תצפית ישירה של ה-DNA אנזימים שכפול באמצעות DNA מולקולה בודדת מתיחה Assay

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

אנו מתארים שיטה התבוננות שכפול בזמן אמת של מולקולות דנ"א בודדות מתווכת על ידי חלבונים של מערכת שכפול bacteriophage.

Cite this Article

Copy Citation | Download Citations

Kulczyk, A. W., Tanner, N. A., Loparo, J. J., Richardson, C. C., van Oijen, A. M. Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay. J. Vis. Exp. (37), e1689, doi:10.3791/1689 (2010).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

אנו מתארים שיטה התבוננות שכפול בזמן אמת של מולקולות דנ"א בודדות מתווכת על ידי חלבונים של מערכת שכפול bacteriophage. לינארית λ-DNA הוא שונה יש ביוטין על קצה חוט אחד, מחצית digoxigenin בצד השני של גדיל אחד. סוף biotinylated מחובר coverslip כוס פונקציונליות לבין סוף digoxigeninated כדי חרוז קטן. הרכבה של אלה-DNA חרוז חבלים על פני השטח של התא זרימה מאפשר זרימה למינרית להיות מיושם להפעיל כוח לגרור על החרוז. כתוצאה מכך, ה-DNA הוא נמתח קרוב ובמקביל פני השטח של coverslip לעבר הכוח אשר נקבעת על ידי קצב הזרימה (איור 1). אורכו של ה-DNA נמדד על ידי ניטור את המיקום של החרוז. הבדלי אורך בין דנ"א יחיד ו פעמיים תקועים מנוצלים לקבל מידע בזמן אמת על פעילות החלבונים שכפול במזלג. מדידת המיקום של החרוז מאפשר קביעה מדויקת של שיעורי processivities של ה-DNA ואת ההתרה פילמור (איור 2).

Protocol

1. שכפול ה-DNA תבנית

DNA עבור התגובה הינה DNA λ לינארית שונה על ידי חישול של oligonucleotides להקים מזלג שכפול. בנוסף, ביוטין מצורף בסופו של גדיל אחד של הדנ"א λ, וכן מחצית digoxigenin מחוברת בקצה השני של הגדיל אותו 1.

חומרים: bacteriophage DNA λ, oligonucleotides: זרוע מזלג biotinylated (A: 5'-ביוטין-AAAAAAAAAAAAAAAAGAGTACTGTACGATCTAGCATCAATCACAGGGTCAGGTTCGTTATTGTCCAACTTGCTGTCC-3 "), λ-משלימים הזרוע מזלג (B: 5'-GGGCGGCGACCTGGACAGCAAGTTG GACAATCTCGTTCTATCACTAATTCACTAATGCAGGGAGGATTTCAGATATGGCA-3"), תחל מזלג (ג: 5 ' -TGCCATATCTGAAATCCTCCCTGC-3 "), λ-משלימים בסוף digoxigenin (D: 5'-AGGTCG CCGCCCAAAAAAAAAAAA-digoxigenin-3"), האנזים T4 DNA, קינאז polynucleotide T4, גוש חום.

  1. Phosphorylate מסיים את "5 של oligonucleotides B ו-D באמצעות קינאז Polynucleotide T4.
  2. לחשל oligonucleotides A, B ו-C ל-DNA λ בצעד אחד על ידי הוספת יתר של פי 10 של oligonucleotides A ו-B, וכן עודף של פי 100 של C oligonucleotide במאגר ה-DNA האנזים T4.
  3. מחממים את התערובת ל 65 ° C בבלוק חום. מחומם פעם, להפוך את חום לחסום את ולאפשר קירור איטי שצריך לחשל oligonucleotides.
  4. הוספת האנזים T4 DNA לתערובת ו דגירה בטמפרטורת החדר למשך 2 שעות. האנזים T4 DNA יהיה לזרז את הצטרפותה של הנכון oligonucleotides A ו-B, ו-DNA λ.
  5. לבסוף, לחשל הדי oligonucleotide לתבנית שכפול ה-DNA על ידי הוספת 100 פי עודף של D oligonucleotide ביחס DNA אני במאגר ה-DNA האנזים T4.
  6. דגירה את התערובת על 45 מעלות צלזיוס למשך 30 דקות בבלוק חום, להתקרר לטמפרטורת החדר לאט ידי הפיכת לחסום את החום.
  7. התבנית הסופית שכפול הדנ"א עכשיו הוא מוכן לשימוש. אנו מאחסנים את התבנית בריכוז של 1.4 nM על 4 מעלות צלזיוס למשך מספר שבועות.

2. חרוזים

חרוזים הם פונקציונליות עם שבר Fab עם סגוליות עבור digoxigenin. הם יכולים להיות מחוברים אז את 2 שכפול הדנ"א התבנית.

חומרים: חרוזים מופעל Tosyl, α-digoxigenin קטע Fab, הצפת: 0.1 M H3BO3 pH 9.5, הצפת B: 0.1 מ PBS pH 7.4, 0.1% w / v BSA, הצפת C: 0.2 M טריס-HCl pH 8.5 (25 ° ג), 0.1% w / v BSA, מפריד מגנטי, Rotator.

  1. Resuspend הפתרון המניות של חרוזים להעביר aliquot קטן לתוך הצינור Eppendorf. מניחים את הצינור לתוך החריץ של מפריד דגירה מגנטי עד פתרון מנקה, ולאחר מכן להסיר supernatant ידי pipetting.
  2. הוסף חוצץ, אשר יפעיל קבוצות tosyl עבור צימוד נוגדנים. מערבבים בעדינות על ידי pipetting ולהסיר עם חיץ מפריד מגנטי.
  3. הוספת קטע Fab וחרוזים resuspend שוב חיץ, ומערבבים היטב, ועל דגירה 16-24 שעות 37 ° C באמצעות המפרק. לאחר דגירה, חרוזים נפרדים באמצעות מפריד מגנטי להסיר חיץ.
  4. לשטוף חרוזים על ידי הוספת ב חיץ דגירה על 4 מעלות צלזיוס למשך 5 דקות. הסר את המאגר באמצעות מפריד מגנטי. חזור כביסה פעמיים.
  5. הוסף חוצץ C ו לדגור על 37 מעלות צלזיוס למשך 4 שעות כדי לחסום קבוצות tosyl חינם. חרוזים נפרדת באמצעות מפריד מגנטי להסיר חיץ.
  6. לשטוף פעמיים ב חיץ aliquot לשימוש. חרוזים יכול להיות מאוחסן על 4 מעלות צלזיוס במשך 1 שנה או יותר ללא איבוד משמעותי של איכות (פתרון המניות שלנו מכיל 1 - 2x10 9 חרוזים / ml).

3. פונקציונליות Coverslips

כדי לאפשר התקשרות של ה-DNA כדי coverslip הזכוכית, הזכוכית היא פונקציונליות הראשון עם aminosilane, אשר יחד ואז מולקולות PEG biotinylated. ציפוי זה עוזר להפחית את האינטראקציות ספציפי של דנ"א וחלבונים שכפול עם המשטח 3,4.

חומרים: coverslips זכוכית, צנצנות מכתים, 3-aminopropyltriethoxysilane, Methoxy-PEG5k-NHS אסתר, ביוטין, PEG5k-NHSester, אצטון, 1M KOH, אתנול תנור, sonicator Bath

  1. ניקיון יסודי של coverslips זכוכית על ידי הצבת אותם מכתים צנצנות ממלאים את הצנצנות עם אתנול. Sonicate במשך 30 דקות, לשטוף את הצנצנות מתמלאות 1 M KOH. חזור על שני שוטף.
  2. עבור התגובה functionalization הראשון, כל עקבות מים צורך להסיר. ממלאים את הצנצנות עם אצטון sonicate במשך 10 דקות. ריק ולמלא שוב עם אצטון.
  3. הכן 2% v / v פתרון של מגיב silane ב אצטון. הוסף את הצנצנות מכתים ו להתסיס במשך 2 דקות. תגובה זו זוגות הקבוצה alkoxy של aminosilane כדי זכוכית, משאיר אמין תגובתי לשלב הבא צימוד. להרוות את התגובה עם עודף גדול של מים.
  4. יבש coverslips ידי אפייה אותם 110 °; C בתנור במשך 30 דקות.
  5. הכן methoxy 50:1: תערובת ביוטין PEG ב 100 pH 8.2 mM NaHCO 3. כוון PEG w / v סביב 0.2% biotinylated.
  6. פיפטה 100 μL של התערובת PEG על coverslip מקום silanized יבש אחר coverslip על העליונה. כולל spacer coverslip זכוכית תאפשר הפרדת coverslips.
  7. דגירה coverslips בפתרון PEG במשך 3 שעות, ואז נפרד כל זוג coverslips בהרחבה ולשטוף עם מים. הקפד לשמור coverslips פונקציונליות כלפי מעלה כמו פעם רק צד יהיה מצופה PEG.
  8. יבש coverslips עם האוויר ולאחסן תחת ואקום ייבוש. משטחים להישאר יציב למשך חודש לפחות, כך עשרות coverslips ניתן לבצע אצווה בשימוש לפי הצורך.

4. לשכת תזרים הכנה

הניסוי מבוצע באמצעות תא זרימה פשוט בנוי עם coverslip פונקציונליות, פעמיים צדדי קלטת, שקופיות קוורץ צינורות. אחת קאמרית תזרים מוכן לניסוי מולקולה בודדת כל 2,4.

חומרים: פעמיים צדדי קלטת, סכין גילוח, שקופיות קוורץ עם חורים אפוקסי, מהיר יבש צינורות, coverslip פונקציונליות, פתרון streptavidin (25 μL של 1 מ"ג / מ"ל PBS), צינורות, חסימת חיץ (5X: 20 מ"מ טריס pH 7.5, 2 mM EDTA, 50 mM NaCl, 0.2 מ"ג / מ"ל ​​BSA, 0.005% Tween-20), מאגר עובדים (1X: 20 מ"מ טריס-HCl pH 7.5, 2 mM EDTA, 50 mM NaCl).

  1. בגין על ידי ערבוב הצבת 5 מ"ל של חיץ חסימה 20 מ"ל של עבודה חיץ ייבוש להסיר בועות אוויר עבור צעדים מאוחר יותר.
  2. קחו coverslip PEG-פונקציונליות ולהפיץ 125 של פתרון PBS-בדילול streptavidin על פני השטח. תשאיר את זה דגירה במשך 20 דקות בטמפרטורת החדר בעת הכנת חלקים אחרים של התא, ומאפשר streptavidin להיקשר biotins פני השטח.
  3. חותכים נייר דבק דו צדדית כדי להתאים את גודל השקופית קוורץ. סמן את המיקום של החורים בצינור בקלטת, כך מתאר של החדר תזרים ניתן להסיק בקלטת.
  4. הפוך את ערוץ 3 מ"מ רחב מרכז ומלבנים המכיל שני חורים. אנו משתמשים בתאי לזרום עם כניסת שתיים ועוד שתיים שקע בצורת האות V ערוצים.
  5. גזור לאורך קו המתאר נמשך, מה שהופך ישר, חתכים נקיים כדי לוודא שלא דבק הבולטת לתוך התעלה.
  6. נקו את אצטון ביסודיות באמצעות קוורץ או אתנול להסיר דבק מן הבנייה תזרים הקודם התא.
  7. מצא את ההיערכות הטובה ביותר המתאר את הערוץ, להסיר צד אחד של גיבוי דבק בזהירות במקום קלטת לשקופית קוורץ. היזהר ליישר את הקלטת כראוי, כמו החורים מפרצון ו לשקע צריכים להישאר חסומים.
  8. גזור אורכי צינורות עבור כניסת ו לשקע של התא זרימה. זה עוזר לחתוך את הקצה של הצינור על כ 30 ° זווית כך הצינור לא לחוצים אל תחתית החדר. מניחים את הצינורות על איזה תמיכה (למשל מתלים צינור) להשעות אותם מצורף קל התא זרימה בשלבים הבאים.
  9. שוטפים את coverslip streptavidin מצופים היטב במים ולייבש באמצעות אוויר דחוס. זכרו כי רק צד אחד הוא פונקציונליות. הסר את הצד השני של קלטת גיבוי במקום שקופיות קוורץ על coverslip.
  10. לחץ קלות על coverslip כדי לדחוף את כל האוויר שנלכד דבק. זה יעזור למנוע בועות אוויר להיכנס לערוץ הזרימה.
  11. חותם את הצדדים של החדר עם אפוקסי. הכנס את צינורות לחתוך לתוך החורים של קוורץ ו חותם במקום עם אפוקסי. זה צריך להתייבש במשך כמה דקות.
  12. יבש פעם, להתחיל לחסום את פני השטח על ידי משיכת חלק למאגר חסימת degassed דרך אחד הצינורות. מחט מד 21-מתאים באופן מושלם בתוך צינורות 0.76 מ"מ. פלאש כמה פעמים כדי להסיר בועות אוויר, ולאפשר החדר כדי לדגור במשך שעה לפחות חצי.

5. Single-מולקולה שכפול ניסוי

לאחר תבנית ה-DNA וחרוזים פונקציונליות הוכנו, ובית הנבחרים תזרים מוכן, בניסוי מולקולה בודדת יכולה להתבצע.

חומרים: תא תזרים הוכן, חסימת חיץ (5X: 20 מ"מ טריס-HCl pH 7.5, 2 mM EDTA, 50 mM NaCl, 1 מ"ג / מ"ל BSA, 0.025% Tween-20), מאגר עבודה (1X: 20 מ"מ טריס-HCl pH 7.5, 2 mM EDTA, 50 mM NaCl), חוצצי T7 שכפול, עם או בלי 10mm MgCl 2 (1X: 40 מ"מ טריס-HCl pH 7.5, 50 mM K-גלוטמט, 2 mM EDTA, 100 מיקרוגרם / מ"ל BSA, 10 mM DTT, dNTPs 600 מיקרומטר), חלבונים שכפול, מיקרוסקופ אופטי הפוכה במטרה 10X, מצלמת CCD, מגנט קבוע נדיר הארץ, משאבת מזרק, airspring, המאייר סיבים, מחשב עם תוכנת רכישת התמונה.

  1. לאחר התא זרימה נחסם, הוא מוכן להתחיל את הניסוי.
  2. קח את התא זרימה ולמקם אותו על הבמה מיקרוסקופ. החזק את תא במקום עם קליפים הבמהולהיות בטוח כי ערוץ זרימה ממוקם בקנה אחד עם מצלמה CCD.
  3. חבר את התא זרימה צינורות מוצא אל airspring באמצעות מחבר צינורות בקוטר גדול יותר או מחט. Airspring משמש לייצוב חריגות לזרום. צינור פלסטיק 50 מ"ל מלא 45ml של מים. המכסה של הצינור הוא חתום עם אפוקסי. הם דקרו שלושה חורים במכסה, שלוש חתיכות של צינורות מוכנסים לתוך הצינור. באמצעות אפוקסי, צינורות סגורים ואז המכסה, למנוע כל כניסה של אוויר או לברוח. Airspring מחוברת משאבה את המזרק, וכן את צינורות המוצא של התא זרימה.
  4. מניחים את צינורות היניקה של התא זרימה חוסמת המאגר ולמשוך את הבוכנה כדי להסיר כל האוויר בצינור. קפיצי עדין של הצינור לשקע יעזור ברור כל בועות אוויר שנלכדו בתוך התא זרימה.
  5. לאחר כל בועות האוויר הוסרו, בלוק אחד של צינורות היניקה עם מחט, ואחד הצינורות לשקע ידי כיפוף זה על ידי 1800 ואבטחת הצינור עם דבק.
  6. לדלל את תבנית ה-DNA המניות PM ב 10 מ"ל 1 של חיץ חסימת degassed. תזרים לתוך תא בקצב הזרימה מתונה לאפשר כיסוי השטח טוב של ה-DNA (0.01-0.05 מ"ל / דקה במשך 20 דקות עובדת היטב). זו יכולה להיות מגוונת המבוססת על כמה מולקולות הדנ"א הן על פני השטח עבור כל אצווה של coverslips או כמה הם הרצויה עבור הניסוי.
  7. פתרון לדלל את המניות חרוז ל-4x10 2 חרוזים 6 / מ"ל 1 מ"ל של חיץ חסימת degassed. תזרים לתוך תא בבית 0.01-0.05 מ"ל / דקה במשך 15 דקות.
  8. לאחר חרוזים מתווספים, הופכים את זרימת את החדר ולאפשר להגיע לשיווי משקל. ואז לסגור את שני צינורות מוצא. כל השינויים צינורות בלי חדר סגור יגרום לתנודות בלחץ כי יהיה להפעיל כוח חזק על חרוזים גזירה את מולקולות ה-DNA קשור.
  9. חסום את צינור היניקה ששימשה לטעינת חרוזים עם מחט, ולהתחיל לשטוף את התא זרימה באמצעות כניסת השני עם פתרון 1X degassed של חיץ חסימת במאגר עובד. לשטוף בהרחבה בשיעור של 0.01-0.05 מ"ל / דקה. להתסיס את הבמה באופן ידני על ידי לחיצה להסיר כל החרוזים תקועים nonspecifically אל פני השטח ( הקשה ).
  10. לאחר חרוזים חופשי מוסרים מספיק, להפוך את הזרימה ולאפשר את החדר כדי להגיע לשיווי משקל. סגור את צינור מוצא לפתוח ולעבור המאגר כניסת לפתרון חלבון, לאט פתיחת לשקע, כדי למנוע שינויים בלחץ מהירה
  11. אתה יכול לבדוק אם חרוזים הם קשורים ל-DNA על ידי שינוי כיוון הזרימה ( DNA ).
  12. עכשיו, התגובה האנזימטית יכול להתבצע. עבור מובילים הגדיל לעשות ניסויים סינתזה פתרון 20nm של helicase gp4 פתרון 20nm של פולימראז gp5 (מטוהרים כמתחם עם thioredoxin שלה processivity גורם) במאגר T7 degassed שכפול שאינו מכיל MgCl 2.
  13. תזרים הפתרון חלבון לתא בקצב מתון כדי לאפשר זרימה יעילה מחייב ל-DNA. אנו משתמשים 0.037 מ"ל / דקה במשך 8 דקות, ואז 0.012 מ"ל / דקה במשך 7 דקות.
  14. שטפו את החדר עם חיץ T7 degassed שכפול ללא MgCl 2 כדי להסיר את החלבונים חינם. שיעור של 0.037 מ"ל / דקה במשך 3-10 דקות עובד מצוין.
  15. לאחר כביסה, תזרים T7 שכפול חיץ עם MgCl 2 ולהתחיל רכישת נתונים. השתמש קצב הזרימה של 0.012 מ"ל / דקה המקביל לכוח PN 3 גרירה על רצועות DNA בתנאים המתוארים בפרוטוקול זה.
  16. המקום מגנט נדיר הארץ קבע מעל התא זרימה לפני הדמיה כדי למנוע אינטראקציות ספציפי בין חרוזים פני השטח.
  17. צפה השדה עם מטרה 10X ואת המצלמה CCD. פוקוס בעזרת חרוז קשור.
  18. מיקום הפנס סיבים בזווית שכיחות בין 10 מעלות ובמקביל לשלב את המיקרוסקופ ליד המיקרוסקופ. Dark שדה תאורה משמש כדי להגדיל את החדות בתחום ההדמיה חרוז.
  19. רוכשת את הנתונים עבור 20 דקות 30 בקצב איטי מסגרת (בדרך כלל 2-4 הרץ).

6. נציג תוצאות

בניסוי מוצלח אתה אמור להיות מסוגל לשמור יותר מ 100 חרוזים בו זמנית ( סינתזת גדיל מוביל ). הניסוי אמור להניב עקבות רבים להציג סינתזה המובילים גדיל DNA.

ניתוח נתונים:

על מנת למדוד את שיעורי processivities של ה-DNA ואת ההתרה פילמור, עמדות המדויק של חרוזים חייבת להיות נחושה. ניתן להשיג זאת על ידי התאמת תפקידים אלה עם 2 מימדי פונקציות גאוס. מסלולי אז יכול להיות מופק על ידי העמדה חרוז מעקב על כל מסגרת באמצעות תוכנת מעקב (DiaTrack למשל). כעת אתה מוכן לדמיין מסלולי ידי זוממים עמדה חרוז כפונקציה של הזמן באמצעות כל כך גרפיftware (מקור למשל). כדי לקבל נתונים בקצב, להתאים את חלקות עם רגרסיה לינארית לחשב את השיפוע. עבור processivity, לקבוע את האורך הכולל של ה-DNA מתחילתו ועד סופו של האירוע קיצור (איור 3). שני המספרים האלה יהיה צורך להמיר basepairs. כדי להמיר תנועה חרוז כדי basepairs, הראשון שאתה צריך למדוד את אורך λ נמתח מולקולת DNA בקצב זרימת התגובה. מאז אורכו של ה-DNA λ ידוע (48,502 bp) אתה יכול לכייל את מספר זוגות בסיסים / פיקסל לעבר כוח ניסיונית. עבור דיוק מוגבר, לגרוע את עקבות עניין עקבות הבסיסית של לקשור חרוז שלא שינו enzymatically. מערבבים את כל המדידות יחיד קצב העלילה הפצות processivity. התאם את הנתונים באמצעות פונקציות גאוס ו יחיד מעריכי, בהתאמה (איור 3).

איור 1
באיור 1. מולקולה בודדת ניסיוני ההתקנה. (א) דופלקס λ DNA (48.5 kb) מחוברת אל פני השטח של התא זרימה דרך 5 "בסופו של גדיל אחד באמצעות אינטראקציה ביוטין-streptavidin, ואת 3" בסופו של גדיל אותה מחוברת חרוז באמצעות digoxigenin אנטי digoxigenin אינטראקציה. מזלג השכפול דרוך נוצר בקצה השני חרוז כדי לאפשר טעינה של פולימראז. (ב) חרוז-DNA אסיפות נמתחים באמצעות זרימה למינרית של חיץ צילמו באמצעות שדה רחב מיקרוסקופיה אופטית. על ידי מעקב את עמדותיהם של חרוזים לאורך זמן, תוך שמירה על כוח מתיחות מתמדת, באורכים של בונה DNA יכול להיות פיקוח. (ג) הארכת פרופיל של ssDNA (עיגול מלא) ו dsDNA (מעגל פתוח) תחת כוחות נמוך. קו מקווקו תוכניות באורך מלא קריסטלוגרפיים של ה-DNA DS-λ, 16.3 מיקרומטר. ההבדל הגדול בין אורך ssDNA ו dsDNA לעבר כוחות סביב 3 PN מאפשר תצפית ישירה של המרות בין SS-ו dsDNA על ידי ניטור השינויים באורך DNA. להדמיה סימולטני של מספר גדול של ה-DNA יחד חרוזים מאפשר לחקר replisomes בודדים רבים בניסוי אחד.

איור 2
איור 2 חלבונים bacteriophage T7 שכפול:. פולימראז ה-DNA (המורכב של gp5 ו thioredoxin) ו-DNA helicase (gp4) לסנתז גדיל DNA המובילים בנוכחות deoxyribonucleotides ומגנזיום. תהליך זה מלווה קיצור של גדיל הדנ"א מפגרת בגלל התפתלות. המרת dsDNA למצב שינויים ssDNA של חרוז. מדידת המיקום של החרוז מאפשר קביעה מדויקת של שיעור ו processivity של שכפול ה-DNA.

איור 3
איור 3. דוגמה נתונים אופייני מולקולה בודדת מובילה הגדיל הניסוי סינתזה. Processivity של שכפול הדנ"א שווה באורך כולל של ה-DNA מתחילתו ועד סופו של האירוע וקיצור. שיעור שכפול הדנ"א מתקבל על ידי הולם את העלילה עם רגרסיה ליניארית וחישוב המדרון. שיעור מראה הבלעה הפצות processivity כי התקבלו על ידי שילוב של נתונים מתוך מספר מדידות. הנתונים הותאמו באמצעות פונקציות גאוס ו יחיד מעריכי, בהתאמה.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

חשוב להבטיח כי כוח הגרר המופעל על ידי זרימה למינרית חרוזים אינו משפיע על פעילות אנזימטית של חלבונים שכפול. למשל, כוח 3 PN המתאים קצב זרימה של 0.012 ml / min לא משפיע השכפול של גדיל DNA מובילים. היא עושה זאת להשפיע על הפעילות האנזימטית המתרחשים במהלך סינתזת DNA מתואמת, ולכן יש לצמצם 1.5 PN. הכוח לגרור ניתן לשלוט בקלות על ידי שינוי קצב הזרימה או ברוחב של ערוץ הזרימה 5.

ה-DNA מתיחה assay מעסיקה הבדלים באורך בין פעמיים ו גדילי דנ"א יחיד. בניסוי המתואר כאן את ההמרה של dsDNA כדי ssDNA מתרחשת כתוצאה לסינתזה גדיל מוביל (איור 2). אתם צריכים לזכור ssDNA הוא קצר יותר מאשר dsDNA רק כוחות מתיחה נמוך מתחת 6 PN (איור 1).

שיפור אפשרי של שיטה זו הוא לשנות את גדיל מפגרת של תבנית שכפול ידי הצמדת חרוז השני בסוף 3'שלה. התחלפות כזו שתאפשר תצפית ישירה של פעילות אנזימטית המתרחשים בשני גדילי הדנ"א.

מלבד המחקרים של הסינתזה גדיל מוביל שכפול מתואמת, ה-DNA מתיחה assay הועסק בהצלחה לבחון את אחת מולקולה קינטיקה של exonuclease λ, והדינמיקה של חילופי פולימראז במהלך שכפול 5,6. בעיקרון, שיטה זו יכולה לשמש כדי לחקור כל אנזים עיבוד ה-DNA.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

הפיתוח של ה-DNA מתיחה assay נעזרה פול Blainey, בונג ג'ונג לי, סמיר חמדאן. עבודה זו נתמכת על ידי המכונים הלאומיים לבריאות מענקים לצ'ארלס ריצ'רדסון (GM54397) ואנטואן ואן Oijen (GM077248).

Materials

Name Company Catalog Number Comments
Bacteriophage λ DNA New England Biolabs N3011L
DNA Oligonucleotides Integrated DNA Technologies
T4 DNA Ligase New England Biolabs M0202L
T4 Polynucleotide Kinase New England Biolabs M0201L
α-digoxigenin Fab Roche Group 11214667001
Tosyl Activated Beads Invitrogen 142-03
Magnetic Separator Invitrogen Dynal MPC
3-aminopropyl-triethoxysilane Sigma-Aldrich A3648 Other aminosilanes can be used or mixed with non-amine reactive silanes for sparser surfaces
Succinimidyl propionate PEG Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Biotin-PEG-NHS Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Double-sided tape Grace Bio-Lab Inc. SA-S-1L 100 μm thickness
Quartz slide Technical Glass 20 mm (W)x 50 mm (L)x 1mm (H) Size to fit on coverslips. Drill holes with diamond-tip drill bits (DiamondBurs.net)
Polyethylene tubing BD Biosciences 427416 0.76 mm ID, 1.22 OD
Other size tubing can be substituted.
Streptavidin Sigma-Aldrich S4762 Make 1 mg/mL solution, 25 μL aliquots in PBS pH 7.3
Deoxyribonucleotide triphosphate solution mix New England Biolabs N0447
Inverted Optical Microscope with 10X Objective Olympus Corporation Olympus IX-51
Permament rare-earth magnet National Imports www.rare-earth-magnets.com
CCD Camera QImaging Rolera-XR Fast 139
Syringe Pump Harvard Apparatus 11 Plus Operate in refill mode to facilitate solution changes
Fiber Illuminator Thorlabs Inc. OSL1

DOWNLOAD MATERIALS LIST

References

  1. Lee, J. B. DNA primase acts as a molecular brake in DNA replication. Nature. 439, 621-624 (2006).
  2. Tanner, N. A., van Oijen, A. M. Single-molecule observation of prokaryotic DNA replication. Methods Mol Biol. 521, 397-410 (2009).
  3. Sofia, S. J., Premnath, V. V., Merrill, E. W. Poly(ethylene oxide) Grafted to Silicon Surfaces: Grafting Density and Protein Adsorption. Macromolecules. 31, 5059-5070 (1998).
  4. Tanner, N. A., Loparo, J. J., van Oijen, A. M. Visualizing single-molecule DNA replication with fluorescence microscopy. J Vis Exp. (2009).
  5. Hamdan, S. M., Loparo, J. J., Takahashi, M., Richardson, C. C., van Oijen, A. M. Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis. Nature. 457, 336-339 (2009).
  6. van Oijen, A. M. Single-molecule kinetics of lambda exonuclease reveal base dependence and dynamic disorder. Science. 301, 1235-1238 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics