Direkt observation av enzymer Replikera DNA med en enda molekyl DNA Stretching analys

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Vi beskriver en metod för att observation realtid replikering av enskilda DNA-molekyler förmedlas av proteiner från bakteriofag replikering systemet.

Cite this Article

Copy Citation | Download Citations

Kulczyk, A. W., Tanner, N. A., Loparo, J. J., Richardson, C. C., van Oijen, A. M. Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay. J. Vis. Exp. (37), e1689, doi:10.3791/1689 (2010).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Vi beskriver en metod för att observation realtid replikering av enskilda DNA-molekyler förmedlas av proteiner från bakteriofag replikering systemet. Linjäriserade λ DNA är modifierad så den har en biotin på slutet av en tråd, och en digoxigenin fraktionen i andra änden av samma tråd. Den biotinylerad änden är ansluten till en functionalized glas täckglas och digoxigeninated slut på en liten pärla. Monteringen av dessa DNA-sträng tjuder på ytan av ett flöde cell gör ett laminärt flöde som skall tillämpas för att utöva en dragkraft på pärlan. Som ett resultat, är DNA sträcks nära och parallellt med ytan på täckglas vid en kraft som bestäms av flödet (Figur 1). Längden på DNA mäts genom att övervaka läget för pärla. Längd skillnader mellan enkel-och dubbelsträngat DNA används för att få information i realtid om verksamheten för replikering proteiner på gaffeln. Mätning av läge pärla ger en exakt bestämning av priser och processivities av DNA varva ner och polymerisation (figur 2).

Protocol

1. DNA-replikering Mall

DNA för reaktionen är en linjär λ DNA modifieras av glödgning av oligonukleotider att bilda en replikering gaffel. Dessutom är biotin bifogas i slutet av en del av λ DNA, och en digoxigenin fraktion är ansluten till den andra änden av samma område 1.

Material: bakteriofag λ DNA, oligonukleotider: biotinylerad gaffel armen (A: 5'-biotin-AAAAAAAAAAAAAAAAGAGTACTGTACGATCTAGCATCAATCACAGGGTCAGGTTCGTTATTGTCCAACTTGCTGTCC-3), λ-kompletterande gaffel armen (B: 5'-GGGCGGCGACCTGGACAGCAAGTTG GACAATCTCGTTCTATCACTAATTCACTAATGCAGGGAGGATTTCAGATATGGCA-3 '), gaffel primer (C: 5' -TGCCATATCTGAAATCCTCCCTGC-3), λ-kompletterande digoxigenin änden (D: 5'-AGGTCG CCGCCCAAAAAAAAAAAA-digoxigenin-3), T4 DNA-ligas, T4 polynucleotide kinas, Värme block.

  1. Fosforylera de 5 "ändarna av oligonukleotider B och D med T4 polynucleotide Kinase.
  2. Glödga oligonukleotider A, B och C till λ DNA i ett steg genom att lägga till en 10-faldigt högre än oligonukleotider A och B, samt en 100-faldig över oligonukleotid C i T4 DNA-ligas buffert.
  3. Värm blandningen till 65 ° C i värmen blocket. När uppvärmd, stäng av värmen blockera och tillåta långsam nedkylning ordentligt glödga oligonukleotider.
  4. Lägg T4 DNA-ligas till blandningen och inkubera i rumstemperatur i 2 timmar. T4 DNA-ligas kommer att katalysera den korrekta anslutningen av oligonukleotider A och B och λ DNA.
  5. Slutligen glödga olignukleotiden D till DNA-replikation mallen genom att lägga till 100-faldig över oligonukleotid D med avseende på l DNA i T4 DNA-ligas buffert.
  6. Inkubera blandningen vid 45 ° C i 30 min i värmen blocket, och svalna till rumstemperatur långsamt genom att vrida värmeblocket av.
  7. Den slutliga DNA-replikation mallen är nu klar för användning. Vi lagrar mallen vid en koncentration av 1,4 Nm vid 4 ° C i flera veckor.

2. Pärlor

Pärlor är functionalized med ett Fab-fragment med specificitet för digoxigenin. De kan bifogas sedan DNA-replikation mallen 2.

Material: Tosyl aktiveras pärlor, α-digoxigenin Fab-fragment, Buffert A: 0,1 miljoner H3BO3 pH 9,5, Buffert B: 0,1 M PBS pH 7,4, 0,1% w / v BSA, Buffert C: 0,2 M Tris-HCl pH 8,5 (25 ° C), 0,1% w / v BSA, magnetisk separator, rotator.

  1. Resuspendera stamlösningen av pärlor och överföra ett litet delprov i Eppendorf-rör. Placera röret i ett fack av den magnetiska separatorn och inkubera tills lösningen försvinner, ta sedan bort supernatanten genom pipettering.
  2. Lägg till buffert A, som aktiverar tosyl grupper för antikroppar koppling. Blanda försiktigt genom att pipettera och ta bort bufferten med magnetisk separator.
  3. Lägg Fab-fragment och återsuspendera pärlor igen i buffert A, blanda väl och inkubera 16-24 timmar vid 37 ° C med rotator. Efter inkubation, separat pärlor med hjälp av den magnetiska separatorn och ta bort buffert.
  4. Tvätta kulor genom att lägga till buffert B och inkubera vid 4 ° C i 5 min. Ta bort bufferten med hjälp av magnetisk separator. Upprepa tvätt två gånger.
  5. Lägg buffert C och inkubera vid 37 ° C i 4 timmar att blockera fri tosyl grupper. Separat pärlor med hjälp av magnetisk separator och ta bort buffert.
  6. Tvätta två gånger i buffert B och delprov för användning. Pärlor kan lagras vid 4 ° C under 1 år eller längre utan betydande förlust av kvalitet (vårt lager lösning innehåller 1 - 2x10 9 pärlor / ml).

3. Functionalized Täckglas

För att möjliggöra fastsättning av DNA till glaset täckglas är glaset first functionalized med en aminosilane som sedan kopplas till biotinylerad PEG molekyler. Denna beläggning bidrar till att minska ospecifik interaktion mellan DNA och proteiner replikering med ytan 3,4.

Material: Glas täckglas, färgning burkar, 3-aminopropyltriethoxysilane, Methoxy-PEG5k-NHS-ester, Biotin-PEG5k-NHSester, aceton, 1M KOH, Etanol, Ugn, Badkar sonicator

  1. Rengör glaset täckglasen genom att placera dem i färgning burkar och fylla burkarna med etanol. Sonikera i 30 minuter, skölj ur burkar och fyll med 1 M KOH. Upprepa både tvättar.
  2. För första funktionalisering reaktion, alla spår av vatten måste tas bort. Fyll burkarna med aceton och låt ligga i 10 min. Töm och fyll igen med aceton.
  3. Bered en 2% v / v lösning av silan reagens i aceton. Lägg till färgningen burkar och skaka i 2 minuter. Denna reaktion par i alkoxi grupp av aminosilane mot glaset, vilket ger en reaktiv amin för nästa koppling steg. Släck reaktionen med ett stort överskott av vatten.
  4. Torka täckglasen genom att baka dem i 110 °, C i ugnen i 30 minuter.
  5. Förbered en 50:1 metoxi: biotin PEG blandning i 100 mm NaHCO 3 pH 8,2. Sikta på ca 0,2% w / v biotinylerad PEG.
  6. Pipettera 100 mikroliter av PEG blandningen på en torr silaniseras täckglas och placera en annan täckglas ovanpå. Inklusive en spacer glas täckglas tillåter separation av täckglas.
  7. Inkubera täckglasen i PEG-lösning i 3 timmar, därefter separera varje par av täckglas och tvätta mycket med vatten. Var noga med att hålla täckglasen functionalized uppåt eftersom endast en gång sida kommer att vara belagda med PEG.
  8. Torka täckglas med luft och lagra i vakuum i exsickator. Ytorna är hållbar i minst en månad, så massor av täckglas kan göras i ett parti och används efter behov.

4. Flöde avdelningen Förberedelser

Experimentet utförs med hjälp av ett enkelt flöde kammare konstruerad med en functionalized täckglas, dubbelhäftande tejp, en kvarts bild och slang. Ett flöde kammare är förberedd för varje enskild molekyl experiment 2,4.

Material: Dubbelhäftande tejp, rakblad, kvarts bild med hål för slang, snabbtorkande epoxy, functionalized täckglas, streptavidin lösning (25 mikroliter av 1 mg / ml i PBS), slang, blockerande buffert (5X: 20 mM Tris pH 7,5, 2 mM EDTA, 50 mM NaCl, 0,2 mg / mL BSA, 0,005% Tween-20), som arbetar buffert (1X: 20 mM Tris-HCl pH 7,5, 2 mM EDTA, 50 mM NaCl).

  1. Börja med att blanda och placera 5 ml blockerande buffert och 20 ml av att arbeta buffert i en exsickator för att ta bort eventuella luftbubblor för senare steg.
  2. Ta en PEG-functionalized täckglas och spridningen 125 PBS-utspädd streptavidin lösning över ytan. Lämna detta till inkubera i 20 minuter i rumstemperatur medan du förbereder övriga delar av kammaren, så streptavidin att binda ytan biotins.
  3. Klipp en bit dubbelhäftande tejp för att matcha storleken på kvarts bilden. Markera positionen för slangen hålen på bandet så att en översikt av flödet kammaren kan ritas på bandet.
  4. Gör en 3 mm bred centerkanalen och rektanglar som innehåller båda hålen. Vi använder flöde kammare med två inlopp och två utlopp Y-formade kanaler.
  5. Klipp längs den ritade konturen och gör raka, rena snitt så att ingen självhäftande sticker in i kanalen.
  6. Rengör kvarts noggrant med aceton eller etanol för att ta bort lim från föregående flödescell konstruktion.
  7. Hitta de bästa anpassningen av kanalen kontur, ta bort ena sidan av självhäftande baksida och försiktigt placera tejpen på kvarts bilden. Var noga med att anpassa bandet ordentligt, som in-och utlopp hål måste förbli hävs.
  8. Klipp längder av rör för inlopp och utlopp av flödet cellen. Det bidrar till att minska i slutet av röret på ca en 30 graders vinkel så att slangen inte kommer att trycka platt mot kammaren botten. Placera rören på någon form av stöd (t.ex. rör rack) att avbryta dem för enkel infästning i flödescellen i nästa steg.
  9. Skölj streptavidin-belagda täckglas ordentligt med vatten och torka med tryckluft. Kom ihåg att endast en sida är functionalized. Ta bort den andra sidan av bandet bakom och placera kvarts bilden på täckglas.
  10. Tryck lätt på täckglas att pressa ut all luft i limmet. Detta kommer att bidra till att undvika eventuella luftbubblor kommer in i flödet kanal.
  11. Täta sidor av kammaren med epoxi. Sätt skär slangen i hålen av kvarts och tätningen på plats med epoxi. Detta måste torka i ett par minuter.
  12. När torr, börjar blockera ytan genom att dra några av de avgasade blockerande buffert genom ett rör. En 21-gauge nål passar perfekt in i 0,76 mm slang. Spola några gånger att ta bort luftbubblor och låta kammaren till inkubera i minst en halvtimme.

5. Enda molekyl replikering Experiment

När DNA-mallen och functionalized pärlor har upprättats, och flödet kammaren är klar kan en enda molekyl experiment utföras.

Material: Förberedd flöde kammare, blockerande buffert (5X: 20 mM Tris-HCl pH 7,5, 2 mM EDTA, 50 mM NaCl, 1 mg / mL BSA, 0,025% Tween-20), Working buffert (1X: 20 mM Tris-HCl pH 7,5, 2 mM EDTA, 50 mM NaCl), T7 replikering buffertar med eller utan 10 mM MgCl 2 (1X: 40 mM Tris-HCl pH 7,5, 50 mm K-glutamat, 2 mM EDTA, 100 mikrogram / ​​ml BSA, 10 mm DTT, 600 mikroM dNTPs), replikering proteiner, inverterat ljusmikroskop med 10x objektiv, CCD-kamera, permanent sällsynta magnet, sprutpump, airspring, fiber belysning, dator med bild förvärvet programvara.

  1. Efter flödescellen har blockerats, är det redo att börja experimentet.
  2. Ta flödet cellen och placera den på mikroskop scenen. Håll kammaren på plats med scenen klippoch se till att flödet kanalen är placerad i linje med CCD-kamera.
  3. Anslut flödet rören cellen utlopp till airspring med en större slang diameter kontakten eller en nål. Den airspring används för att stabilisera något flöde oegentligheter. En 50 ml plaströr är fylld med 45 ml vatten. Locket på röret är förseglade med epoxi. Tre hål hål i locket, och tre bitar av slang förs in i röret. Använda epoxi, är rören sedan förseglade med lock, förhindra luft från att komma in eller fly. Den airspring är anslutet till sprutan pumpen och till utloppet rör med flödet cellen.
  4. Placera inloppet rör med flödet cellen i blockerande buffert och dra tillbaka sprutan för att avlägsna eventuell luft i röret. Ett lätt snärt med utloppsrör kommer att klara eventuella luftbubblor fastnar i flödet cellen.
  5. När alla luftbubblor har tagits bort, blockera en av inloppet rör med en nål och en av verksamhetsstället rören genom att böja det med 1800 och säkra slangen med tejp.
  6. Späd mallen lager-DNA till 10 på kvällen i 1 ml avgasade blockerande buffert. Strömma in i kammaren i måttlig flödeshastighet så att en god yttäckning av DNA (från 0,01 till 0,05 ml / min i 20 minuter fungerar bra). Detta kan varieras beroende på hur många DNA-molekyler på ytan för varje parti täckglas eller hur många önskas för experimentet.
  7. Späd beståndet pärla lösning till 2-4x10 6 pärlor / ml i 1 ml avgasade blockerande buffert. Strömma in i kammaren på 0,01-0,05 ml / min i 15 minuter.
  8. När pärlor tillkommer, stänga av flödet och låt kammare för att nå jämvikt. Stäng sedan båda utlopp rören. Eventuella förändringar av rören utan att kammaren stängd orsakar tryckvariationer som kommer att utöva en stark kraft på pärlor och klippa uppbundna DNA-molekyler.
  9. Blockera inloppet röret som användes för lastning pärlor med en nål, och börja tvätta flödescellen med den andra inlopp med avgasade 1X-lösning blockerande buffert i arbetslivet buffert. Tvätta utförligt i en takt av 0,01-0,05 ml / min. Skaka manuellt scenen genom att trycka för att ta bort kulor ospecifikt fastnat på ytan ( Tapping ).
  10. När fria pärlor är tillräckligt bort, stänga av flödet och låt kammare för att nå jämvikt. Stäng den öppna utloppsrör och växla inloppet reservoaren till protein lösning, långsamt öppna utloppet för att undvika snabba tryckförändringar
  11. Du kan kontrollera om pärlor är bundna till DNA genom att ändra riktning på flödet ( DNA ).
  12. Nu kan den enzymatiska reaktionen ske. För ledande del syntes experiment gör 20nm lösning av GP4 helikas och 20Nm lösning av GP5 polymeras (renat som ett komplex med sina processivity faktor thioredoxin) i avgasade T7 replikering buffert som inte innehåller MgCl 2.
  13. Flow proteinet lösningen i kammaren i måttlig flödeshastighet för att möjliggöra en effektiv bindning till DNA. Vi använder oss av 0,037 ml / min i 8 minuter, och sedan 0,012 ml / min för 7 minuter.
  14. Tvätta kammaren med avgasade T7 replikering buffert utan MgCl 2 för att ta bort fria proteiner. Frekvensen av 0,037 ml / min för 3-10 minuter fungerar bra.
  15. Efter tvätt, flöde T7 replikering buffert med MgCl 2 och börja datainsamling. Använd ett flöde på 0,012 ml / min vilket motsvarar 3 PN dra kraft den DNA binda på de villkor som beskrivs i detta protokoll.
  16. Placera en sällsynta jordartsmetaller permanentmagnet över flödet cell innan avbildning för att förhindra ospecifik interaktion mellan pärlor och yta.
  17. Visa fält med 10X objektiv och CCD-kamera. Fokusera med en tjudrad pärla.
  18. Placera en fiber belysning med en incidens vinkel mellan 10 grader och parallellt med mikroskop scenen nära mikroskopet. Mörkfältsbelysning används för att öka kontrasten i pärlan avbildning.
  19. Skaffa data för 20 30 minuter i långsam bildfrekvens (vanligtvis 2-4 Hz).

6. Representativa resultat

I ett lyckat experiment bör du kunna observera mer än 100 pärlor samtidigt ( Ledande del syntes ). Experimentet ska ge många spår som visar vilket syntes DNA.

Dataanalys:

För att mäta priser och processivities av DNA varva ner och polymerisation, måste den exakta positioner pärlor fastställas. Du kan uppnå det genom att montera dessa positioner med 2-dimensionella Gaussisk funktioner. Banor kan sedan utvinnas genom att spåra pärla position vid varje bildruta med hjälp av mjukvara (t.ex. DiaTrack). Nu är du redo att visualisera banor genom att rita pärla position som en funktion av tiden med hjälp av någon grafisk såftware (t.ex. Origin). För att få rate data, passa tomter med en linjär regression och beräkna lutningen. För processivity, fastställa den totala längden av DNA från början till slut en förkortning händelse (Figur 3). Båda dessa siffror kommer att behöva konverteras till baspar. För att konvertera pärla rörelse till baspar, först måste du mäta längden på en utsträckt λ DNA-molekyl i reaktionen flöde. Eftersom längden på λ DNA är känd (48.502 bp) kan du kalibrera antalet baspar / bildpunkt i experimentell kraft. För ökad noggrannhet, subtrahera från spår av intresse en baslinje spår av en pärla tjuder som inte är enzymatiskt ändras. Kombinera alla enskilda mätningar och plotta ränta och utdelningar processivity. Montera data med gaussisk och ensamstående exponentialfunktioner respektive (Figur 3).

Figur 1
Figur 1. Single-molekyl experiment. (A) Duplex λ-DNA (48,5 kb) är fäst på ytan av flödescellen via 5 "slutet på en strand med en biotin-streptavidin interaktion, och 3" slutet av samma del är ansluten till en pärla med en digoxigenin anti-digoxigenin interaktion. En grundmålad replikationsgaffeln bildas i slutet mittemot pärla att tillåta lastning av polymeras. (B) Bead-DNA församlingar sträcks med hjälp av laminärt flöde av buffert och avbildas med brett fält optisk mikroskopi. Genom att spåra positionerna för kulorna över tiden, samtidigt som en konstant stretching kraft, kan längden på DNA-konstruktioner övervakas. (C) Förlängning profil ssDNA (fylld cirkel) och dsDNA (öppen cirkel) under lågt krafter. Streckad linje visar kristallografiska längd fullt DS-λ DNA, 16,3 ìm. Den stora skillnaden i längd mellan ssDNA och dsDNA på krafterna runt 3 PN möjliggör en direkt observation av omräkningar mellan SS-och dsDNA genom att övervaka förändringar i DNA-längd. Den samtidiga visualisering av ett stort antal DNA-kopplad pärlor möjliggör studier av många enskilda replisomes i ett experiment.

Figur 2
Figur 2 bakteriofag T7 replikering proteiner:. DNA-polymeras (komplex av GP5 och thioredoxin) och DNA helikas (GP4) syntetisera DNA ledande del i närvaro av deoxyribonucleotides och magnesium. Denna process åtföljs av förkortning av DNA släpar del på grund av ringlande. Omvandling av dsDNA i ssDNA ändrar ställning pärla. Mätning ställning pärla ger en exakt bestämning av ränta och processivity av DNA replikation.

Figur 3
Figur 3. Exempel på typiska data från en enda molekyl ledande strand syntes experiment. Processivity av DNA-replikering är lika med en total längd av DNA från början till slut en förkortning händelse. Graden av DNA-replikation uppnås genom att montera tomten med en linjär regression och beräkning av lutning. Den infällda bilden visar hastighet och fördelningar processivity som erhålls genom att kombinera data från ett antal mätningar. Data samlades monteras med gaussisk och ensamstående exponentialfunktioner, respektive.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Det är viktigt att se till att dra kraft som verkar på pärlor med laminärt flöde inte påverkar enzymaktiviteten av replikering proteiner. Till exempel påverkar ett 3 pn-kraft som motsvarar ett flöde på 0,012 ml / min inte replikering av DNA ledande strängen. Det påverkar dock enzymatisk aktiviteter som äger rum under samordnad DNA-syntes, och det måste därför reduceras till 1,5 PN. Den dragkraft kan enkelt kontrolleras genom att ändra flödet eller en bredd av flödet kanal 5.

Det DNA som sträcker sig analysen sysselsätter längd skillnader mellan dubbel-och enkel-strängat DNA. I experimentet som beskrivs här omvandlingen av dsDNA att ssDNA uppstår som en följd av de ledande tråd syntes (figur 2). Du bör komma ihåg att ssDNA är kortare än dsDNA endast vid låga stretching krafter under 6 PN (Figur 1).

En möjlig förbättring av denna metod är att ändra släpar delen av replikering mallen genom att fästa en andra pärla till 3'-änden. En sådan växling skulle ge direkt observation av enzymatiska aktiviteter som äger rum på både DNA-strängar.

Förutom studier av de ledande tråd syntes och samordnad replikering, har DNA-analysen sträcker sig framgångsrikt används för att undersöka de enda molekyl kinetik λ exonuclease, och dynamik polymeras utbyte vid replikering 5,6. I princip kan denna metod användas för att studera eventuella enzymet DNA-behandling.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Utvecklingen av DNA-stretching analysen fick hjälp av Paul Blainey, Jong-Bong Lee, och Samir Hamdan. Detta arbete stöds av National Institutes of Health bidrag till Karl Richardson (GM54397), och Antoine van Oijen (GM077248).

Materials

Name Company Catalog Number Comments
Bacteriophage λ DNA New England Biolabs N3011L
DNA Oligonucleotides Integrated DNA Technologies
T4 DNA Ligase New England Biolabs M0202L
T4 Polynucleotide Kinase New England Biolabs M0201L
α-digoxigenin Fab Roche Group 11214667001
Tosyl Activated Beads Invitrogen 142-03
Magnetic Separator Invitrogen Dynal MPC
3-aminopropyl-triethoxysilane Sigma-Aldrich A3648 Other aminosilanes can be used or mixed with non-amine reactive silanes for sparser surfaces
Succinimidyl propionate PEG Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Biotin-PEG-NHS Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Double-sided tape Grace Bio-Lab Inc. SA-S-1L 100 μm thickness
Quartz slide Technical Glass 20 mm (W)x 50 mm (L)x 1mm (H) Size to fit on coverslips. Drill holes with diamond-tip drill bits (DiamondBurs.net)
Polyethylene tubing BD Biosciences 427416 0.76 mm ID, 1.22 OD
Other size tubing can be substituted.
Streptavidin Sigma-Aldrich S4762 Make 1 mg/mL solution, 25 μL aliquots in PBS pH 7.3
Deoxyribonucleotide triphosphate solution mix New England Biolabs N0447
Inverted Optical Microscope with 10X Objective Olympus Corporation Olympus IX-51
Permament rare-earth magnet National Imports www.rare-earth-magnets.com
CCD Camera QImaging Rolera-XR Fast 139
Syringe Pump Harvard Apparatus 11 Plus Operate in refill mode to facilitate solution changes
Fiber Illuminator Thorlabs Inc. OSL1

DOWNLOAD MATERIALS LIST

References

  1. Lee, J. B. DNA primase acts as a molecular brake in DNA replication. Nature. 439, 621-624 (2006).
  2. Tanner, N. A., van Oijen, A. M. Single-molecule observation of prokaryotic DNA replication. Methods Mol Biol. 521, 397-410 (2009).
  3. Sofia, S. J., Premnath, V. V., Merrill, E. W. Poly(ethylene oxide) Grafted to Silicon Surfaces: Grafting Density and Protein Adsorption. Macromolecules. 31, 5059-5070 (1998).
  4. Tanner, N. A., Loparo, J. J., van Oijen, A. M. Visualizing single-molecule DNA replication with fluorescence microscopy. J Vis Exp. (2009).
  5. Hamdan, S. M., Loparo, J. J., Takahashi, M., Richardson, C. C., van Oijen, A. M. Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis. Nature. 457, 336-339 (2009).
  6. van Oijen, A. M. Single-molecule kinetics of lambda exonuclease reveal base dependence and dynamic disorder. Science. 301, 1235-1238 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics