넣고 로터와 카운터웨이트 플레이트의 균형을 적절히 조정합니다. 펄스 원심분리기는 최대 1,000rpm의 플레이트를 원심분리한 다음 원심분리기가 브레이크 없이 서서히 정지하도록 합니다.

반응 플레이트를 qPCR 기계에 넣습니다. 제조 업체의 사양에 따라 PCR 프로그램을 설정 하 고 사용 되는 프라이머 쌍에 따라 용융 온도를 설정 합니다. 실행하려면 반응 프로그램을 설정합니다.

qPCR 프로그램이 완료되면, 소프트웨어는 각 반응에서 cDNA의 양을 계산하기 위해 양적 제어의 알려진 농도를 사용할 수 있습니다. 그런 다음 원래 샘플에서 바이러스의 양을 계산할 수 있습니다.

qPCR 프로그램이 완료되면, 소프트웨어는 각 반응에서 cDNA의 양을 계산하기 위해 양적 제어의 알려진 농도를 사용할 수 있습니다.

qPCR의 결과, 우물으로 전송된 부피, 토양에서 추출, 역전사로부터의 계수, 초기 토양 샘플의 바이러스 수를 계산할 수 있다.

qPCR의 수행 방식을 알아두면 다양한 환경 샘플을 분석하는 데 어떻게 사용할 수 있는지 살펴보겠습니다.

qPCR은 다양한 유형의 샘플에서 회수된 바이러스의 양을 정량화하는 데 사용할 수 있습니다. 이 응용 프로그램에서, 아데노바이러스의 두 가지 다른 종류는 여러 가지 다른 방법에 의해 물 샘플에서 집중되었다. DNA는 바이러스로부터 추출된 다음 qPCR을 실시하여 농도 방법의 상대적 효율을 평가하였다.

qPCR 기반 미생물 열거형의 또 다른 응용 분야는 식품 및 농업 샘플에서 세균 함량을 정량화하는 것입니다 -이 예에서, 닭 농장에서 배설물 및 쓰레기 샘플. 과학자들은 개별 종을 표적으로 삼기보다는 모든 박테리아에서 발견되는 매우 보존된 유전자에 대한 프라이머를 사용하여 qPCR을 수행하고 샘플에서 발견되는 총 세균 커뮤니티를 정량화했습니다.

마지막으로, 앞에서 언급했듯이, 전통적인 qPCR 방법론의 한 가지 단점은 살아있는 미생물과 죽은 미생물을 구별할 수 없다는 것입니다. 그러나, 프로피듐 monoazide로 알려진 화학 물질을 추가 하 여, 또는 PMA, PCR 와 같은 후속 효소 반응을 억제 하는 DNA에 바인딩 죽은 세포를 입력할 수 있는, 여기 연구원은 E. coli O157:H7의 살아있는 및 죽은 문화를 구별할 수 있었다, 오염 된 음식과 물에서 발견 하는 일반적인 병원성 긴장.

QPCR을 사용하여 환경 미생물 및 바이러스를 정량화하는 JoVE의 소개를 방금 시청했습니다. 이제 qPCR의 작동 방식, qPCR을 사용하여 환경 샘플의 미생물 양을 측정하는 방법 및 이 기술의 일부 응용 을 이해해야 합니다. 시청해 주셔서 감사합니다!

Subscription Required. Please recommend JoVE to your librarian.

Applications and Summary

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

qPCR 기술을 사용하여 표적 게놈 세그먼트 사본을 정량화하는 능력은 여러 과학 분야에서 중요합니다. 예제 응용 프로그램은 다음과 같습니다.

(1) 물, 토양, 음식, 표면 등에서병원균을 포추화한다.

실시간 PCR은 다양한 환경에서 병원균을 열거하는 데 활용됩니다. 발병 시, 물과 토양 샘플은 관심있는 병원균을 분석하여 확산을 유발하는 소스를 찾을 수 있습니다. 그 때 근원은 병원체의 농도를 열거하고 오염의 양을 결정하기 위하여 추가 분석될 수 있습니다. 예를 들어, 승객 중, 물 및 식품 샘플에 심각한 위장염, 구토 및 설사를 일으킨 유람선에서 노로바이러스가 발병하는 동안 바이러스의 원인을 확인하기 위해 실시간 PCR을 받을 수 있습니다( 예:제대로 처리되지 않은 물 및 높은 배설물 오염이 포함되었다.

(2) 폐수 처리에 의한 병원성 미생물의 감소 측정

원시 하수물은 질병을 유발하는 미생물의 풍부를 포함하고 있으므로 공중 보건을 보호하기 위해 처리해야합니다. 물 샘플은 폐수 처리 열차를 따라 다른 지점에서 수집할 수 있으며, qPCR을 사용하여 분석하여 바이러스를 포함한 병원성 미생물의 수율 감소를 결정할 수 있다. 계산된 감소는 폐수 처리 공정의 효과와 잠재적인 물 재사용 응용 에 대한 귀중한 정보를 제공합니다.

(3) 환경에서 기능성 유전자 마커 측정

미생물 공동체는 환경 압력으로 인해 회원 자격 의 변화와 활동의 변동의 영향을받습니다. 이러한 변화는 특정 환경 스트레스에 의해 활성화 될 수 있는 기능성 유전자의 분석을 통해 모니터링될 수 있습니다. 실시간 PCR은 미생물 커뮤니티 활동의 변화를 모니터링하기 위해 샘플에서 이러한 유전자의 발현을 정량화하는 데 사용할 수 있습니다. 예를 들어, qPCR은 미생물 생태학자들이 토양에 존재하는 인공 오염물질이 존재하여 생분해 경로를 위해 활성화된 유전자의 발현을 정량화할 수 있게 한다.

Subscription Required. Please recommend JoVE to your librarian.

References

  1. Zhang, T., Breitbart, M., et al. RNA Viral Community in Human Feces: Prevalence of Plant Pathogenic Viruses. PLoS Biology. 4, e3 (2005).
  2. Haramoto, E., et al. Occurrence of Pepper Mild Mottle in Drinking Water Sources in Japan. Applied Environmental Microbiology. 79, 7413-7418 (2013).

Transcript

Please note that all translations are automatically generated.

Click here for the English version.

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter