Прямое наблюдение Ферменты Репликация ДНК Использование одиночных молекул ДНК Растяжка Пробирной

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Мы опишем метод для наблюдения реального времени репликации отдельных молекул ДНК посредничестве белков системы репликации бактериофагов.

Cite this Article

Copy Citation | Download Citations

Kulczyk, A. W., Tanner, N. A., Loparo, J. J., Richardson, C. C., van Oijen, A. M. Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay. J. Vis. Exp. (37), e1689, doi:10.3791/1689 (2010).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Мы опишем метод для наблюдения реального времени репликации отдельных молекул ДНК посредничестве белков системы репликации бактериофагов. Линеаризованные λ ДНК модифицируется, чтобы биотина на конце одной цепи, и дигоксигенин фрагмент на другом конце той же цепи. Биотинилированного конец крепится к функционализированных покровного стекла и digoxigeninated конец небольшой шарик. Сборка этих ДНК-бусинка тросов на поверхности проточной ячейке позволяет ламинарного течения, которые должны применяться приложить силы сопротивления на шарик. В результате ДНК растягивается вблизи и параллельно поверхности покровного на силу, которая определяется по скорости потока (рис. 1). Длина ДНК измеряется мониторинга положение валика. Длина различия между одно-и двухцепочечной ДНК используются для получения информации в реальном времени от активности белков репликации на вилку. Измерение положения шарик позволяет точно определить ставки и processivities ДНК размотки и полимеризации (рис. 2).

Protocol

1. Шаблон репликации ДНК

ДНК для реакции линеаризованной ДНК λ изменены отжига олигонуклеотиды для формирования репликации вилкой. Кроме того, биотин прикрепляется к концу одной нити ДНК λ, и дигоксигенин фрагмент присоединен к другому концу той же цепи 1.

Материалы: Бактериофаг λ ДНК, олигонуклеотиды: биотинилированного руку вилку (: 5'-биотин-AAAAAAAAAAAAAAAAGAGTACTGTACGATCTAGCATCAATCACAGGGTCAGGTTCGTTATTGTCCAACTTGCTGTCC-3 '), λ-дополнительных вилкой руку (B: 5'-GGGCGGCGACCTGGACAGCAAGTTG GACAATCTCGTTCTATCACTAATTCACTAATGCAGGGAGGATTTCAGATATGGCA-3'), вилка праймера (C: 5 ' -TGCCATATCTGAAATCCTCCCTGC-3 '), λ-дополнительных дигоксигенин конца (D: 5'-AGGTCG CCGCCCAAAAAAAAAAAA-дигоксигенин-3'), T4 ДНК-лигазы, T4 полинуклеотидкиназы, тепло блока.

  1. Фосфорилировать концы 5 'олигонуклеотидов B и D использованием Т4 полинуклеотидкиназы.
  2. Отжиг олигонуклеотиды, В и С до λ ДНК в один шаг, добавив 10-кратного избытка олигонуклеотидов и В, а 100-кратного избытка олигонуклеотидных С в буфере T4 ДНК-лигазы.
  3. Нагрейте смесь до 65 ° С в тепло блока. Как только нагревается, включить отопление блокируют и позволяют медленного охлаждения правильно отжига олигонуклеотиды.
  4. Добавить T4 ДНК-лигазы к смеси и инкубировать при комнатной температуре в течение 2 часов. T4 ДНК-лигазы станет катализатором для правильного присоединения олигонуклеотидов и В, а λ ДНК.
  5. Наконец, отжиг олигонуклеотидных D в шаблон репликации ДНК, добавив 100-кратного избытка олигонуклеотидных D по отношению к л ДНК в буфере T4 ДНК-лигазы.
  6. Выдержите смесь при 45 ° С в течение 30 мин в тепло блок, и охладить до комнатной температуры медленно, поворачивая тепла блокируют.
  7. Окончательный шаблон репликации ДНК, в настоящее время готова к использованию. Мы сохраняем шаблон в концентрации 1,4 Нм при 4 ° С в течение нескольких недель.

2. Бисер

Бисер являются функциональными с Fab фрагмент с специфичность дигоксигенин. Они могут быть затем прикрепляется к шаблону 2 репликации ДНК.

Материалы: тозил активированный бусы, α-дигоксигенин Fab фрагмент, Буфер: 0,1 М H3BO3 рН 9,5, буфер B: 0,1 М PBS рН 7,4, 0,1% мас. / BSA, Буфер C: 0,2 М Трис-HCl рН 8,5 (25 ° С), 0,1% мас. / BSA, магнитный сепаратор, Rotator.

  1. Ресуспендируют маточного раствора из бисера и передачи небольших аликвоту в пробирку Эппендорф. Поместите пробирку в слот магнитный сепаратор и инкубировать до решения очищается, а затем удалить супернатант пипетки.
  2. Добавить буфера, который будет активировать тозил группы для антител связи. Осторожно перемешать с помощью пипетки и удалить буфер с магнитным сепаратором.
  3. Добавить фрагмента Fab и ресуспендируйте бисера снова в буфер, тщательно перемешать и инкубировать 16-24 часов при температуре 37 ° С с использованием ротатора. После инкубации отдельных бусин с помощью магнитного сепаратора и удаления буфера.
  4. Вымойте бисером, добавив B буфера и инкубировать при температуре 4 ° С в течение 5 мин. Удалить буфера с помощью магнитного сепаратора. Промыть их в два раза.
  5. Добавить буфера C и инкубировать при 37 ° С в течение 4 часов, чтобы блокировать свободные тозил групп. Отдельные бусины с использованием магнитного сепаратора и удаления буфера.
  6. Мыть два раза в B буфера и аликвоты для использования. Бисер можно хранить при температуре 4 ° С в течение 1 года и более без существенной потери качества (наш исходный раствор содержит 1 - 2x10 9 бусин / мл).

3. Функциональные Покровные

Чтобы разрешить прикрепления ДНК к стеклу покровное, стекло первой функционализированных аминосиланом, который затем связан с биотинилированного молекул ПЭГ. Это покрытие помогает уменьшить неспецифические взаимодействия ДНК и репликацию белков с поверхностью 3,4.

Материалы: стекло покровные, Окрашивание банки, 3-аминопропилтриэтоксисилана, метокси-PEG5k-NHS сложный эфир, биотин-PEG5k-NHSester, ацетон, 1М КОН, этанол, духовка, ванны sonicator

  1. Тщательно очистить стекла покровные, помещая их в банки и окрашивание заполнения банки с этанолом. Разрушать ультразвуком в течение 30 минут, промыть банки и залить 1 М КОН. Повторите оба стирок.
  2. Для первой реакции функционализации, все следы воды должны быть удалены. Заполнить банки с ацетоном и разрушать ультразвуком в течение 10 мин. Пустые и залейте еще раз с помощью ацетона.
  3. Подготовка 2% об. / решение силана реагента в ацетоне. Добавить в окрашивании банки и агитировать за 2 минуты. Эта реакция пары алкокси группа аминосиланом к стеклу, оставляя реактивную амин для следующего шага связи. Quench реакции с большим избытком воды.
  4. Сухие покровные по выпечке их на 110 °; С в духовке в течение 30 минут.
  5. Подготовка 50:1 метокси: биотин PEG смеси в 100 мМ NaHCO 3 рН 8,2. Стремитесь к примерно 0,2% мас. / биотинилированного ПЭГ.
  6. Внесите 100 мкл смеси ПЭГ на сухую silanized покровное и место другое покровное на вершине. В том числе прокладку стекло покровное позволит разделение покровные.
  7. Инкубируйте покровных в решении PEG на 3 часа, затем отделить каждую пару покровные и мыть широко водой. Будьте осторожны, чтобы сохранить покровные функционализированных стороной вверх, как только один раз из сторон будет покрыта ПЭГ.
  8. Сухие покровные с воздухом и сохранить под вакуумом в эксикаторе. Поверхности остается стабильным в течение по крайней мере месяц, так что десятки покровные могут быть сделаны в партии и используются по мере необходимости.

4. Подготовка потока палаты

Эксперимент проводится с помощью простой камеры поток, построенный с функциональными покровное, двусторонняя лента, кварц слайдов и трубопроводов. Один поток камера готова к каждой отдельной молекулы эксперимента 2,4.

Материалы: Двусторонняя лента, лезвие бритвы, кварц слайд с отверстиями для шлангов, быстрый сухой эпоксидные, функционализированных покровное, стрептавидина решение (25 мкл 1 мг / мл в PBS), труб, блокирующим буфером (5X: 20 мМ Трис рН 7,5, 2 мМ EDTA, 50 мМ NaCl, 0,2 мг / мл BSA, 0,005% Твин-20), рабочий буфер (1X: 20 мМ Трис-HCl рН 7,5, 2 мМ EDTA, 50 мМ NaCl).

  1. Начните путем смешивания и размещение 5 мл блокирующего буфера и 20 мл рабочего буфера в эксикаторе, чтобы удалить пузырьки воздуха для последующего шага.
  2. Возьмите PEG-функционализированных покровное и распространение 125 из PBS-разбавленный стрептавидин решение по поверхности. Оставьте это для инкубации в течение 20 минут при комнатной температуре, при подготовке других частях камеры, что позволяет стрептавидин для связывания поверхности biotins.
  3. Отрежьте кусок двухсторонней ленты, чтобы соответствовать размеру кварцевых слайда. Отметьте положение трубки отверстий на ленте, так что контур потока камера может быть обращено на ленту.
  4. Сделайте 3 мм широкий центральный канал и прямоугольники, содержащие как отверстия. Мы используем поток камеры с двумя входными и два выпускных У-образный каналов.
  5. Вырезать по обращено наброски, делая прямые, чистые пропилы, чтобы убедиться, нет клея выступает в канал.
  6. Чистый кварц тщательно с использованием ацетона или этанола, чтобы удалить клей от предыдущей конструкции ячейки потока.
  7. Найти лучшее выравнивание канала контур, удалить одну сторону клеем поддержки и осторожно поместите ленту на кварц слайда. Будьте осторожны, чтобы выровнять ленты должным образом, как входное и выходное отверстия должны оставаться разблокированы.
  8. Листы из трубки для входа и выхода потока клетки. Это помогает сократить конец трубки примерно на 30 градусов так, чтобы трубка не будет давить квартира против дно камеры. Место трубы на какой-то поддержки (стойки, например, трубы), чтобы приостановить их для легкого крепления к проточной ячейки в следующих шагах.
  9. Промыть покрытых стрептавидином покровное тщательно промыть водой и сухим сжатым воздухом. Помните, что только одна сторона функциональными. Удалите другой стороне ленты поддержки и место кварца слайд на покровное.
  10. Слегка нажмите на покровное выдвинуть какие-либо воздух, находящийся в клей. Это поможет избежать воздушных пузырей попасть в поток канала.
  11. Печать стороны камеры с эпоксидной смолой. Вставьте вырезать трубки в отверстия кварца и уплотнение в месте с эпоксидной смолой. Это должно высохнуть в течение нескольких минут.
  12. После высыхания, начать блокирование поверхности, потянув некоторые из дегазированной блокирующего буфера через одну из труб. 21-иглы прекрасно вписывается в 0,76 мм трубы. Промойте несколько раз, чтобы удалить пузырьки воздуха, и позволяют камере для инкубации, по крайней мере полчаса.

5. Одиночных молекул репликации Эксперимент

Как только ДНК-матрицы и функциональных бисером были подготовлены, и поток камера готова, одной молекулы эксперимент может быть выполнен.

Материалы: Подготовлено камере поток, Блокировка буфера (5X: 20 мМ Трис-HCl, рН 7,5, 2 мМ EDTA, 50 мМ NaCl, 1 мг / мл BSA, 0,025% Твин-20), Рабочая буфером (1х: 20 мМ Трис-HCl рН 7,5, 2 мМ EDTA, 50 мМ NaCl), Т7 репликации буферов с или без 10 мМ MgCl 2 (1X: 40 мМ Трис-HCl, рН 7,5, 50 мМ К-глутамат, 2 мМ ЭДТА, 100 мкг / мл BSA, 10 мМ DTT, 600 мкМ дНТФ), репликация белков, перевернутый оптический микроскоп с 10X цель, CCD камеры, постоянных редкоземельных магнитов, шприцевой насос, airspring, волоконно-подсветки, компьютер с изображением приобретение программного обеспечения.

  1. После Проточная ячейка была заблокирована, она готова начать эксперимент.
  2. Возьмите проточной ячейки и поместить его на предметный столик микроскопа. Держите камеру в месте с этапа клипыи быть уверенным, что поток канал позиционируется в соответствие с ПЗС-камерой.
  3. Подключение трубок тока ячейки выход к airspring использованием большего диаметра трубки разъем или иглы. Airspring используется для стабилизации любой поток нарушений. 50 мл пластиковая трубка наполнена 45 мл воды. Крышку трубки герметизируется эпоксидной смолой. Три отверстия прокалываются в крышке, и три куска трубы вставляются в трубку. Использование эпоксидной смолы, трубы, то герметичность крышки, предотвращая любые попадания воздуха или убежать. Airspring подключен к шприцевой насос и выходе труб потоком клетке.
  4. Место входа трубы проточной ячейки в блокирующем буфере и отступить от шприца, чтобы удалить воздух в трубке. Нежным движением отводной трубки поможет очистить любые воздушные пузыри захваченных в проточной ячейке.
  5. После того как все воздушные пузырьки были удалены, блок одного из впускной трубы с иглой, и один из розетки трубы, скрутив ее к 1800 году и обеспечение трубки с помощью клейкой ленты.
  6. Развести шаблон фондовом ДНК до 10 часов вечера в 1 мл дегазированной блокирующем буфере. Поток в камере при умеренном расходе, чтобы хорошее покрытие поверхности ДНК (0,01-0,05 мл / мин в течение 20 минут работает хорошо). Это может быть изменена в зависимости от количества молекул ДНК на поверхности для каждой партии покровные или сколько желательны для эксперимента.
  7. Развести фондового борт решение 2-4x10 6 бусин / мл в 1 мл дегазированной блокирующем буфере. Поток в камере при 0,01-0,05 мл / мин в течение 15 минут.
  8. Как только бисер добавил, включите стекать и позволяют камере для достижения равновесия. Затем закройте обе розетки трубы. Любые изменения в трубах без камеры закрыты вызовет колебания давления, что будет оказывать сильное силу бисером и сдвига привязаны молекул ДНК.
  9. Блок впускная труба, которая была использована для загрузки бисер с иглы и начать мыть проточной ячейки используя второй вход с дегазированной 1X решение блокирующего буфера в рабочий буфер. Вымойте широко по курсу 0,01-0,05 мл / мин. Перемешайте вручную этапе нажмите, чтобы удалить любые бусины неспецифически прилипла к поверхности ( нажатии ).
  10. После освобождения бисер достаточно удалены, включите стекать и позволяют камере для достижения равновесия. Закройте открытые трубкой и переключиться входе резервуара в растворе белка, медленно открывая выход, чтобы избежать быстрого изменения давления
  11. Вы можете проверить, если бисером привязаны к ДНК, изменяя направление потока ( ДНК ).
  12. Теперь, ферментативной реакции может быть выполнена. Для ведущих нитей эксперименты синтеза делают 20 нм решения GP4 геликазы и 20 нм решения GP5 полимераза (очищенная, как комплекс с тиоредоксин фактор processivity) в дегазированной репликации T7 буфер, который не содержит MgCl 2.
  13. Поток раствора белка в камере при умеренном расходе чтобы позволить эффективное связывание с ДНК. Мы используем 0,037 мл / мин в течение 8 минут, а затем 0,012 мл / мин в течение 7 минут.
  14. Вымойте камеру с дегазированной репликации T7 буфера без MgCl 2, чтобы удалить свободные белки. Скорость 0,037 мл / мин в течение 3-10 минут работает отлично.
  15. После мытья, расход T7 репликации буфера с MgCl 2 и начать сбор данных. Используйте расход 0,012 мл / мин соответствует 3 пН сила сопротивления на ДНК тросов в условиях, описанных в этом протоколе.
  16. Место редкоземельный постоянный магнит над проточной ячейки до визуализации, чтобы предотвратить неспецифическое взаимодействие между бисером и поверхности.
  17. Посмотреть поле с 10X объективных и CCD камеры. Фокус использованием привязал шарик.
  18. Позиция волокна осветителя на угол падения от 10 градусов и параллельно столике микроскопа рядом с микроскопом. Темные поля освещенности используется для увеличения контрастности изображения шарик.
  19. Сбор данных для 20 30 мин при медленном частотой кадров (обычно 2-4 Гц).

6. Представитель Результаты

В успешном эксперименте вы должны иметь возможность наблюдать более 100 бусин одновременно ( ведущий синтеза нити ). Эксперимент должен дать многочисленные следы отображения ведущих синтеза ДНК.

Анализ данных:

Для того чтобы измерить ставок и processivities ДНК размотки и полимеризации, точные позиции бусин должны быть определены. Вы можете достичь этого путем установки этих позиций с 2-мерных функций Гаусса. Траектории могут быть извлечены путем отслеживания бусинка позиции на каждом каркасе с помощью отслеживания программного обеспечения (например DiaTrack). Теперь вы готовы для визуализации траектории, откладывая бусинка позицию в зависимости от времени, используя любой графический такftware (например, происхождение). Чтобы получить скорость передачи данных, пригодные участки с линейной регрессии и вычислить наклон. Для processivity, определять общая длина ДНК от начала и до конца сокращение события (рис. 3). Оба эти числа должны быть преобразованы в пар оснований. Для преобразования бусинка движение пар оснований, для начала вам необходимо измерить длину натянутой молекулы ДНК λ при расходе реакции. Так как длина ДНК λ известно (48 502 б.п.), вы можете откалибровать число пар оснований / пиксель при экспериментальном силу. Для повышения точности, вычесть из следов интереса базовых следов шарик троса, который не ферментативно изменены. Смешайте все единичных измерений и сюжет скорость и processivity дистрибутивов. Fit данных с использованием гауссовых и одной экспоненциальной функции, соответственно (рис. 3).

Рисунок 1
Рисунок 1. Одиночных молекул экспериментальной установки. (), Двусторонняя печать λ ДНК (48,5 кб) прикрепляется к поверхности проточной ячейки через 5 'конца одной нити использовании биотин-стрептавидин взаимодействия, а 3' конце того же прядь крепится к бусинка использованием дигоксигенин анти-дигоксигенин взаимодействия. Загрунтовать репликации вилка формируется на конце, противоположном шарик, чтобы загрузка полимеразы. (Б) Бусы-ДНК сборки растягиваются использованием ламинарного потока буфера и отображаемого использованием широкого поля оптической микроскопии. Отслеживая позиции бусин с течением времени, сохраняя при этом постоянное растяжение силы, длины ДНК-конструкции могут быть отслежены. (В) расширение профиля оцДНК (заполненный круг) и двухцепочечной ДНК (открытый круг) в условиях низких сил. Пунктирная линия показывает кристаллографических длина полностью DS-λ ДНК, 16,3 мкм. Большая разница в длине между одноцепочечной и двухцепочечной ДНК в силах около 3 пН позволяет прямое наблюдение преобразования между сс-и двухцепочечной ДНК, отслеживая изменения в ДНК длиной. Одновременная визуализация большого количества ДНК-связанных бисером позволяет для изучения многих отдельных replisomes в одном эксперименте.

Рисунок 2
Рисунок 2 бактериофага Т7 репликации белка. ДНК-полимеразы (комплекс GP5 и тиоредоксин) и ДНК геликазы (GP4) синтезировать ДНК ведущих прядь в присутствии дезоксирибонуклеотидов и магния. Этот процесс сопровождается сокращением ДНК отстающих прядь из-за намотки. Преобразование в дц оцДНК изменения положения шарика. Измерение положения шарик позволяет точно определить скорость и processivity репликации ДНК.

Рисунок 3
Рисунок 3. Пример типичной данных из одной молекулы ведущих нитей синтеза эксперимента. Processivity репликации ДНК равна общая длина ДНК от начала и до конца сокращение события. Скорость репликации ДНК получается путем подбора участка с линейной регрессии и расчета по склону. Вставка ставка шоу и processivity дистрибутивов, которые были получены путем объединения данных из числа измерений. Данные были установлены использованием гауссовой и одной экспоненциальной функции, соответственно.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Важно, чтобы гарантировать, что сила сопротивления, действующая на бисер по ламинарного потока не влияет на ферментативную деятельность репликации белков. Например, 3 пН сила, которая соответствует скорости потока 0,012 мл / мин не влияет на репликацию ДНК, ведущей нити. Она тем не менее влияют на ферментативную деятельность, которая состоится в ходе скоординированной синтеза ДНК, и поэтому она должна быть уменьшена до 1,5 PN. Сила сопротивления может быть легко регулируется путем изменения скорости потока или ширине потока канала 5.

ДНК-анализ использует растяжения длина различия между двух-и одноцепочечных ДНК. В эксперименте, описанном здесь преобразования двухцепочечной ДНК, чтобы оцДНК происходит в результате синтеза ведущей нити (рис. 2). Вы должны помнить, что оцДНК короче, чем дц только при низких растягивающих сил ниже 6 PN (рис. 1).

Возможного улучшения этого метода заключается в изменении отстающие нити репликации шаблон путем присоединения второго борта к ее 3'-конца. Такое чередование позволит непосредственное наблюдение ферментативной деятельности, которые имеют место в обеих цепей ДНК.

Помимо исследований ведущих синтеза нити и скоординированных репликации ДНК растяжение анализ был успешно применен для изучения отдельных молекул кинетики λ экзонуклеазная, и динамика обменного полимеразы при репликации 5,6. В принципе, этот метод может быть использован для изучения какой-либо фермента ДНК обработки.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Развитие ДНК растяжение анализа была сообщница, Пол Blainey, Чен Ли Бон, и Самир Хамдан. Эта работа проводится при поддержке Национального института здоровья гранты Чарльз Ричардсон (GM54397), и Антуан ван Oijen (GM077248).

Materials

Name Company Catalog Number Comments
Bacteriophage λ DNA New England Biolabs N3011L
DNA Oligonucleotides Integrated DNA Technologies
T4 DNA Ligase New England Biolabs M0202L
T4 Polynucleotide Kinase New England Biolabs M0201L
α-digoxigenin Fab Roche Group 11214667001
Tosyl Activated Beads Invitrogen 142-03
Magnetic Separator Invitrogen Dynal MPC
3-aminopropyl-triethoxysilane Sigma-Aldrich A3648 Other aminosilanes can be used or mixed with non-amine reactive silanes for sparser surfaces
Succinimidyl propionate PEG Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Biotin-PEG-NHS Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Double-sided tape Grace Bio-Lab Inc. SA-S-1L 100 μm thickness
Quartz slide Technical Glass 20 mm (W)x 50 mm (L)x 1mm (H) Size to fit on coverslips. Drill holes with diamond-tip drill bits (DiamondBurs.net)
Polyethylene tubing BD Biosciences 427416 0.76 mm ID, 1.22 OD
Other size tubing can be substituted.
Streptavidin Sigma-Aldrich S4762 Make 1 mg/mL solution, 25 μL aliquots in PBS pH 7.3
Deoxyribonucleotide triphosphate solution mix New England Biolabs N0447
Inverted Optical Microscope with 10X Objective Olympus Corporation Olympus IX-51
Permament rare-earth magnet National Imports www.rare-earth-magnets.com
CCD Camera QImaging Rolera-XR Fast 139
Syringe Pump Harvard Apparatus 11 Plus Operate in refill mode to facilitate solution changes
Fiber Illuminator Thorlabs Inc. OSL1

DOWNLOAD MATERIALS LIST

References

  1. Lee, J. B. DNA primase acts as a molecular brake in DNA replication. Nature. 439, 621-624 (2006).
  2. Tanner, N. A., van Oijen, A. M. Single-molecule observation of prokaryotic DNA replication. Methods Mol Biol. 521, 397-410 (2009).
  3. Sofia, S. J., Premnath, V. V., Merrill, E. W. Poly(ethylene oxide) Grafted to Silicon Surfaces: Grafting Density and Protein Adsorption. Macromolecules. 31, 5059-5070 (1998).
  4. Tanner, N. A., Loparo, J. J., van Oijen, A. M. Visualizing single-molecule DNA replication with fluorescence microscopy. J Vis Exp. (2009).
  5. Hamdan, S. M., Loparo, J. J., Takahashi, M., Richardson, C. C., van Oijen, A. M. Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis. Nature. 457, 336-339 (2009).
  6. van Oijen, A. M. Single-molecule kinetics of lambda exonuclease reveal base dependence and dynamic disorder. Science. 301, 1235-1238 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics