Name: Mechanism of Kemeng Fangs Inhibition of Podocyte Apoptosis in Rats with Membranous Nephropathy through the PI3K/AKT Signaling Pathway (Video) | JoVE Journal
Uploaded: 2024-08-23T14:40:00.000+00:00
Duration: 7 min 15 s
Description: Discover how Kemeng Fang reduces podocyte apoptosis in membranous nephropathy rats through PI3K/AKT pathway activation. This study establishes an MN animal model using C-BSA immunization and Western blotting techniques.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

This work was supported by the Jilin Provincial Natural Science Foundation (No.YDZJ202301ZYTS145 and No. YDZJ202301ZYTS208).

Traditional Medicine and PI3K/AKT Pathway Activation in Membranous Nephropathy

All the authors have no conflicts of interest to declare.

This study aimed to observe the pharmacological effects of KMF and explore its specific mechanism of inhibiting apoptosis of MN rat podocytes. First, it demonstrated in vivo that KMF can alleviate podocyte apoptosis and delay MN progression by activating the PI3K/AKT signaling pathway. Second, transcriptomic results showed that KMF may exert its effects through the PPAR, PI3K/AKT, and p53 signaling pathways, ECM receptor interaction, etc. Among them, the PI3K/AKT signaling pathway has been validated in experiments. These findings may provide a scientific basis for the clinical use of KMF as a potential treatment option for patients with MN.
Research has shown that podocyte apoptosis is one of the key factors leading to the gradual progression of MN. Furthermore, MN limits the division and proliferation ability of podocytes; consequently, once damaged or lost, this sequela seriously affects renal function. When the number of podocytes decreases to the point where they cannot fully cover the GBM, the GBM is completely exposed and adheres to Bowman&#39;s capsule, causing compression or even collapse of the glomerular capillary loop, ultimately promoting MN to develop into ESRD33,34,35,36. Therefore, further research on the specific mechanism of podocyte apoptosis and methods to block or inhibit podocyte apoptosis is key to delaying the progression of MN. Research has shown that the PI3K/AKT signaling pathway has multiple functions in regulating cell apoptosis, oxidative stress, and inflammatory response and plays an important regulatory role in the occurrence and development of MN. WT-1 and Nephrin are pore membrane proteins expressed on podocytes, which not only play an important role in maintaining the normal structure and function of the pore membrane but also initiate PI3K/AKT-dependent signaling pathways and participate in podocyte signaling. The decrease in expression levels of these proteins often indicates damage to podocytes37,38,39.
PI3K is a dimer composed of a regulatory subunit, p85, and a catalytic subunit, p110, which can be activated by various growth factors and complexes. It is a key and initiating factor in this pathway40. The PIK3CA gene is located on chromosome 3 and has a total of 20 exons. Its main function is to encode one of the catalytic subunits of the PI3K enzyme, p110 &#945; Protein; hence, changes in PIK3CA can cause the PI3K enzyme to remain in a sustained activated state41. Once PI3K is activated, the second messenger, PIP3, will generate and continuously stimulate the downstream AKT signaling pathway, while p-AKT promotes the phosphorylation of the pro-apoptotic molecule, Bad, dissociating the pro-apoptotic complex of Bad with Bcl-2 and Bcl-xL, and forming a complex with the 14-3-3 protein in the cytoplasm, thereby losing its pro-apoptotic function. The anti-apoptotic molecules, BCL-2 and Bcl-xL, can be fully dissociated and exert an inhibitory effect on podocyte apoptosis42,43. Caspase-3 is a protease that plays a core role in the execution phase of cell apoptosis, ultimately leading to cell apoptosis by cleaving the DNA repair enzyme PARP into small fragments44. The induction of cytochrome c release from mitochondria to the cytoplasm by the pro-apoptotic protein Bad is a key step in activating caspase, and the complex of P-Bad binding to the 14-3-3 protein inhibits this process, thereby preventing the occurrence of the apoptotic cascade45,46,47.
Transcriptomic results indicate that KMF treatment for MN is closely related to the PI3K/AKT, PPAR, and p53 signaling pathways. Validated the PI3K/AKT signaling pathway through WB analysis. The experimental results showed that the PI3K/AKT signaling pathway in MN rats was significantly inhibited, while KMF could significantly activate the PI3K/AKT signaling pathway, reducing the generation of the pro-apoptotic molecules Bad and Bax and promoting the generation of the anti-apoptotic molecule BCL-2, thereby increasing the expression levels of podocyte hiatal membrane proteins, WT-1 and Nephrin, and reducing the incidence of podocyte apoptosis. Therefore, KMF reduces podocyte apoptosis by activating the PI3K/AKT signaling pathway and was found to have a protective effect on MN model rats.
However, this study has some limitations. First, this study only explored the mechanism of KMF inhibition of podocyte apoptosis at the level of in vivo animal experiments, which needs to be verified by in vitro cellular experiments as well as in-depth explorations of the mechanism; second, podocyte injury is also closely related to autophagy, immune-inflammation, and pyroptosis, and it needs to be further explored whether KMF can affect MN by regulating autophagy, immune-inflammation, and pyroptosis48,49.
The PPAR family (PPAR &#945;, PPAR &#946;/&#948;, PPAR &#947;) is a nuclear hormone receptor that relies on ligand activation and has important functions such as participating in energy metabolism, regulating cell apoptosis, and inflammatory response50,51. They affect gene transcription by forming heterodimerization with retinoic acid X receptor (RXR), where PPAR &#947; both regulate the inflammatory factor NF- &#954;B. The key to B activation lies in its function of protecting podocytes from damage52,53,54. Multiple studies have shown that PPAR &#947; agonists (TZD, such as pioglitazone) have renal protective effects independent of hypoglycemic effects, directly protecting podocytes from damage and reducing proteinuria and glomerular damage in various kidney disease animal models55,56,57,58,59. There are also reports indicating that PPAR can reduce podocyte apoptosis by inhibiting the activation of Caspase-360. The latest research indicates a new type of PPAR &#947;, the selective regulator GQ-16, is more effective than TZD in reducing proteinuria and nephrotic syndrome-related complications, which also brings dawn to the treatment of kidney disease61. KMF has a protective effect on the apoptosis of MN rat podocytes by activating the PI3K/AKT signaling pathway. Based on the important role of the PPAR signaling pathway in the kidneys, further in-depth exploration of the relationship between KMF, PPAR, and MN is required in the future.

Membranous nephropathy (MN) is a common pathological type of adult nephrotic syndrome, with an annual incidence rate of approximately 5-10 per 100,000 individuals. It mostly occurs between the ages of 30 and 50 and is rare in children (about 5%). It is significantly more prevalent in men than women (2:1). Moreover, up to 20% of patients with MN develop the end-stage renal disease (ESRD). Furthermore, there is an increasing trend where patients with MN develop ESRD year by year1,2,3. The pathological feature of MN is that granular immunoglobin G (IgG) and complement system membrane attack complex (MAC) are heavily deposited in the glomerular basement membrane (GBM) adjacent to the podocytes. This deposition leads to the thickening of the GBM and disruption of the glomerular filtration barrier integrity, ultimately leading to proteinuria4.
Supportive therapy, immunosuppressants, and targeted monoclonal antibodies are the main methods for treating MN. Although these interventions can significantly reduce proteinuria and delay the progression of renal deterioration, they also have many shortcomings. First, supportive therapy is only suitable for low-risk patients5. Second, immunosuppressants can cause adverse reactions, such as femoral head necrosis, secondary infection, and inhibition of bone marrow hematopoietic function6. Third, extensive randomized-controlled trial research is needed to provide evidence-based medicine for the use of monoclonal antibodies such as ofamizumab, otuzumab, daretozumab, and isatuximab7,8,9. Therefore, actively seeking effective treatment methods for MN has great significance in delaying the onset of ESRD and improving the quality of life of patients with MN.
Podocytes, also known as glomerular visceral epithelial cells, are attached to the outer side of the GBM, and the GBM capillary endothelium together form the glomerular blood filtration barrier. They have important functions, such as maintaining the glomerular protein filtration barrier, synthesizing normal basement membrane, and providing structural support for the glomerular capillary plexus10,11. Research has shown that apoptosis of podocytes plays a crucial role in the occurrence and development of proteinuria and MN, and the PI3K/AKT signaling pathway is involved in the entire process of podocyte growth, differentiation, and apoptosis12,13,14.
An increasing number of studies have shown that Chinese medicine has significant advantages in the treatment of MN, which can significantly reduce blood creatinine, proteinuria, and delayed kidney injury15,16. KMF is a traditional Chinese medicine compound with ingredients derived from 13 plants: Codonopsis pilosula (Franch.) Nannf. (Dangshen, DS); Astragalus membranaceus (Fisch.) Bunge. (Huangqi, HQ); Coptis chinensis Franch. (Huanglian, HL); Perilla frutescens (L.) Britt. (Suye, SY); Rehmannia glutinosa (Gaertn.) DC. (Shudihuang, SDH); Ligusticum chuanxiong Hort. (Chuanxiong, CX); Euryale ferox Salisb. (Qianshi, QS); Sabia japonica Maxim. (Qinfengteng, QFT); Rhus chinensis Mill. (Wubeizi, WBZ); Lobelia chinensis Lour. (Banbianlian, BBL); Oldenlandia diffusa (Willd.) Roxb. (Baihuasheshecao, BHSSC; Table 1). KFM has many functions, such as tonifying the kidney (enhancement of renal function), enhancing qi (strengthening immunity), promoting diuresis, and dredging collaterals (promoting blood circulation). However, the therapeutic mechanism of KMF in MN is unclear17,18.
At present, there are many ways to construct MN models, Including Heymann nephritis model, C-BSA nephritis model, &#945;3NC1 mouse model, in which Heymann nephritis model, the main pathogenic antigen megalin protein is not found in human MN, so it is different from the pathogenesis of human MN, &#945;3NC1 mouse model, only DBA/1 genetic background of the mouse model success rate is higher, the rest of the mice were less successful in modeling, or even unable to be modeled19,20,21. The C-BSA nephritis model is cost-effective and simple to operate, and its pathogenesis is highly similar to that of the human MN animal model19. The basic principle is that because the GBM is negatively charged, and C-BSA is positively charged, it can easily cross the GBM to become a planted antigen, which induces circulating antibodies to accumulate there to form an in situ immune complex, thereby constructing an MN model22,23. The aim of this study was to observe the therapeutic effect of KMF on MN and its molecular mechanism by a combination of transcriptomics and molecular biology and to provide a reliable scientific basis for the treatment of MN with KMF.

<table><tbody><tr><td>2-Amino-3-(2-chloro-phenyl)-propionic acid</td><td>Aladdin</td><td>103616-89-3</td><td></td></tr><tr><td>30% H2O2</td><td>China National Pharmaceutical Group Chemical Reagent Co., Ltd</td><td>10011218</td><td></td></tr><tr><td>812 embedding agent</td><td>SPI</td><td>90529-77-4</td><td></td></tr><tr><td>Acetone</td><td>China National Pharmaceutical Group Chemical Reagent Co., Ltd</td><td>10000418</td><td></td></tr><tr><td>Acetonitrile</td><td>Thermo</td><td>75-05-8</td><td></td></tr><tr><td>Ammonia</td><td>China National Pharmaceutical Group Chemical Reagent Co., Ltd</td><td>10002118</td><td></td></tr><tr><td>Ammonium formate</td><td>Sigma</td><td>540-69-2</td><td></td></tr><tr><td>Analytical balance</td><td>Changzhou Lucky Electronic Equipment Co., Ltd</td><td>FA</td><td></td></tr><tr><td>Anhydrous ethanol</td><td>China National Pharmaceutical Group Chemical Reagent Co., Ltd</td><td>10009218</td><td></td></tr><tr><td>Anti fluorescence quenching and sealing agent</td><td>southernbiotech</td><td>0100-01</td><td></td></tr><tr><td>Automatic biochemical analyzer</td><td>Rayto Life and Analytical Sciences</td><td>Chemray240</td><td></td></tr><tr><td>BCA Protein Assay Kit</td><td>Solarbio</td><td>PC0020</td><td></td></tr><tr><td>Benazepril hydrochloride tablets</td><td>Xinya Minhang</td><td>H20044840</td><td></td></tr><tr><td>Blender</td><td>Kylin-Bell</td><td>BE-2600</td><td></td></tr><tr><td>Brick and stone cutting blade</td><td>Daitome</td><td>Ultra45</td><td></td></tr><tr><td>BSA</td><td>ZSGB-BIO</td><td>ZLI-9027</td><td></td></tr><tr><td>Buffer RW</td><td>Beijing Baiao Leibo</td><td>WK191</td><td></td></tr><tr><td>Carbodiimide hydrochloride</td><td>Hubei Xinghengye Technology</td><td>25952-53-8</td><td></td></tr><tr><td>Cell apoptosis detection kit</td><td>Elabscience</td><td>E-CK-A322</td><td></td></tr><tr><td>Chemiluminescence imaging system</td><td>Hangzhou Shenhua Technology Co., Ltd</td><td>SH-523</td><td></td></tr><tr><td>Chloroform</td><td>China National Pharmaceutical Group Chemical Reagent Co., Ltd</td><td>10006818</td><td></td></tr><tr><td>Constant temperature drying oven</td><td>Thermo Fisher</td><td>Heto PowerDiy LL3000&amp;nbsp;</td><td></td></tr><tr><td>Cover glass slide</td><td>Jiangsu Shitai Experimental Equipment Co., Ltd</td><td>10212450C</td><td></td></tr><tr><td>CY3 Conjugated AffiniPure Goat Anti-rabbit IgG (H+L)</td><td>BOSTER</td><td>BA1032</td><td></td></tr><tr><td>DAB reagent kit</td><td>Servicebio</td><td>G1212-200T</td><td></td></tr><tr><td>DAPI</td><td>Blue Cloud Sky</td><td>C1002</td><td></td></tr><tr><td>Decolorization shaker</td><td>Wuhan Lingsi Biotechnology Co., Ltd</td><td>TSY-B</td><td></td></tr><tr><td>Dehydration machine</td><td>Wuhan Junjie Electronics Co., Ltd</td><td>JJ-12J</td><td></td></tr><tr><td>DL2000 DNA Marker</td><td>TIANGEN</td><td>MD114</td><td></td></tr><tr><td>DMSO</td><td>MCE</td><td>HY-Y0320</td><td></td></tr><tr><td>dNTP</td><td>TIANGEN</td><td>CD117</td><td></td></tr><tr><td>EBlot L1 Rapid Wet Rotation Instrument</td><td>Kingsray Biotechnology Co., Ltd</td><td>L00686C</td><td></td></tr><tr><td>ECL substrate solution</td><td>affinity</td><td>KF8003</td><td></td></tr><tr><td>Electric constant temperature water bath pot</td><td>Fisaff Instrument (Hebei) Co., Ltd</td><td>DK-20000-IIIL</td><td></td></tr><tr><td>Electrophoresis instrument power supply</td><td>Beijing Longfang Technology Co., Ltd</td><td>LF-600S</td><td></td></tr><tr><td>Embedding machine</td><td>Wuhan Junjie Electronics Co., Ltd</td><td>JB-P5</td><td></td></tr><tr><td>Equilibrium buffer</td><td>Wuhan Lingsi Biotechnology Co., Ltd</td><td>E8090</td><td></td></tr><tr><td>Ethylenediamine</td><td>Ruichengkang Pharmaceutical Technology</td><td>107-15-3</td><td></td></tr><tr><td>FA series multifunctional analytical electronic balance</td><td>Changzhou Lucky Electronic Equipment Game Company</td><td>FA1204</td><td></td></tr><tr><td>Filter membrane</td><td>Jinteng</td><td>Nylon6-0.22&amp;mu;m</td><td></td></tr><tr><td>Formaldehyde solution</td><td>China National Pharmaceutical Group Chemical Reagent Co., Ltd</td><td>10010018</td><td></td></tr><tr><td>Formic acid</td><td>TCI</td><td>64-18-6</td><td></td></tr><tr><td>Freezing centrifuge</td><td>Xiangyi</td><td>H1850-R</td><td></td></tr><tr><td>Frozen platform</td><td>Wuhan Junjie Electronics Co., Ltd</td><td>JB-L5</td><td></td></tr><tr><td>Glacial acetic acid</td><td>China National Pharmaceutical Group Chemical Reagent Co., Ltd</td><td>10000218</td><td></td></tr><tr><td>Glass bead</td><td>Sigma</td><td>G8772-500G</td><td></td></tr><tr><td>Glass slide</td><td>Nantong Meiweide Life Science Co., Ltd</td><td>PC2-301</td><td></td></tr><tr><td>glycine</td><td>Biofroxx</td><td>30166428</td><td></td></tr><tr><td>Hematoxylin</td><td>Wuhan Lingsi Biotechnology Co., Ltd</td><td>G1140</td><td></td></tr><tr><td>High speed refrigerated centrifuge&amp;nbsp;</td><td>Hunan Kecheng Instrument Equipment Co., Ltd</td><td>H1-16KR</td><td></td></tr><tr><td>Horizontal agarose electrophoresis tank</td><td>Long Fang</td><td>LF-31DS</td><td></td></tr><tr><td>Horizontal shaker</td><td>Jiangsu Haimen Qilin Bell Instrument Manufacturing Co., Ltd</td><td>TS-1</td><td></td></tr><tr><td>HRP Conjugated AffiniPure Goat Anti-rabbit IgG (H+L)</td><td>BOSTER</td><td>BA1054</td><td></td></tr><tr><td>hydrochloric acid</td><td>China National Pharmaceutical Group Chemical Reagent Co., Ltd</td><td>10011028</td><td></td></tr><tr><td>Imaging system</td><td>Nikon</td><td>Nikon DS-U3</td><td></td></tr><tr><td>Incomplete Freund&#039;s adjuvant</td><td>MCE</td><td>ISA-51</td><td></td></tr><tr><td>Intelligent digital magnetic heating stirrer</td><td>Hangzhou Miou Instrument Co., Ltd</td><td>TP-350E+</td><td></td></tr><tr><td>Isoflurane</td><td>Sigma</td><td>26675-46-7</td><td></td></tr><tr><td>Isopropanol</td><td>China National Pharmaceutical Group Chemical Reagent Co., Ltd</td><td>80109218</td><td></td></tr><tr><td>KCl</td><td>China National Pharmaceutical Group Chemical Reagent Co., Ltd</td><td>10020318</td><td></td></tr><tr><td>KH2PO4</td><td>China National Pharmaceutical Group Chemical Reagent Co., Ltd</td><td>1115GR500</td><td></td></tr><tr><td>Liquid chromatograph</td><td>Thermo</td><td>IQLAAAGABHFAPUMBJC</td><td></td></tr><tr><td>marker(10-250KD)</td><td>Mei5bio</td><td>MF028-plus-01</td><td></td></tr><tr><td>marker(20-120KD)</td><td>GenScript</td><td>M00521</td><td></td></tr><tr><td>Mass spectrometer</td><td>Thermo</td><td>IQLAAEGAAPFALGMBDK</td><td></td></tr><tr><td>Masson staining kit</td><td>BASO</td><td>BA4079B</td><td></td></tr><tr><td>Methanol</td><td>Thermo</td><td>67-56-1</td><td></td></tr><tr><td>microscope</td><td>Nikon</td><td>ECLIPSE Ci</td><td></td></tr><tr><td>microwave oven</td><td>Galanz Microwave Oven Electrical Appliance Co., Ltd</td><td>P70D20TL-P4</td><td></td></tr><tr><td>Multi sample tissue grinder</td><td>Shanghai Jingxin Industrial Development Co., Ltd</td><td>Tissuelyser-24L</td><td></td></tr><tr><td>Multiskan FC ELISA reader</td><td>Thermo scientific</td><td>1410101</td><td></td></tr><tr><td>Na2HPO4.12H2O</td><td>China National Pharmaceutical Group Chemical Reagent Co., Ltd</td><td>10017618</td><td></td></tr><tr><td>NaCl</td><td>China National Pharmaceutical Group Chemical Reagent Co., Ltd</td><td>10000218</td><td></td></tr><tr><td>Neutral resin</td><td>Wuhan Lingsi Biotechnology Co., Ltd</td><td>G8590</td><td></td></tr><tr><td>Normal Goat Serum</td><td>Solarbio</td><td>SL038</td><td></td></tr><tr><td>Organizational spreading machine</td><td>Zhejiang Jinhua Kedi Instrument Equipment Co., Ltd</td><td>KD-P</td><td></td></tr><tr><td>Osmic acid</td><td>Ted Pella Inc</td><td>18450</td><td></td></tr><tr><td>oven</td><td>Shanghai Huitai Instrument Manufacturing Co., Ltd</td><td>DHG-9140A</td><td></td></tr><tr><td>Palm centrifuge</td><td>Wuhan Lingsi Biotechnology Co., Ltd</td><td>D1008E</td><td></td></tr><tr><td>Paraformaldehyde</td><td>Solarbio</td><td>P1110</td><td></td></tr><tr><td>PAS staining kit</td><td>BASO</td><td>BA4114B</td><td></td></tr><tr><td>Pathological slicer</td><td>Shanghai Leica Instrument Co., Ltd</td><td>RM2016</td><td></td></tr><tr><td>PBS</td><td>Solarbio</td><td>P1020</td><td></td></tr><tr><td>PCR instrument</td><td>Hangzhou Miou Instrument Co., Ltd</td><td>PR-96</td><td></td></tr><tr><td>PH meter</td><td>Sedolis Scientific Instruments (Beijing) Co., Ltd</td><td>PB-10</td><td></td></tr><tr><td>PH meter</td><td>Sedolis Scientific Instruments (Beijing) Co., Ltd</td><td>2018C132-11</td><td></td></tr><tr><td>PI3K inhibitor LY294002</td><td>MCE</td><td>HY-10108</td><td></td></tr><tr><td>Pipette gun</td><td>Dragon</td><td>KE0003087/KA0056573</td><td></td></tr><tr><td>Protein phosphatase inhibitor complex</td><td>Meilunbio</td><td>MB12707-1</td><td></td></tr><tr><td>PVDF membrane (0.22 &amp;mu;m)</td><td>Solarbio</td><td>ISEQ00010</td><td></td></tr><tr><td>PVDF membrane (0.45 &amp;mu;m)</td><td>Solarbio</td><td>YA1701</td><td></td></tr><tr><td>Quick primary/secondary antibody diluent</td><td>Solarbio</td><td>A1811</td><td></td></tr><tr><td>Rabbit anti-AKT</td><td>Affinity</td><td>AF0836</td><td></td></tr><tr><td>Rabbit anti-BAD</td><td>Affinity</td><td>AF6471</td><td></td></tr><tr><td>Rabbit anti-C3</td><td>Affinity</td><td>DF13224</td><td></td></tr><tr><td>Rabbit anti-GAPDH</td><td>Hangzhou Xianzhi</td><td>AB-P-R 001</td><td></td></tr><tr><td>Rabbit anti-IgG</td><td>CST</td><td>3900S</td><td></td></tr><tr><td>Rabbit anti-Nephrin</td><td>bioss</td><td>bs-10233R</td><td></td></tr><tr><td>Rabbit anti-P-AKT</td><td>Affinity</td><td>AF0016</td><td></td></tr><tr><td>Rabbit anti-p-BAD</td><td>invitrogen</td><td>PA5-105023</td><td></td></tr><tr><td>Rabbit anti-PI3K</td><td>Affinity</td><td>AF6241</td><td></td></tr><tr><td>Rabbit anti-PIK3CA</td><td>Bioss</td><td>Bs-2067R</td><td></td></tr><tr><td>Rabbit anti-WT-1</td><td>Affinity</td><td>DF6331</td><td></td></tr><tr><td>Real-Time PCR System</td><td>ABI</td><td>QuantStudio 6</td><td></td></tr><tr><td>RIPA Lysis Buffer</td><td>Meilunbio</td><td>MA0151</td><td></td></tr><tr><td>SDS</td><td>China National Pharmaceutical Group Chemical Reagent Co., Ltd</td><td>10019318</td><td></td></tr><tr><td>Slide and cover glass</td><td>Jiangsu Shitai Experimental Equipment Co., Ltd</td><td>10212432C</td><td></td></tr><tr><td>Super pure water instrument</td><td>Zhiang Instrument (Shanghai) Co., Ltd</td><td>Clever-S15</td><td></td></tr><tr><td>SYBR Green Master Mix</td><td>VAZYME</td><td>Q111-02</td><td></td></tr><tr><td>Taq Plus DNA Polymerase</td><td>TIANGEN</td><td>ET105-02</td><td></td></tr><tr><td>Tissue grinder</td><td>Beautiful Wall</td><td>MB-96</td><td></td></tr><tr><td>Transmission electron microscope</td><td>HITACHI</td><td>HT7800/HT7700</td><td></td></tr><tr><td>Tris-base</td><td>Biofroxx</td><td>10019318</td><td></td></tr><tr><td>Trizol</td><td>Ambion</td><td>15596-026</td><td></td></tr><tr><td>TUNEL Cell Apoptosis Detection Kit (FITC)</td><td>Beijing Baiao Leibo</td><td>SY0475</td><td></td></tr><tr><td>Tween 20</td><td>China National Pharmaceutical Group Chemical Reagent Co., Ltd</td><td>30189328</td><td></td></tr><tr><td>Ultra micro UV visible spectrophotometer</td><td>Hangzhou Miou Instrument Co., Ltd</td><td>ND-100</td><td></td></tr><tr><td>Ultra thin slicer</td><td>Leica</td><td>Leica UC7</td><td></td></tr><tr><td>Ultrasonic cleaner</td><td>shumei</td><td>KQ- 800DE</td><td></td></tr><tr><td>Upright optical microscope</td><td>Nikon</td><td>Nikon Eclipse CI</td><td></td></tr><tr><td>Urinary Protein Test Kit</td><td>Nanjing Jiancheng Bioengineering Research Institute</td><td>C035-2</td><td></td></tr><tr><td>Vertical electrophoresis tank</td><td>Beijing 61 Instrument Factory</td><td>DYCZ-24DN</td><td></td></tr><tr><td>Vortex mixer</td><td>Wuhan Lingsi Biotechnology Co., Ltd</td><td>MX-F</td><td></td></tr><tr><td>Western Blocking Buffer</td><td>Solarbio</td><td>SW3010</td><td></td></tr><tr><td>xylene</td><td>China National Pharmaceutical Group Chemical Reagent Co., Ltd</td><td>10023418</td><td></td></tr></tbody></table>

mechanism of kemeng fang's inhibition of podocyte apoptosis in rats with membranous nephropathy through the pi3k/akt signaling pathway

Mechanism of Kemeng Fang's Inhibition of Podocyte Apoptosis in Rats with Membranous Nephropathy through the PI3K/AKT Signaling Pathway

Membranous nephropathy (MN) is a common pathological type of adult nephrotic syndrome. Up to 20% of patients with MN develop end-stage renal disease (ESRD). Podocytes have an important function in maintaining the glomerular filtration barrier and play a crucial role in the occurrence and development of proteinuria and MN. PI3K/AKT signaling pathway is involved in the entire process of podocyte growth, differentiation, and apoptosis. Kemeng Fang (KMF) is a traditional Chinese medicine formula that has been used to delay kidney injury. However, the therapeutic mechanism of KMF in MN is unclear. Here, the MN rat model was established by axillary, inguinal, and tail vein injections of cationized bovine serum albumin (C-BSA), and then KMF and PI3K inhibitor (LY294002) were administered. The data of liver function, kidney function, blood lipid, renal pathology, podocyte function, expression level of PI3K/AKT signaling pathway, and transcriptomics of rats demonstrated that KMF has a protective effect on the podocytes of MN rats by activating the PI3K/AKT signaling pathway, and it can effectively prevent the progression of MN.

Analysis results of the components of KMF 
In the positive and negative ion modes analyzed by LC-MS/MS, 147 and 120 compounds were identified, respectively (Figure 1A-B). Some compounds and their MF-calculated molecular weight, m/z value, retention time, and parent ions are shown in Supplementary Table 2.
KMF improved lipid metabolism disorders and liver and kidney injury in MN rats 
Using SD rats and C-BSA, we established an MN model. After 1 week of tail vein injections of C-BSA, the MN rats exhibited varying degrees of mental fatigue, decreased appetite, slow growth, dull hair color, fluffy fur, delayed response, and weight loss, with some rats developing scrotal edema. After 4 weeks of administration, different doses of KMF significantly reduced the expression levels of 24 h urinary total protein (24 h-UTP), Scr, and BUN, enhanced renal function (Figure 2A-C); reduced ALT and AST expression levels and increased TP and ALB expression levels, enhance liver function (Figure 2D-G); reduced the expression levels of TC and TG, and improved the function of lipid regulation (Figure 2H-I). These results suggest that KMF has a protective effect on renal function; however, its specific mechanism of action is not yet clear.
KMF improves histopathological damage of renal tissue in MN rats 
To test whether KMF could improve renal injury in MN rats, using H&amp;E, PAS, Masson, and IF detected histopathological damage of renal tissue. H&amp;E and PAS staining showed glomerular hypertrophy, mild proliferation of mesangial cells, renal tubular dilation, and vacuolar degeneration of renal tubular epithelial cells in the MOD group (Figure 3A). Masson staining showed a significant increase in the area of renal fibrosis in the MOD group (Figure 3B-C). Immunofluorescence showed that the relative fluorescence intensity of IgG and C3 in the MOD group was significantly higher than that in the CON group (Figure 3D-F). After administering KMF, BEN, or PI3K inhibitors+KM-M, the degree of glomerular hypertrophy, as well as the degree of proliferation of tethered cells, was reduced, the area of renal fibrosis was significantly reduced, and the relative fluorescence intensity of IgG and C3 was significantly lower. These results indicate that KMF can alleviate renal pathological damage in MN rats.
KMF alleviates podocyte damage by activating the PI3K/AKT signaling pathway 
The damage of key podocytes in MN was also observed using methods described here, namely IHC, PCR, TUNEL, and TEM. IHC and PCR results showed that compared with the CON group, the MOD group had a significant decrease in the expression levels of podocyte-specific and functional marker proteins, WT-1 and Nephrin, indicating podocyte damage, while KMF treatment increases the expression levels of WT-1, Nephrin and alleviates podocyte damage (Figure 4A-E). The TUNEL staining results showed severe apoptosis of podocytes in the MOD group, while KMF treatment significantly decreased fluorescence intensity and reduced the incidence of apoptosis (Figure 4F-G). The TEM results showed that the basement membrane of the glomerulus in the MOD group was significantly unevenly thickened, and the mitochondria of podocytes showed severe swelling, sparse matrix, and empty bombardment of the matrix, with reduced or absent cristae. After administering KMF, the thickening of the glomerular basement membrane was significantly reduced, and the morphology of podocyte mitochondria was significantly restored (Figure 4H). These results indicate that KMF can alleviate podocyte damage in MN rats.
Further detection of the expression of PI3K/AKT signaling pathway-related proteins26,27 by WB revealed that compared with the CON group, the MOD group showed a significant increase in the expression levels of PI3K, PIK3CA, AKT, P-AKT, BAD, BAX, and C-caspase3, while the expression levels of P-BAD and BCL-2 decreased significantly. While KMF treatment reduces the expression levels of PI3K, PIK3CA, AKT, P-AKT, BAD, BAX, and C-caspase3, it increases the expression levels of P-BAD and BCL-2 (Figure 4I-J). These results further indicate that KMF can improve podocyte damage in MN rats by activating the PI3K/AKT signaling pathway.
Exploring the possible mechanisms of KMF therapy for MN based on transcriptomics 
To further reveal the targets and potential mechanisms of KMF in treating MN, a transcriptomic analysis was conducted based on Tandem Mass Tag (TMT). The results showed that there were 898 differentially expressed genes (DEGs) between the CON and MOD groups, including 372 upregulated and 526 downregulated genes (Figure 5A-B). Similarly, there were 360 DEGs between the KM-L and MOD groups, including 202 upregulated and 158 downregulated genes (Figure 5C-D). To identify the genes and signaling pathways that may be affected, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment functional analysis was conducted (Figure 5E-H). The results showed that the biological processes of DEG mainly focus on cellular processes and biological regulation, while the functions of DEG mainly focus on neuroactive ligand-receptor interactions, such as the CAMP, PPAR, PI3K-AKT, and p53 signaling pathways. These results suggest that KMF may treat MN by affecting these signaling pathways, with the PI3K/AKT signaling pathway validated in experiments. Finally, the top 100 DEGs were selected in order of degree value to construct the Protein-protein interaction (PPI) network (Figure 5I-J).
<img alt="Chromatography analysis graph; retention time vs. ion intensity peaks; LC-MS data comparison." class="xfigimg" src="/files/ftp_upload/67170/67170fig01.jpg" data-altupdatedat="1788304762000" data-alt="Figure 1"> 
Figure 1: LC-MS/MS peak ion chromatogram. (A) Positive ion mode. (B) Negative ion mode. <a href="https://www.jove.com/files/ftp_upload/67170/67170fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Serum biochemical parameters with time series. Charts show urine albumin, Cr, BUN, AST, Albumin." class="xfigimg" src="/files/ftp_upload/67170/67170fig02.jpg" data-altupdatedat="1788304762000" data-alt="Figure 2"> 
Figure 2: KMF improves lipid metabolism disorder and liver and kidney injury in MN rats. (A-C) The effects of Kemeng Fang on renal function, including 24 h urine Albumin, serum Cera, and serum BUN. (D-G) The effects of Kemeng Fang on liver function include Alanine aminotransferase (ALT), Aspartate transaminase (AST), total protein, and serum albumin. (H-I) The effect of Kemeng Fang on the regulation of blood lipid metabolism, including Triglyceride (TG) and Total cholesterol (TC). Data are expressed as means ± standard deviations of 3-6 independent samples, using one-way ANOVA in T-test, compared with the blank group, *p&lt;0.05, **p&lt;0.01, ***p&lt;0.001, and compared with the model group, #p &lt; 0.05, ##p &lt; 0.01, ###p &lt; 0.001. <a href="https://www.jove.com/files/ftp_upload/67170/67170fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Histology staining analysis; includes H&amp;E, PAS, Masson images, bar graphs for inflammation data." class="xfigimg" src="/files/ftp_upload/67170/67170fig03.jpg" data-altupdatedat="1788304762000" data-alt="Figure 3"> 
Figure 3: Kemeng Fang improves histopathological damage to the kidneys of MN rats. (A) Renal histological examination, including H&amp;E and PAS (200x). (B-C) Semi-quantitative analysis of renal fibrosis (blue collagen fibers) relative area using Masson staining and Image J software. (D-F) Semi-quantitative analysis of relative fluorescence intensity (Intden/Area; where Intden is the total regional fluorescence intensity, the area is the regional area) of IgG and C3 in renal tissue using IF and Image J software. <a href="https://www.jove.com/files/ftp_upload/67170/67170fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Histology and Western blot analysis of nephrin and VWF1 expression with PI3K- and AKT-related pathways." class="xfigimg" src="/files/ftp_upload/67170/67170fig04.jpg" data-altupdatedat="1788304762000" data-alt="Figure 4"> 
Figure 4: Kemeng Fang alleviates podocyte damage by activating the PI3K/AKT signaling pathway. (A-C) IHC was used to detect the relative expression levels of two podocyte marker proteins, WT-1, and Nephrin, in renal tissue. (D-E) PCR detection of the relative mRNA expression of two podocyte marker proteins, WT-1 and Nephrin, in renal tissue. (F-G) TUNEL staining was used to detect the incidence of apoptosis in renal tissue. (H) Observation of glomerular basement membrane and podocyte mitochondrial structure using TEM (2,500x, bar=5 µM; 7,000x, bar=2 µM). (I-J) WB detection of relative protein expression levels of PI3K, PIK3CA, AKT, P-AKT, BAD, P-BAD, BCL-2, bax, and C-caspase3 in renal tissue. <a href="https://www.jove.com/files/ftp_upload/67170/67170fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Differential gene expression analysis; heatmaps, volcano plots, scatter plots, PPI networks." class="xfigimg" src="/files/ftp_upload/67170/67170fig05.jpg" data-altupdatedat="1788304762000" data-alt="Figure 5"> 
Figure 5: Exploring the possible mechanism of Kemeng Fang in treating MN based on transcriptomics. (A-B) Differential gene heatmaps and volcano plots between the CON and MOD groups, with blue representing downregulation and red representing upregulation. (C-D) Differential gene heatmaps and volcano plots between the MOD and KM-L groups, with blue representing downregulation and red representing upregulation. (E) GO enrichment between the CON and MOD groups. (F) GO enrichment between the MOD and KM-L groups. (G) KEGG enrichment between the CON and MOD groups. (H) KEGG enrichment between the MOD and KM-L groups. (I) Protein-protein interaction (PPI) chart of the top 100 differentially expressed genes between the CON and MOD groups. (J) PPI chart of the top 100 DEG degree values between the MOD and KM-L groups. <a href="https://www.jove.com/files/ftp_upload/67170/67170fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>NO.</td>
			<td>Chinese name</td>
			<td>Latin name</td>
			<td>Family</td>
			<td>Part used</td>
			<td>Dose(g)</td>
		</tr>
		<tr>
			<td>1</td>
			<td>Dangshen (DS)</td>
			<td>Codonopsis pilosula (Franch.) Nannf.</td>
			<td>Campanulaceae</td>
			<td>Root</td>
			<td>20</td>
		</tr>
		<tr>
			<td>2</td>
			<td>Huangqi (HQ)</td>
			<td>Astragalus membranaceus (Fisch.) Bunge.</td>
			<td>Leguminosae</td>
			<td>Root</td>
			<td>30</td>
		</tr>
		<tr>
			<td>3</td>
			<td>Huanglian (HL)</td>
			<td>Coptis chinensis Franch.</td>
			<td>Ranunculaceae</td>
			<td>Root and tuber</td>
			<td>3</td>
		</tr>
		<tr>
			<td>4</td>
			<td>Suye (SY)</td>
			<td>Perilla frutescens (L.) Britt</td>
			<td>Labiatae</td>
			<td>leaf</td>
			<td>6</td>
		</tr>
		<tr>
			<td>5</td>
			<td>Shudihuang (SDH)</td>
			<td>Rehmannia glutinosa (Gaertn.) DC.</td>
			<td>Scrophulariaceae</td>
			<td>Root and tuber</td>
			<td>15</td>
		</tr>
		<tr>
			<td>6</td>
			<td>Chuanxiong (CX)</td>
			<td>Ligusticum chuanxiong Hort.</td>
			<td>Umbelliferae</td>
			<td>Root and tuber</td>
			<td>15</td>
		</tr>
		<tr>
			<td>7</td>
			<td>Qianshi (QS)</td>
			<td>Euryale ferox Salisb.</td>
			<td>Nymphaeaceae</td>
			<td>Seed</td>
			<td>15</td>
		</tr>
		<tr>
			<td>8</td>
			<td>Qinfengteng (QFT)</td>
			<td>Sabia japonica Maxim.</td>
			<td>Sabiaceae</td>
			<td>Root, tuber and leaf</td>
			<td>10</td>
		</tr>
		<tr>
			<td>9</td>
			<td>Wubeizi (WBZ)</td>
			<td>Rhus chinensis Mill.</td>
			<td>Anacardiaceae</td>
			<td>leaf</td>
			<td>3</td>
		</tr>
		<tr>
			<td>10</td>
			<td>Banbianlian (BBL)</td>
			<td>Lobelia chinensis Lour.</td>
			<td>Campanulaceae</td>
			<td>Tuber and leaf</td>
			<td>15</td>
		</tr>
		<tr>
			<td>11</td>
			<td>Baihuasheshecao (BHSSC)</td>
			<td>Oldenlandia diffusa (Willd.) Roxb.</td>
			<td>Rubiaceae</td>
			<td>Tuber and leaf</td>
			<td>15</td>
		</tr>
	</tbody>
</table>
Table 1: Composition of Kemeng Fang (KMF).
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antibody</td>
			<td>Dilution multiple</td>
		</tr>
		<tr>
			<td>IgG</td>
			<td>1:100</td>
		</tr>
		<tr>
			<td>C3</td>
			<td>1:100</td>
		</tr>
		<tr>
			<td>WT-1</td>
			<td>1:200</td>
		</tr>
		<tr>
			<td>Nephrin</td>
			<td>1:100</td>
		</tr>
		<tr>
			<td>PI3K</td>
			<td>1:1000</td>
		</tr>
		<tr>
			<td>PI3K3CA</td>
			<td>1:1000</td>
		</tr>
		<tr>
			<td>AKT</td>
			<td>1:1000</td>
		</tr>
		<tr>
			<td>P-AKT</td>
			<td>1:1000</td>
		</tr>
		<tr>
			<td>BAD</td>
			<td>1:1000</td>
		</tr>
		<tr>
			<td>P-BAD</td>
			<td>1:1000</td>
		</tr>
		<tr>
			<td>BCL-2</td>
			<td>1:1000</td>
		</tr>
		<tr>
			<td>bax</td>
			<td>1:4000</td>
		</tr>
		<tr>
			<td>c-caspase3</td>
			<td>1:1000</td>
		</tr>
		<tr>
			<td>GAPDH</td>
			<td>1:1000</td>
		</tr>
	</tbody>
</table>
Table 2: Antibody dilution multiples.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Gene</td>
			<td>Primer</td>
			<td colspan="2">Sequence (5'-3')</td>
			<td>PCR Products</td>
		</tr>
		<tr>
			<td rowspan="2">Rat GAPDH</td>
			<td>Forward</td>
			<td colspan="2"> ACAGCAACAGGGTGGTGGAC</td>
			<td rowspan="2">253 bp</td>
		</tr>
		<tr>
			<td>Reverse</td>
			<td colspan="2"> TTTGAGGGTGCAGCGAACTT</td>
		</tr>
		<tr>
			<td rowspan="2">Rat WT-1</td>
			<td>Forward</td>
			<td colspan="2">AATGGACAGAAGGGCAGAGCA</td>
			<td rowspan="2">209 bp</td>
		</tr>
		<tr>
			<td>Reverse</td>
			<td colspan="2">TGGGTACGCACACATGAAAGG</td>
		</tr>
		<tr>
			<td rowspan="2">Rat Nephrin</td>
			<td>Forward</td>
			<td colspan="2">CGGAGAACAAGAACGTGACC</td>
			<td rowspan="2">177 bp</td>
		</tr>
		<tr>
			<td>Reverse</td>
			<td colspan="2">ATTGTCTTCTCTCCGCACCA</td>
		</tr>
	</tbody>
</table>
Table 3: Detailed information of qRT-PCR primers.
Supplementary Table 1: PCR reaction. <a href="https://www.jove.com/files/ftp_upload/67170/Supplementary%20Table%201_RE.zip" target="_blank">Please click here to download this File.</a>
Supplementary Table 2: Quantitative list of metabolite identification. ID: First order molecular weight serial number; Name: Identification result; Mz: mass to nucleus ratio; Rt: retention time (S); Exact Mass: Accurate molecular weight; Ppm: The error between the detected molecular weight and the theoretical molecular weight, measured in ppm; precursor_type: Ionization mode, [M+H]+ is positive ion mode, [M-H]- is negative ion mode; class: Triple classification in HMDB database; sub_class: Four level classification in HMDB database; KEGG: KEGG compound number; KEGG_Pathway: KEGG signaling pathway; CAS: Chemical Abstracts Service registration number; HMDB: HMDB database number; Library: Database; Formula: Theoretical molecular formula; KEGG: KEGG compound number; Library: Database; level: Metabolite identification level; pos: positive ion mode; neg: negative ion mode; KMF_1/2/3: total ion intensity of three experiments. <a href="https://www.jove.com/files/ftp_upload/67170/Supplementary%20Table%202_RE.zip" target="_blank">Please click here to download this File.</a>

The present protocol describes the establishment of a membranous nephropathy (MN) animal model, and how Kemeng Fang's inhibition reduces MN rat podocyte apoptosis by activating the PI3K/AKT signaling pathway.

Membranous nephropathy (MN) is a common pathological type of adult nephrotic syndrome. Up to 20% of patients with MN develop end-stage renal disease ...

mechanism-kemeng-fang-s-inhibition-podocyte-apoptosis-rats-with

Research

JoVE Journal

Medicine

Here, we present a protocol describing network pharmacology and molecular docking techniques to explore the mechanism of action of Jiawei Shengjiang San (JWSJS) in treating diabetic nephropathy.

Antagonistic Effect of Jiawei Shengjiang San on a Rat Model of Diabetic Nephropathy: Related to EGFR/MAPK3/1 Signaling Pathway

The cytotoxic activity of the phenanthridine PJ-34 in cancer cells undergoing mitosis was documented in real time by live confocal imaging. PJ-34 eradicated human breast cancer MDA-MB-231 cells harboring extra-centrosomes in mitosis. Unlike normal bi-focal mitosis, the extra-centrosomes were not clustered in the two spindle poles in the presence of PJ-34.

Cell Death Associated with Abnormal Mitosis Observed by Confocal Imaging in Live Cancer Cells

Molecular signaling through both estrogen and microRNAs are critical in breast cancer development and growth. Estrogen activates the estrogen receptors, which are transcription factors. Many transcription factors can regulate the expression of microRNAs, and estrogen-regulated microRNAs can be profiled using different large-scale techniques.

Profiling of Estrogen-regulated MicroRNAs in Breast Cancer Cells

This paper details how Elvax 40W can be used as a slow-release method for drug delivery to the adult rat retina. The protocol for preparing, loading, and delivering the drug-resin complex to the eye is described.

Slow-release Drug Delivery through Elvax 40W to the Rat Retina: Implications for the Treatment of Chronic Conditions

A rat model of abdominal aortic constriction that induces cardiac hypertrophy and remodeling is described. An efficient, highly-reproducible, and minimally-invasive method is used to provide a simple yet useful platform for research in myocardial hypertrophy and dysfunction.

A Model of Cardiac Remodeling Through Constriction of the Abdominal Aorta in Rats

The rodent left pneumonectomy is a valuable technique in pulmonary hypertension research. Here, we present a protocol to describe the rat pneumonectomy procedure and postoperative care to ensure minimal morbidity and mortality.

The Left Pneumonectomy Combined with Monocrotaline or Sugen as a Model of Pulmonary Hypertension in Rats

Here, we present a protocol to take blood samples from the subclavian vein of mice.

Blood Collection Through Subclavian Vein Puncture in Mice

This protocol describes a common and feasible method of inducing acute liver injury (ALI) via CCl4 exposure through an orogastric tube. CCl4 exposure induces ALI through the formation of reactive oxygen species during its biotransformation in the liver. This method is used to analyze the pathophysiology of ALI and examine different hepatoprotective strategies.

Inducing Acute Liver Injury in Rats via Carbon Tetrachloride (CCl4) Exposure Through an Orogastric Tube

In this protocol, a knee osteoarthritis model was prepared using the modified Videman method, and the operation procedures and precautions of acupotomy are detailed. The effectiveness of acupotomy has been demonstrated by testing the mechanical properties of quadriceps femoris and tendon and the mechanical and morphological properties of cartilage.

Application of Acupotomy in a Knee Osteoarthritis Model in Rabbit

The present protocol describesa comprehensive strategy for evaluating the pharmacological action and mechanism of salidroside in inhibiting MCF-7 cell proliferation and migration.

Exploring the Pharmacological Action and Molecular Mechanism of Salidroside in Inhibiting MCF-7 Cell Proliferation and Migration

Discover how Kemeng Fang reduces podocyte apoptosis in membranous nephropathy rats through PI3K/AKT pathway activation. This study establishes an MN animal model using C-BSA immunization and Western blotting techniques.

Mechanism of Kemeng Fangs Inhibition of Podocyte Apoptosis in Rats with Membranous Nephropathy through the PI3K/AKT Signaling Pathway (Video) | JoVE Journal

Mechanism of Kemeng Fang's Inhibition of Podocyte Apoptosis in Rats with Membranous Nephropathy through the PI3K/AKT Signaling Pathway

Explore More Videos