डीएनए नकल एंजाइमों का प्रत्यक्ष प्रेक्षण एक एकल अणु डीएनए परख टूटती का उपयोग

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

हम व्यक्तिगत डीएनए जीवाणुभोजी प्रतिकृति प्रणाली के प्रोटीन द्वारा मध्यस्थता अणुओं की वास्तविक समय प्रतिकृति के अवलोकन के लिए एक विधि का वर्णन.

Cite this Article

Copy Citation | Download Citations

Kulczyk, A. W., Tanner, N. A., Loparo, J. J., Richardson, C. C., van Oijen, A. M. Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay. J. Vis. Exp. (37), e1689, doi:10.3791/1689 (2010).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

हम व्यक्तिगत डीएनए जीवाणुभोजी प्रतिकृति प्रणाली के प्रोटीन द्वारा मध्यस्थता अणुओं की वास्तविक समय प्रतिकृति के अवलोकन के लिए एक विधि का वर्णन. Linearized λ डीएनए के एक भूग्रस्त के अंत पर एक बायोटिन, और ही भूग्रस्त के दूसरे छोर पर एक digoxigenin आधा भाग है संशोधित किया गया है. biotinylated अंत functionalized कांच coverslip और एक छोटे से मनका के digoxigeninated अंत से जुड़ी है. एक प्रवाह सेल की सतह पर इन डीएनए मनका tethers के विधानसभा लामिना का प्रवाह के लिए मनका पर एक खींचें बल लागू लागू किया जा करने के लिए अनुमति देता है. एक परिणाम के रूप में, डीएनए करीब करने के लिए और एक शक्ति है कि प्रवाह की दर (चित्रा 1) द्वारा निर्धारित किया जाता है पर coverslip की सतह के समानांतर फैला है. डीएनए की लंबाई मनका की स्थिति की निगरानी के द्वारा मापा जाता है. एकल और डबल असहाय डीएनए के बीच अंतर करने के लिए लंबाई दोराहे पर प्रतिकृति प्रोटीन की गतिविधि पर वास्तविक समय जानकारी प्राप्त करने के लिए उपयोग कर रहे हैं. मनका की स्थिति को मापने और unwinding के डीएनए और polymerization (चित्रा 2) के दरों processivities के सटीक निर्धारण की अनुमति देता है.

Protocol

1. डीएनए प्रतिकृति टेम्पलेट

प्रतिक्रिया के लिए डीएनए एक linearized λ oligonucleotides की annealing के लिए एक प्रतिकृति कांटा फार्म संशोधित डीएनए है. इसके अतिरिक्त, बायोटिन λ डीएनए के एक भूग्रस्त के अंत में संलग्न है, और एक digoxigenin आधा भाग ही एक भूग्रस्त के दूसरे छोर से जुड़ा हुआ है .

जीवाणुभोजी λ डीएनए, oligonucleotides:: biotinylated कांटा हाथ (एक: 5'-बायोटिन - AAAAAAAAAAAAAAAAGAGTACTGTACGATCTAGCATCAATCACAGGGTCAGGTTCGTTATTGTCCAACTTGCTGTCC-3 '), λ पूरक कांटा हाथ (बी: 5'-GGGCGGCGACCTGGACAGCAAGTTG GACAATCTCGTTCTATCACTAATTCACTAATGCAGGGAGGATTTCAGATATGGCA-3'), कांटा प्राइमर (सी: 5 'माल TGCCATATCTGAAATCCTCCCTGC-3 '), digoxigenin λ पूरक अंत (डी: 5'-AGGTCG CCGCCCAAAAAAAAAAAA digoxigenin-3'), टी -4 डीएनए ligase, टी -4 polynucleotide kinase, हीट ब्लॉक.

  1. Oligonucleotides बी और डी के 5 'टी -4 polynucleotide kinase का उपयोग कर समाप्त होता है phosphorylate.
  2. Oligonucleotides ए, बी, और सी ए और बी oligonucleotides की एक अतिरिक्त 10 गुना है, और टी -4 डीएनए ligase बफर में oligonucleotide सी की 100 गुना अधिक जोड़कर λ डीएनए के लिए पानी रखना एक कदम में.
  3. 65 ° गर्मी ब्लॉक सी मिश्रण गर्मी. एक बार गर्म, गर्मी ब्लॉक बंद और धीमी गति से ठंडा अनुमति देने के लिए ठीक oligonucleotides पानी रखना.
  4. मिश्रण करने के लिए टी -4 डीएनए ligase जोड़ें और कमरे के तापमान पर 2 घंटे के लिए सेते हैं. टी -4 डीएनए ligase में शामिल होने के ए और बी, और λ डीएनए oligonucleotides की सही उत्प्रेरित करेंगे.
  5. अंत में, टी -4 डीएनए ligase बफर में मैं डीएनए के लिए सम्मान के साथ oligonucleotide डी 100 गुना से अधिक जोड़कर डीएनए प्रतिकृति टेम्पलेट oligonucleotide डी पानी रखना.
  6. 45 डिग्री सेल्सियस गर्मी ब्लॉक में 30 मिनट, और कमरे के तापमान शांत करने के लिए के लिए गर्मी ब्लॉक बंद करके धीरे धीरे मिश्रण सेते हैं.
  7. अंतिम डीएनए प्रतिकृति टेम्पलेट अब इस्तेमाल के लिए तैयार है. हम 4 में 1.4 एनएम के एक एकाग्रता में टेम्पलेट ° दुकान कई हफ्तों के लिए सी.

2. मोती

मोती विशिष्टता के साथ एक digoxigenin के लिए फैब टुकड़ा के साथ functionalized कर रहे हैं. वे तो डीएनए प्रतिकृति टेम्पलेट 2 के लिए संलग्न किया जा सकता है.

सामग्री: Tosyl सक्रिय मोती, α digoxigenin फैब टुकड़ा, एक बफर: 0.1 एम H3BO3 9.5 पीएच, बफर बी एम 0.1 पीबीएस 7.4 पीएच, 0.1% w / ध् BSA, बफर सी: 0.2 Tris - एचसीएल एम पीएच 8.5 (25 ° सी), 0.1% w / ध् BSA, चुंबकीय विभाजक, अंग को घुमानेवाली पेशी.

  1. मोतियों के शेयर समाधान Resuspend और Eppendorf ट्यूब में एक छोटे से विभाज्य हस्तांतरण. चुंबकीय विभाजक और सेते की एक स्लॉट में ट्यूब प्लेस तक समाधान को साफ करता है, तो pipetting द्वारा सतह पर तैरनेवाला हटायें.
  2. एक बफर में जोड़ें, जो एंटीबॉडी युग्मन के लिए tosyl समूहों को सक्रिय कर देंगे. Pipetting द्वारा धीरे मिक्स और चुंबकीय विभाजक के साथ बफर हटाने.
  3. फैब टुकड़ा और resuspend मोती एक बफर में फिर से जोड़ें, मिश्रण अच्छी तरह से, और 37 में 16-24 घंटे ° का उपयोग सी अंग को घुमानेवाली पेशी को सेते हैं. ऊष्मायन के बाद, अलग मोती चुंबकीय विभाजक का उपयोग और बफर हटायें.
  4. 4 ° C में 5 मिनट के लिए बफर बी और सेते जोड़कर मोती धो लें. चुंबकीय विभाजक का उपयोग कर बफर निकालें. दो बार धोने दोहराएँ.
  5. 4 घंटे के लिए बफर सी और सेते 37 डिग्री सेल्सियस जोड़ें करने के लिए स्वतंत्र tosyl समूहों ब्लॉक. अलग मोती चुंबकीय विभाजक का उपयोग और बफर हटायें.
  6. उपयोग के लिए बफर बी और विभाज्य में दो बार धोएं. मोती 4 में संग्रहीत किया जा सकता है है डिग्री सेल्सियस के लिए 1 या वर्ष की गुणवत्ता काफी हानि (हमारे स्टॉक समाधान 1 शामिल हैं - 2x10 9 / मोती मिलीलीटर) के बिना अब.

3. Functionalized Coverslips

कांच coverslip करने के लिए डीएनए की कुर्की की अनुमति के लिए, कांच पहले एक aminosilane है, जो तब biotinylated खूंटी अणुओं के लिए युग्मित है के साथ functionalized है. इस कोटिंग 3,4 सतह के साथ डीएनए प्रतिकृति और प्रोटीन की बातचीत nonspecific को कम करने में मदद करता है.

ग्लास coverslips, धुंधला जार, 3-aminopropyltriethoxysilane, Methoxy PEG5k - एनएचएस एस्टर, बायोटिन PEG5k - NHSester, एसीटोन, 1M KOH, इथेनॉल, ओवन, स्नान sonicator सामग्री:

  1. उन्हें जार धुंधला हो जाना और इथेनॉल के साथ जार भरने में रखकर अच्छी तरह से साफ कांच coverslips. 30 मिनट के लिए Sonicate, जार बाहर कुल्ला और एम 1 KOH के साथ भरें. दोनों washes दोहराएँ.
  2. पहली functionalization प्रतिक्रिया के लिए, पानी के सभी निशान को हटा दिया जाना चाहिए. एसीटोन और 10 मिनट के लिए sonicate के साथ जार भरें. खाली और एसीटोन के साथ फिर से भरने.
  3. एसीटोन में silane अभिकर्मक की एक 2% v / v समाधान तैयार करें. धुंधला जार में जोड़ें और 2 मिनट के लिए आंदोलन. यह प्रतिक्रिया aminosilane के कांच के लिए alkoxy समूह जोड़े, के लिए अगले युग्मन कदम एक प्रतिक्रियाशील amine छोड़ने. पानी की एक बड़ी अतिरिक्त के साथ प्रतिक्रिया बुझाने.
  4. उन्हें 110 पर पाक द्वारा coverslips सूखी °, 30 मिनट के लिए ओवन में सी.
  5. 100 मिमी NaHCO 3 8.2 पीएच में: 50:1 methoxy बायोटिन खूंटी मिश्रण तैयार कर लें. 0.2% के आसपास w / ध् biotinylated खूंटी के लिए निशाना लगाओ.
  6. पिपेट एक सूखी silanized coverslip और जगह के शीर्ष पर एक coverslip पर 100 खूंटी मिश्रण की μL. एक गिलास coverslip स्पेसर शामिल coverslips की जुदाई की अनुमति देगा.
  7. 3 घंटे के लिए खूंटी समाधान में coverslips सेते हैं, तो coverslips की प्रत्येक जोड़ी के अलग और धोने के पानी के साथ बड़े पैमाने पर. Functionalized coverslips पक्ष के रूप में केवल एक बार ओर खूंटी के साथ लेपित हो जाएगा रखने के लिए सावधान रहें.
  8. हवा और desiccator में वैक्यूम के तहत दुकान के साथ coverslips सूखी. सतहों कम से कम एक महीने के लिए स्थिर रहेगा, तो coverslips के दर्जनों एक बैच में बनाया जा सकता है है और के रूप में की जरूरत इस्तेमाल किया.

4. फ्लो चैंबर तैयार

प्रयोग एक सरल प्रवाह चैम्बर एक functionalized coverslip, डबल पक्षीय टेप, एक क्वार्ट्ज स्लाइड और टयूबिंग के साथ निर्माण का उपयोग किया जाता है. एक प्रवाह कक्ष प्रत्येक एकल अणु 2,4 प्रयोग के लिए तैयार है .

सामग्री: डबल पक्षीय टेप, रेजर ब्लेड, टयूबिंग, जल्दी सूखी epoxy के लिए छेद के साथ क्वार्ट्ज स्लाइड, Functionalized coverslip, streptavidin समाधान (1 पीबीएस में मिलीग्राम / एमएल के 25 μL), टयूबिंग, अवरुद्ध बफर (5X: 20 मिमी Tris पीएच 7.5, 2 मिमी EDTA, 50 मिमी NaCl, 0.2 मिलीग्राम / एमएल BSA, 0.005% बीच - 20), काम बफर (1X: 20 मिमी Tris - एचसीएल पीएच 7.5, 2 मिमी EDTA, 50 मिमी NaCl).

  1. मिश्रण और अवरुद्ध बफर और एक desiccator में बफर काम करने के लिए बाद के चरणों के लिए किसी भी हवाई बुलबुले को दूर करने के 20 मिलीलीटर की 5 एमएल रखने द्वारा शुरू करो.
  2. खूंटी-functionalized coverslip लो और सतह पर 125 पीबीएस - पतला streptavidin समाधान के फैल गया. छोड़ो इस कमरे के तापमान पर 20 मिनट के लिए सेते हैं जबकि चैम्बर के अन्य भागों की तैयारी, streptavidin सतह biotins बाध्य करने की अनुमति.
  3. डबल पक्षीय टेप का एक टुकड़ा कट क्वार्ट्ज स्लाइड के आकार मैच. टेप पर इतना है कि प्रवाह चैम्बर की एक रूपरेखा तैयार किया जा सकता है टेप पर टयूबिंग छेद की स्थिति चिह्नित.
  4. एक 3 मिमी चौड़ा केंद्र चैनल और दोनों छेद युक्त आयत बनाएँ. हम दो Inlet और दो आउटलेट वाई के आकार चैनलों के साथ प्रवाह कक्षों का उपयोग करें.
  5. तैयार रूपरेखा के साथ कट, सीधे, साफ कटौती करने के चैनल में कोई चिपकने वाला protrudes सुनिश्चित करें.
  6. साफ़ क्वार्ट्ज अच्छी तरह का उपयोग एसीटोन या इथेनॉल पिछले प्रवाह कक्ष के निर्माण से चिपकने वाला हटाने.
  7. चैनल रूपरेखा का सबसे अच्छा संरेखण का पता लगाएं, चिपकने वाला समर्थन के एक तरफ हटा और ध्यान क्वार्ट्ज स्लाइड पर टेप की जगह है. टेप ठीक से संरेखित करने के लिए सावधान रहो, Inlet और आउटलेट के रूप में छेद करने के लिए unblocked रहने की जरूरत है.
  8. इनलेट और प्रवाह सेल के आउटलेट के लिए टयूबिंग की लंबाई कट. यह मदद करता है के बारे में एक 30 डिग्री कोण पर ट्यूब के अंत में कटौती इतना है कि ट्यूब चैम्बर नीचे के फ्लैट के खिलाफ प्रेस नहीं होगा. (जैसे ट्यूब रैक) का समर्थन करने के लिए उन्हें अगले चरणों में प्रवाह सेल करने के लिए आसान लगाव के लिए निलंबित के कुछ प्रकार पर ट्यूबों रखें.
  9. Streptavidin-लेपित coverslip अच्छी तरह से पानी से कुल्ला संपीड़ित हवा का उपयोग कर शुष्क. याद रखें कि केवल एक पक्ष functionalized है. टेप समर्थन के दूसरे पक्ष निकालें और coverslip पर क्वार्ट्ज स्लाइड जगह.
  10. हल्के coverslip पर प्रेस करने के लिए बाहर किसी भी चिपकने में फंस हवा धक्का. यह किसी भी हवाई बुलबुले के प्रवाह चैनल में हो रही से बचने में मदद मिलेगी.
  11. Epoxy के साथ कक्ष के पक्ष सील. क्वार्ट्ज और epoxy के साथ जगह में सील के छेद में कटौती टयूबिंग डालें. यह कुछ मिनट के लिए शुष्क करने की जरूरत है.
  12. एक बार सूखा, degassed अवरुद्ध बफर की ट्यूबों के माध्यम से कुछ खींच द्वारा सतह को अवरुद्ध शुरू. एक 21 गेज सुई 0.76 मिमी टयूबिंग के अंदर पूरी तरह से फिट बैठता है. कुछ समय बाहर फ्लश करने के लिए हवाई बुलबुले को दूर करने के लिए, और चैम्बर कम से कम आधे घंटे के लिए सेते करने के लिए अनुमति देते हैं.

5. एकल अणु प्रतिकृति प्रयोग

एक बार डीएनए टेम्पलेट और functionalized मोती तैयार किया गया है, और प्रवाह कक्ष के लिए तैयार है, एक एकल अणु प्रयोग किया जा सकता है.

तैयार प्रवाह चैम्बर, अवरुद्ध बफर (5X:: 20 मिमी Tris - एचसीएल 7.5 पीएच, 2 मिमी EDTA, 50 मिमी NaCl, 1 मिलीग्राम / एमएल BSA, 0.025 बीच 20%) सामग्री, कार्य बफर (1X: 20 मिमी Tris - एचसीएल पीएच 7.5, 2 मिमी EDTA, 50 मिमी NaCl), T7 प्रतिकृति buffers के साथ या बिना MgCl 10mm 2 (1X: 40 मिमी Tris - एचसीएल 7.5 पीएच, 50 मिमी कश्मीर ग्लूटामेट, 2 मिमी EDTA, 100 μg / एमएल BSA, 10 मिमी डीटीटी, 600 सुक्ष्ममापी) dNTPs, प्रतिकृति प्रोटीन, 10X उद्देश्य, सीसीडी कैमरा, दुर्लभ पृथ्वी स्थायी चुंबक, सिरिंज पंप, airspring, फाइबर प्रकाशक छवि अधिग्रहण सॉफ्टवेयर के साथ कंप्यूटर के साथ औंधा ऑप्टिकल माइक्रोस्कोप.

  1. प्रवाह सेल के बाद अवरुद्ध किया गया है, यह प्रयोग शुरू करने के लिए तैयार है.
  2. प्रवाह सेल ले लो और यह खुर्दबीन मंच पर जगह है. चरण क्लिप के साथ जगह में चैम्बर पकड़ोऔर यकीन है कि प्रवाह चैनल सीसीडी कैमरे के साथ संरेखण में तैनात है.
  3. एक बड़ा व्यास संबंधक टयूबिंग या एक सुई का उपयोग कर airspring के लिए प्रवाह सेल आउटलेट ट्यूबों कनेक्ट. airspring किसी भी प्रवाह अनियमितताओं को स्थिर करने के लिए प्रयोग किया जाता है. एक 50 मिलीलीटर की प्लास्टिक की ट्यूब पानी के 45ml से भरा है. epoxy के साथ ट्यूब का ढक्कन बंद है. तीन छेद ढक्कन में छेदा कर रहे हैं, और टयूबिंग के तीन टुकड़े ट्यूब में डाला जाता है. Epoxy, ट्यूबों का प्रयोग तो ढकने के लिए सील कर रहे हैं, में प्रवेश करने या भागने से किसी भी हवा को रोकने. airspring सिरिंज पंप, और प्रवाह सेल की दुकान ट्यूबों के लिए जुड़ा हुआ है.
  4. बफर को रोकने में प्रवाह सेल के इनलेट ट्यूबों प्लेस और ट्यूब में किसी भी हवा निकाल सिरिंज पर वापस खींच. आउटलेट ट्यूब के एक सज्जन झटका किसी भी हवा के प्रवाह कक्ष में फंस बुलबुले स्पष्ट में मदद मिलेगी.
  5. एक बार सभी हवाई बुलबुले हटा दिया गया है, एक सुई के साथ प्रवेश ट्यूबों के एक है, और यह 1800 द्वारा झुकने और चिपकने वाला टेप के साथ ट्यूब हासिल करके दुकान ट्यूबों के एक ब्लॉक.
  6. Degassed अवरुद्ध बफर के 1 मिलीलीटर में 10 बजे तक शेयर डीएनए टेम्पलेट पतला. उदारवादी प्रवाह दर पर चैम्बर में प्रवाह करने के लिए डीएनए (0.01-0.05 / मिलीलीटर मिनट 20 मिनट के लिए अच्छी तरह से काम करता है) का अच्छा सतह कवरेज की अनुमति. कितने coverslips के प्रत्येक बैच के लिए डीएनए अणु सतह पर हैं या कितने प्रयोग के लिए वांछित हैं पर आधारित विभिन्न जा सकता है.
  7. शेयर 2-4x10 6 मोती / degassed अवरुद्ध बफर के 1 मिलीलीटर में मिलीलीटर मनका समाधान पतला. चेंबर में 0.01-0.05 मिलीलीटर / 15 मिनट के लिए मिनट पर प्रवाह.
  8. एक बार मोती जोड़ रहे हैं, प्रवाह बंद और चैम्बर संतुलन तक पहुँचने के लिए अनुमति देते हैं. फिर दोनों आउटलेट ट्यूबों बंद करें. चैम्बर के बिना ट्यूबों के लिए कोई भी परिवर्तन बंद दबाव उतार चढ़ाव है कि माला और सीमित डीएनए अणुओं कतरनी पर एक मजबूत ताकत लागू होगा कारण होगा.
  9. ब्लॉक इनलेट ट्यूब कि एक सुई के साथ मोती लोड करने के लिए इस्तेमाल किया गया था, और प्रवाह degassed अवरुद्ध बफर के 1X समाधान के साथ काम बफर में दूसरा प्रवेश का उपयोग सेल धोने शुरू करते हैं. 0.01-0.05 मिलीलीटर / मिनट की दर पर बड़े पैमाने पर धो लें. मैन्युअल रूप से किसी भी nonspecifically सतह (करने के लिए अटक मोती निकालने के दोहन द्वारा चरण के आंदोलन का दोहन).
  10. एक बार मुक्त मोती पर्याप्त हटा रहे हैं, प्रवाह बंद और चैम्बर संतुलन तक पहुँचने के लिए अनुमति देते हैं. खुले आउटलेट ट्यूब बंद करें और प्रोटीन समाधान के लिए इनलेट जलाशय स्विच करने के लिए, धीरे धीरे आउटलेट खोलने के लिए तेजी से दबाव में परिवर्तन से बचने
  11. तुम अगर मोती प्रवाह की दिशा (बदलकर डीएनए के लिए सीमित कर रहे हैं जाँच कर सकते हैं डीएनए ).
  12. अब, enzymatic प्रतिक्रिया किया जा सकता है. भूग्रस्त अग्रणी संश्लेषण प्रयोगों gp4 helicase और degassed T7 प्रतिकृति बफर कि MgCl 2 शामिल नहीं करता है (अपने processivity कारक thioredoxin के साथ एक जटिल के रूप में शुद्ध) में gp5 पोलीमरेज़ के 20nm समाधान के 20nm समाधान बनाते हैं .
  13. चेंबर में उदारवादी प्रवाह की दर में प्रोटीन समाधान के लिए डीएनए के लिए कुशल बाध्यकारी की अनुमति फ्लो. हम 8 मिनट के लिए 0.037 मिलीग्राम / मिनट का उपयोग करें, और तब .012 / मिलीलीटर 7 मिनट के लिए मिनट.
  14. 2 MgCl बिना degassed T7 प्रतिकृति बफर के साथ चैम्बर धो करने के लिए स्वतंत्र प्रोटीन को हटाने के लिए. .037 / एमएल 3-10 मिनट के लिए मिनट की दर ठीक काम करता है.
  15. धोने के बाद, MgCl 2 के साथ प्रवाह T7 प्रतिकृति बफर और डाटा अधिग्रहण शुरू . 0.012 मिलीलीटर / 3 PN खींचें बल इस प्रोटोकॉल में वर्णित शर्तों के तहत डीएनए tethers पर इसी मिनट की एक प्रवाह दर का उपयोग करें.
  16. पहले इमेजिंग माला और सतह के बीच nonspecific बातचीत को रोकने के लिए प्रवाह कक्ष के ऊपर एक दुर्लभ पृथ्वी स्थायी चुंबक प्लेस.
  17. एक 10X उद्देश्य और सीसीडी कैमरा के साथ क्षेत्र देखें. एक सीमित मनका का उपयोग ध्यान दें.
  18. 10 डिग्री और खुर्दबीन के पास खुर्दबीन चरण के लिए समानांतर के बीच एक घटना के कोण पर एक फाइबर प्रकाशक स्थिति. अंधेरे क्षेत्र रोशनी मनका इमेजिंग के विपरीत बढ़ाने के लिए प्रयोग किया जाता है.
  19. एक धीमी फ्रेम दर (आमतौर पर 2-4 हर्ट्ज) में 20 30 मिनट के लिए डेटा मोल.

6. प्रतिनिधि परिणाम

एक सफल प्रयोग में आप एक साथ 100 से अधिक मोती निरीक्षण (सक्षम होना चाहिए अग्रणी कतरा संश्लेषण) . प्रयोग के कई निशान अग्रणी कतरा डीएनए संश्लेषण प्रदर्शित उपज चाहिए.

डेटा विश्लेषण:

आदेश में दरों और unwinding के डीएनए और polymerization के processivities उपाय करने के लिए, मोतियों की सटीक स्थान निर्धारित होना चाहिए. आप इसे 2 आयामी गाऊसी कार्यों के साथ इन पदों फिटिंग द्वारा प्राप्त कर सकते हैं. Trajectories तब ट्रैकिंग प्रत्येक ट्रैकिंग सॉफ़्टवेयर (जैसे DiaTrack) का उपयोग कर फ्रेम में मनका स्थिति से निकाला जा सकता है. अब आप समय के एक समारोह के रूप में मनका स्थिति की साजिश रचने के किसी भी ताकि ग्राफ़िक का उपयोग करके trajectories कल्पना करने के लिए तैयार हैंftware (जैसे उत्पत्ति). दर डेटा प्राप्त करने के लिए, एक रेखीय प्रतिगमन के साथ भूखंडों फिट और ढलान की गणना. Processivity के लिए, शुरू से डीएनए के लिए एक छोटा घटना (चित्रा 3) के अंत की कुल लंबाई निर्धारित. इन नंबरों के दोनों basepairs करने के लिए परिवर्तित किया जा आवश्यकता होगी. Basepairs के लिए मनका आंदोलन में परिवर्तित करने के लिए, पहले आप प्रतिक्रिया प्रवाह की दर में एक बढ़ाकर λ डीएनए अणु की लंबाई को मापने की जरूरत है. Λ डीएनए की लंबाई के बाद से जाना जाता है (48,502 बीपी) आप प्रयोगात्मक बल पर बेस जोड़े / पिक्सेल की संख्या जांचना कर सकते हैं. वृद्धि सटीकता के लिए, एक मनका पगहा कि enzymatically बदल नहीं है एक आधारभूत ट्रेस हित के निशान से घटाना. सभी एकल माप और साजिश की दर और processivity वितरण का मिश्रण. गाऊसी और एकल घातीय कार्यों, क्रमशः (चित्रा 3) का उपयोग कर डेटा फ़िट.

चित्रा 1
चित्रा 1 एकल अणु प्रयोगात्मक सेटअप. (क) द्वैध λ डीएनए (48.5 केबी) 5 के माध्यम से प्रवाह सेल की सतह के लिए संलग्न है एक कतरा बायोटिन-streptavidin बातचीत का उपयोग कर के अंत, और 3 'एक ही कतरा के अंत में एक मनका से जुड़ा हुआ है एक का उपयोग कर digoxigenin बातचीत विरोधी - digoxigenin. एक primed प्रतिकृति कांटा मनका विपरीत अंत में बनाई है पोलीमरेज़ की लोडिंग की अनुमति है. (ख) मनका - डीएनए विधानसभाओं लामिना का प्रवाह के बफर का उपयोग कर फैला रहे हैं और व्यापक क्षेत्र ऑप्टिकल माइक्रोस्कोपी का उपयोग imaged. समय पर मोतियों की स्थिति पर नज़र रखने, जबकि एक निरंतर खींच बल को बनाए रखने, डीएनए constructs की लंबाई पर नजर रखी जा सकता है. (ग) विस्तार ssDNA का प्रोफ़ाइल (भरा सर्कल) और dsDNA कम बलों के तहत (खुला सर्कल). डैश्ड रेखा crystallographic पूरी तरह से डी एस λ डीएनए की लंबाई 16.3 सुक्ष्ममापी से पता चलता है. ssDNA और dsDNA के बीच 3 PN आसपास बलों पर लंबाई में बड़े अंतर डीएनए लंबाई में निगरानी परिवर्तन के द्वारा एस एस - और dsDNA के बीच एक रूपांतरणों की प्रत्यक्ष अवलोकन की अनुमति देता है. डीएनए युग्मित मोतियों की बड़ी संख्या के साथ - साथ दृश्य एक प्रयोग में कई व्यक्ति replisomes के अध्ययन के लिए अनुमति देता है.

चित्रा 2
चित्रा 2 जीवाणुभोजी T7 प्रतिकृति प्रोटीन: डीएनए पोलीमरेज़ (gp5 और thioredoxin के जटिल) और डीएनए helicase (gp4) deoxyribonucleotides और मैग्नीशियम की उपस्थिति में डीएनए अग्रणी कतरा synthesize. इस प्रक्रिया डीएनए ठंड coiling के लिए कारण कतरा छोटा के साथ है. DsDNA का मनका के ssDNA परिवर्तन की स्थिति में रूपांतरण. मनका की स्थिति को मापने और डीएनए प्रतिकृति की दर processivity के सटीक निर्धारण की अनुमति देता है.

चित्रा 3
चित्रा 3 एक एकल अणु अग्रणी भूग्रस्त संश्लेषण प्रयोग से विशिष्ट डेटा का उदाहरण है . डीएनए प्रतिकृति के Processivity शुरू से डीएनए के लिए एक छोटा घटना के अंत की कुल लंबाई के बराबर है. डीएनए प्रतिकृति की दर एक रेखीय प्रतिगमन के साथ साजिश फिटिंग और ढलान की गणना के द्वारा प्राप्त की है. इनसेट से पता चलता है दर और processivity वितरण कि माप के एक नंबर से डेटा संयोजन के द्वारा प्राप्त किया गया. डेटा गाऊसी और एकल घातीय कार्यों का उपयोग कर, क्रमशः से सज्जित थे.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

यह सुनिश्चित करना महत्वपूर्ण है कि खींचें लामिना का प्रवाह द्वारा मनकों पर exerted बल प्रतिकृति प्रोटीन के enzymatic गतिविधियों को प्रभावित नहीं करता है है. उदाहरण के लिए, एक 3 PN शक्ति है कि 0.012 मिलीग्राम / मिनट की एक प्रवाह की दर से मेल खाती अग्रणी कतरा डीएनए की प्रतिकृति को प्रभावित नहीं करता है. लेकिन यह enzymatic गतिविधियों है कि समन्वित डीएनए संश्लेषण के दौरान जगह लेने को प्रभावित करता है, और यह इसलिए PN 1.5 करने के लिए कम हो गया है. खींचें बल आसानी से प्रवाह की दर या प्रवाह 5 चैनल की चौड़ाई बदलने के द्वारा नियंत्रित किया जा सकता है.

परख खींच डीएनए डबल और एकल असहाय डीएनए के बीच लंबाई मतभेद कार्यरत हैं. प्रयोग में यहाँ वर्णित ssDNA dsDNA के रूपांतरण प्रमुख कतरा संश्लेषण (चित्रा 2) का एक परिणाम के के रूप में होता है. आपको याद रखना चाहिए कि ssDNA 6 PN नीचे कम खींच बलों (चित्रा 1) पर dsDNA की तुलना में कम ही है.

इस पद्धति का एक संभावित सुधार के लिए अपनी 3'-अंत करने के लिए एक दूसरे मनका संलग्न द्वारा प्रतिकृति टेम्पलेट की ठंड कतरा को संशोधित है. इस तरह के प्रत्यावर्तन enzymatic गतिविधियों है कि डीएनए के दोनों किस्में पर जगह लेने के प्रत्यक्ष अवलोकन की अनुमति होगी.

अग्रणी कतरा संश्लेषण और समन्वित प्रतिकृति के अध्ययन के अलावा, परख खींच डीएनए सफलतापूर्वक किया गया है 5,6 प्रतिकृति के दौरान λ exonuclease के एकल अणु कैनेटीक्स, और पोलीमरेज़ मुद्रा की गतिशीलता की जांच करने के लिए नियोजित. सिद्धांत रूप में, इस विधि के लिए किसी भी डीएनए प्रसंस्करण एंजाइम का अध्ययन किया जा सकता.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

परख खींच डीएनए के विकास पॉल Blainey, जोंग - बोंग ली, और समीर हमदान द्वारा सहायता प्राप्त किया गया था. यह काम राष्ट्रीय स्वास्थ्य अनुदान के चार्ल्स (GM54397) रिचर्डसन, और एंटोनी वैन Oijen (GM077248) संस्थान के द्वारा समर्थित है.

Materials

Name Company Catalog Number Comments
Bacteriophage λ DNA New England Biolabs N3011L
DNA Oligonucleotides Integrated DNA Technologies
T4 DNA Ligase New England Biolabs M0202L
T4 Polynucleotide Kinase New England Biolabs M0201L
α-digoxigenin Fab Roche Group 11214667001
Tosyl Activated Beads Invitrogen 142-03
Magnetic Separator Invitrogen Dynal MPC
3-aminopropyl-triethoxysilane Sigma-Aldrich A3648 Other aminosilanes can be used or mixed with non-amine reactive silanes for sparser surfaces
Succinimidyl propionate PEG Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Biotin-PEG-NHS Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Double-sided tape Grace Bio-Lab Inc. SA-S-1L 100 μm thickness
Quartz slide Technical Glass 20 mm (W)x 50 mm (L)x 1mm (H) Size to fit on coverslips. Drill holes with diamond-tip drill bits (DiamondBurs.net)
Polyethylene tubing BD Biosciences 427416 0.76 mm ID, 1.22 OD
Other size tubing can be substituted.
Streptavidin Sigma-Aldrich S4762 Make 1 mg/mL solution, 25 μL aliquots in PBS pH 7.3
Deoxyribonucleotide triphosphate solution mix New England Biolabs N0447
Inverted Optical Microscope with 10X Objective Olympus Corporation Olympus IX-51
Permament rare-earth magnet National Imports www.rare-earth-magnets.com
CCD Camera QImaging Rolera-XR Fast 139
Syringe Pump Harvard Apparatus 11 Plus Operate in refill mode to facilitate solution changes
Fiber Illuminator Thorlabs Inc. OSL1

DOWNLOAD MATERIALS LIST

References

  1. Lee, J. B. DNA primase acts as a molecular brake in DNA replication. Nature. 439, 621-624 (2006).
  2. Tanner, N. A., van Oijen, A. M. Single-molecule observation of prokaryotic DNA replication. Methods Mol Biol. 521, 397-410 (2009).
  3. Sofia, S. J., Premnath, V. V., Merrill, E. W. Poly(ethylene oxide) Grafted to Silicon Surfaces: Grafting Density and Protein Adsorption. Macromolecules. 31, 5059-5070 (1998).
  4. Tanner, N. A., Loparo, J. J., van Oijen, A. M. Visualizing single-molecule DNA replication with fluorescence microscopy. J Vis Exp. (2009).
  5. Hamdan, S. M., Loparo, J. J., Takahashi, M., Richardson, C. C., van Oijen, A. M. Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis. Nature. 457, 336-339 (2009).
  6. van Oijen, A. M. Single-molecule kinetics of lambda exonuclease reveal base dependence and dynamic disorder. Science. 301, 1235-1238 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics