Direkte Beobachtung von Enzymen Replizieren DNA Mit einem Single-Molekül DNA Stretching Assay

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Wir beschreiben eine Methode zur Beobachtung der Echtzeit-Replikation einzelner DNA-Moleküle durch Proteine ​​des Bakteriophagen Replikationssystem vermittelt.

Cite this Article

Copy Citation | Download Citations

Kulczyk, A. W., Tanner, N. A., Loparo, J. J., Richardson, C. C., van Oijen, A. M. Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay. J. Vis. Exp. (37), e1689, doi:10.3791/1689 (2010).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Wir beschreiben eine Methode zur Beobachtung der Echtzeit-Replikation einzelner DNA-Moleküle durch Proteine ​​des Bakteriophagen Replikationssystem vermittelt. Linearisierte λ DNA wird modifiziert, um ein Biotin auf das Ende eines Stranges, und ein Digoxigenin-Rest am anderen Ende des gleichen Strang zu haben. Der biotinylierte Ende mit einem funktionalisierten Deckglas und die digoxigeninated Ende eine kleine Perle befestigt. Die Montage dieser DNA-Bead Anbindehaltung auf der Oberfläche einer Durchflusszelle ermöglicht eine Laminar-Flow anzuwenden, um eine Zugkraft auf dem Wulst auszuüben. Als Ergebnis wird die DNA in der Nähe und parallel zur Oberfläche des Deckglases mit einer Kraft, die durch den Durchfluss (Abbildung 1) bestimmt wird gestreckt. Die Länge der DNA wird durch die Überwachung der Position der Perle gemessen. Länge Unterschiede zwischen Einzel-und Doppelstrang-DNA werden genutzt, um in Echtzeit Informationen über die Tätigkeit der Replikation Proteine ​​an der Gabelung zu erhalten. Die Messung der Position der Sicke ermöglicht eine präzise Bestimmung der Preise und processivities von DNA Abwickeln und Polymerisation (Abbildung 2).

Protocol

1. DNA Replication Vorlage

DNA für die Reaktion ist ein linearisierter λ-DNA durch Glühen von Oligonukleotiden zu einer Replikationsgabel Form modifiziert. Darüber hinaus ist Biotin an das Ende eines Stranges der λ DNA befestigt, und ein Digoxigenin-Rest ist an das andere Ende des gleichen Strang 1 beigefügt.

Werkstoffe: Bakteriophagen λ DNA, Oligonukleotide: biotinylierten Gabelarm (A: 5'-Biotin-AAAAAAAAAAAAAAAAGAGTACTGTACGATCTAGCATCAATCACAGGGTCAGGTTCGTTATTGTCCAACTTGCTGTCC-3 '), λ-komplementäre Gabelarm (B: 5'-GGGCGGCGACCTGGACAGCAAGTTG GACAATCTCGTTCTATCACTAATTCACTAATGCAGGGAGGATTTCAGATATGGCA-3'), Gabel-Primer (C: 5 ' -TGCCATATCTGAAATCCTCCCTGC-3 '), λ-komplementäre Digoxigenin Ende (D: 5'-AGGTCG CCGCCCAAAAAAAAAAAA-Digoxigenin-3'), T4 DNA Ligase, T4 Polynukleotid Kinase, Wärme zu blockieren.

  1. Phosphorylieren den 5'-Enden von Oligonukleotiden B und D mit Hilfe der T4-Polynukleotid-Kinase.
  2. Glühen Oligonukleotiden A, B und C, die λ-DNA in einem Schritt durch Zugabe einer 10-fachen Überschuss von Oligonukleotiden A und B, und ein 100-fachen Überschuss von Oligonukleotid-C in T4 DNA-Ligase-Puffer.
  3. Erhitzen Sie die Mischung auf 65 ° C in der Hitze zu blockieren. Einmal erhitzt, schalten Sie die Hitze blockieren und ermöglichen ein langsames Abkühlen auf richtig glühen Oligonukleotiden.
  4. Add T4 DNA-Ligase, die Mischung und Inkubation bei Raumtemperatur für 2 Stunden. T4 DNA Ligase katalysiert die richtige Verbindung von Oligonukleotiden A und B und λ DNA.
  5. Schließlich glühen die Oligonukleotid-D auf die DNA-Replikation Vorlage, indem 100-fachen Überschuss von Oligonukleotid-D in Bezug auf l DNA in T4 DNA-Ligase-Puffer.
  6. Inkubieren Sie die Mischung bei 45 ° C für 30 min in der Hitze blockieren und auf Raumtemperatur abkühlen langsam durch Drehen Hitze blockieren.
  7. Die endgültige DNA-Replikation Vorlage ist nun einsatzbereit. Wir speichern die Vorlage bei einer Konzentration von 1,4 nM bei 4 ° C für mehrere Wochen.

2. Beads

Perlen sind mit einer Fab-Fragment mit einer Spezifität für Digoxigenin funktionalisiert. Sie können dann auf die DNA-Replikation Vorlage 2 befestigt werden.

Werkstoffe: Tosyl aktiviert Perlen, α-Digoxigenin Fab-Fragment, Puffer A: 0,1 M H3BO3 pH 9,5, Puffer B: 0,1 M PBS pH 7,4, 0,1% w / v BSA, Puffer C: 0,2 M Tris-HCl pH 8,5 (25 ° C), 0,1% w / v BSA, Magnetabscheider, Rotator.

  1. Resuspendieren Stammlösung von Perlen und Transfer ein kleines Aliquot in die Eppendorf-Röhrchen. Das Röhrchen wird in einen Schlitz der Magnetabscheider und inkubieren, bis die Lösung löscht, dann Überstand zu entfernen durch Pipettieren.
  2. Add-Puffer A, der wird Tosylgruppen für die Antikörper-Kupplung zu aktivieren. Vorsichtig mischen und entfernen Puffer mit dem Magnetabscheider.
  3. Add Fab-Fragment und resuspendieren Perlen wieder in Puffer A, gründlich mischen und inkubieren 16-24 Stunden bei 37 ° C mit Rotator. Nach der Inkubation mit separaten Perlen der Magnetabscheider und entfernen Puffer.
  4. Wash Perlen durch Zugabe von Puffer B und inkubieren Sie bei 4 ° C für 5 min. Entfernen Sie den Puffer mit Magnetabscheider. Wiederholen zweimaligem Waschen.
  5. Add-Puffer C und bei 37 ° C für 4 Stunden auf freien Tosylgruppen blockieren. Separate Perlen mit Magnetabscheider und entfernen Puffer.
  6. Zweimal waschen mit Puffer B und Aliquot für den Einsatz. Perlen können bei 4 ° C gelagert werden für 1 Jahr oder länger ohne wesentlichen Verlust an Qualität (unsere Stammlösung enthält 1 - 2x10 9 Beads / ml).

3. Funktionalisierte Deckgläser

Um Befestigung der DNA, die Deckglas wird das Glas zunächst mit einem Aminosilan, die dann an biotinylierte PEG-Moleküle gekoppelt ist funktionalisiert. Diese Beschichtung hilft, die unspezifische Wechselwirkungen der DNA-Replikation und Proteine ​​mit der Oberfläche 3,4 zu reduzieren.

Materialien: Glas-Deckgläschen, Küvetten, 3-Aminopropyltriethoxysilan, Methoxy-PEG5k-NHS-Ester, Biotin-PEG5k-NHSester, Aceton, 1M KOH, Ethanol, Backofen, Ultraschallbad

  1. Reinigen Sie die Deckgläschen, indem man sie in Küvetten und Befüllen der Gläser mit Ethanol. Ultraschallbad für 30 Minuten ausspülen die Gläser füllen und mit 1 M KOH. Wiederholen Sie die beiden Wäschen.
  2. Zum ersten Funktionalisierung Reaktion, müssen alle Spuren von Wasser entfernt werden. Füllt die Krüge mit Aceton und beschallen für 10 min. Leeren und füllen wieder mit Aceton.
  3. Bereiten Sie eine 2% v / v Lösung des Silans Reagenz in Aceton. Hinzufügen, um die Küvetten und agitieren für 2 Minuten. Diese Reaktion koppelt die Alkoxygruppe des Aminosilan auf das Glas, so dass eine reaktive Amin für die nächsten Kupplungsschritt. Die Reaktion wird mit einem großen Überschuss an Wasser.
  4. Trocknen Sie die Deckgläschen durch Backen sie bei 110 °; C in den Ofen für 30 Minuten.
  5. Bereiten Sie eine 50:1 methoxy: Biotin PEG-Gemisch in 100 mM NaHCO 3 pH 8,2. Ziel für rund 0,2% w / v biotinylierten PEG.
  6. Je 100 ul der PEG-Gemisch auf ein trockenes silanisiert Deckglas und legen Sie eine weitere Deckglas an der Spitze. Inklusive einem Deckglas spacer erlauben Trennung der Deckgläser.
  7. Inkubieren Sie die Deckgläser in der PEG-Lösung für 3 Stunden, dann trennen Sie jedes Paar von Deckgläsern und waschen gründlich mit Wasser. Seien Sie vorsichtig, damit die Deckgläser funktionalisierten Seitenketten als nur einmal an Seite mit PEG beschichtet werden.
  8. Trocknen Sie die Deckgläser mit Luft und speichern unter Vakuum im Exsikkator. Die Oberflächen bleiben für mindestens einen Monat stabil, so Dutzende von Deckgläsern können in einer Batch gemacht werden und nach Bedarf verwendet.

4. Flusskammer Vorbereitung

Das Experiment wird mit Hilfe einer einfachen Flusskammer mit einem funktionalisierten Deckglas, doppelseitiges Klebeband, ein Quarz-Objektträger und Schläuche hergestellt. Eine Flusskammer wird für jede Einzel-Molekül-Experiment 2,4 zubereitet.

Material: Doppelseitiges Klebeband, Rasierklinge, Quarz-Objektträger mit Bohrungen für Schläuche, schnell trocknenden Epoxy-funktionalisierten Deckglas, Streptavidin-Lösung (25 ul 1 mg / mL in PBS), Schläuche, Blocking-Puffer (5X: 20 mM Tris pH 7,5, 2 mM EDTA, 50 mM NaCl, 0,2 mg / ml BSA, 0,005% Tween-20), Arbeits-Puffer (1X: 20 mM Tris-HCl pH 7,5, 2 mM EDTA, 50 mM NaCl).

  1. Beginnen Sie mit dem Mischen und dem Einbau 5 ml Blocking-Puffer und 20 ml Puffer arbeitet in einem Exsikkator, um mögliche Luftblasen für spätere Schritte zu entfernen.
  2. Werfen Sie einen PEG-funktionalisierten Deckglas und breitete 125 von PBS-verdünnten Streptavidin-Lösung über die Oberfläche. Lassen Sie diese für 20 Minuten bei Raumtemperatur inkubieren während der Vorbereitung in anderen Teilen der Kammer, so dass Streptavidin an die Oberfläche Biotine binden.
  3. Schneiden Sie ein Stück doppelseitiges Klebeband, um die Größe des Quarz-Objektträger entsprechen. Markieren Sie die Position des Schlauches Löcher auf dem Band, so dass ein Überblick über die Flusskammer auf dem Band gezogen werden können.
  4. Machen Sie einen 3 mm breiten Center-Kanal und Rechtecke mit beiden Löchern. Wir verwenden Strömungskammern mit zwei Einlass-und zwei Auslass Y-förmige Kanäle.
  5. Schneiden Sie entlang der gezeichneten Kontur, so dass gerade, saubere Schnitte zu machen, dass kein Klebstoff ragt in den Kanal.
  6. Reinigen Sie den Quarz gründlich mit Aceton oder Ethanol, um Klebstoff von der vorherigen Durchflusszelle Bau zu entfernen.
  7. Finden Sie die beste Ausrichtung des Kanals skizzieren, entfernen Sie die eine Seite der Rückseite und setzt vorsichtig das Band auf den Quarz-Objektträger. Seien Sie vorsichtig, um das Band richtig auszurichten, da die Ein-und Auslass Löcher zu bleiben entsperrt brauchen.
  8. Cut Rohrlängen für die Einlass-und Auslass der Durchflusszelle. Es hilft, die Ende der Röhre bei etwa einem 30 ° Winkel geschnitten, so dass das Rohr nicht drücken wird gegen die Kammer unten flach. Legen Sie die Rohre auf irgendeine Art von Unterstützung (zB Reagenzglasgestelle), um sie zur einfachen Befestigung an der Messzelle in die nächsten Schritte zu suspendieren.
  9. Spülen Sie die Streptavidin-beschichteten Deckglas gründlich mit Wasser ab und trocknen mit Druckluft. Denken Sie daran, dass nur eine Seite funktionalisiert ist. Entfernen Sie die andere Seite der Band sichern und Ort der Quarz-Objektträger auf das Deckglas.
  10. Leicht auf dem Deckglas drücken, um Push-out keine Luft in den Klebstoff der Falle. So vermeiden Sie Luftblasen immer in den Strömungskanal.
  11. Verschließen Sie die Seiten der Kammer mit Epoxy. Legen Sie das ausgeschnittene Schlauch in die Löcher der Quarz und Dichtung in Stelle mit Epoxidharz. Dies muss für ein paar Minuten trocknen lassen.
  12. Nach dem Trocknen beginnen Blockierung der Oberfläche, indem einige der entgasten Blockierungspuffer durch eine der Röhren. Ein 21-Gauge-Nadel passt perfekt in die 0,76 mm Schlauch. Flush ein paar Mal, um Luftblasen zu entfernen und damit die Kammer für mindestens eine halbe Stunde zu inkubieren.

5. Einzel-Molekül-Replication Experiment

Sobald die DNA-Vorlage und funktionalisierten Kügelchen hergestellt worden sind, und die Flusskammer bereit ist, kann eine Einzel-Molekül-Experiment durchgeführt werden.

Werkstoffe: Vorbereitet Flusskammer, Blocking-Puffer (5X: 20 mM Tris-HCl pH 7,5, 2 mM EDTA, 50 mM NaCl, 1 mg / mL BSA, 0,025% Tween-20), Working-Puffer (1X: 20 mM Tris-HCl pH 7,5, 2 mM EDTA, 50 mM NaCl), T7-Replikation Puffer mit oder ohne 10 mM MgCl 2 (1X: 40 mM Tris-HCl pH 7,5, 50 mM K-Glutamat, 2 mM EDTA, 100 ug / ml BSA, 10 mM DTT, 600 uM dNTPs), Replikation Proteine, invertiert optisches Mikroskop mit 10X-Objektiv, CCD-Kamera, permanent seltenen Erden Magnet, Spritzenpumpe, Luftfeder, Faser-Hilfslicht, Computer mit Bildaufnahme-Software.

  1. Nach der Durchflusszelle blockiert wurde, ist es bereit, das Experiment zu beginnen.
  2. Nehmen Sie die Durchflusszelle und legen Sie es auf dem Mikroskoptisch. Halten Sie die Kammer in Platz mit Bühne Clipsund sicher sein, dass der Strömungskanal in Ausrichtung mit CCD-Kamera positioniert ist.
  3. Schließen Sie die Durchflusszelle Auslaßrohre die Luftfeder mit einem größeren Durchmesser Anschluss Schlauch oder einer Nadel. Die Luftfeder wird verwendet, um jegliche Strömung Unregelmäßigkeiten zu stabilisieren. Ein 50 ml Kunststoffröhrchen mit 45ml Wasser gefüllt. Der Deckel der Röhre ist mit Epoxidharz versiegelt. Drei Löcher sind in den Deckel durchbohrt, und drei Schlauchstücke sind in das Rohr eingeführt. Mit Epoxidharz werden die Rohre dann mit dem Deckel verschlossen, so dass keine Luft in oder auf der Flucht. Die Luftfeder ist die Spritzenpumpe und die Auslaßrohre der Messzelle verbunden.
  4. Legen Sie die Einlaßrohre der Messzelle in Blocking-Puffer und ziehen wieder auf die Spritze, um die Luft in den Schlauch zu entfernen. Eine sanfte Bewegung aus dem Auslaufrohr wird klar, keine Luftblasen in der Messzelle gefangen.
  5. Nachdem alle Luftblasen entfernt wurden, nur einen Block von der Einlass-Rohre mit einer Nadel und einer der Auslaßrohre durch Biegen sie von 1800 und die Sicherung der Röhre mit einem Klebeband.
  6. Von der Stammlösung DNA-Template zu 22.00 Uhr in 1 ml entgastem Blockierungspuffer. Durchfluss in die Kammer zu moderaten Durchfluss gute Flächendeckung von DNA (0,01 bis 0,05 ml / min für 20 Minuten gut funktioniert) zu ermöglichen. Dies kann je nachdem, wie viele DNA-Moleküle auf der Oberfläche für jede Charge von Deckgläsern oder wie viele sind für das Experiment gewünscht variiert werden.
  7. Von der Stammlösung Bead-Lösung, um 2-4x10 6 Perlen / ml in 1 ml entgastem Blockierungspuffer. Fließen in die Kammer bei 0,01-0,05 ml / min für 15 Minuten.
  8. Sobald Perlen hinzugefügt werden, schalten Sie den Strom ausschalten und Kammer ins Gleichgewicht zu erreichen. Dann schließen Sie beide Auslaßrohre. Jegliche Änderungen an den Rohren, ohne die Kammer geschlossen werden Druckschwankungen, die eine starke Kraft auf die Kugeln und scheren die angebundenen DNA-Moleküle ausüben, verursacht.
  9. Blockieren Sie die Einlass-Schlauch, der zum Laden Perlen mit einer Nadel verwendet wurde, und beginnen Waschen der Messzelle mit dem zweiten Eingang mit entgastem 1X-Lösung Blocking-Puffer in der Arbeit Puffer. Wash ausgiebig in Höhe von 0,01-0,05 ml / min. Man schüttelt von Hand die Bühne, indem Sie auf, um Beads unspezifisch an die Oberfläche (stuck entfernen Tapping ).
  10. Einmal frei Perlen ausreichend entfernt werden, schalten Sie den Strom ausschalten und Kammer um ein Gleichgewicht zu erreichen. Schließen Sie die geöffneten Auslaufrohr und schalten Sie den Einlass Reservoir an Protein-Lösung, langsames Öffnen der Steckdose, um schnelle Druckänderungen zu vermeiden
  11. Sie können prüfen, ob Perlen DNA durch Änderung der Strömungsrichtung (angebunden sind DNA ).
  12. Nun kann die enzymatische Reaktion durchgeführt werden. Für führende Strangsynthese Experimente machen 20nm Lösung von gp4 Helikase und 20nm Lösung von gp5 Polymerase (gereinigt wie ein Komplex mit seinen Prozessivität Faktor Thioredoxin) in entgastem T7 Replikation Puffer nicht enthält MgCl 2.
  13. Durchfluss der Protein-Lösung in die Kammer zu moderaten Durchfluss, um eine effiziente Bindung an die DNA zu ermöglichen. Wir verwenden 0,037 ml / min für 8 Minuten, und dann 0,012 ml / min für 7 Minuten.
  14. Waschen Sie die Kammer mit entgastem T7-Replikation ohne MgCl 2 bis frei Proteine ​​zu entfernen. Die Rate von 0,037 ml / min für 3-10 Minuten funktioniert gut.
  15. Nach dem Waschen, Durchfluss T7 Replikation Puffer mit MgCl 2 und beginnen Datenerfassung. Verwenden Sie einen Durchfluss von 0,012 ml / min entspricht 3 pN Zugkraft auf die DNA-Leinen unter den Bedingungen in diesem Protokoll beschrieben.
  16. Legen Sie einen seltenen Erden Permanentmagnet oberhalb der Messzelle vor Imaging unspezifische Wechselwirkungen zwischen Perlen und Oberfläche zu verhindern.
  17. View Feld mit einer 10X-Objektiv und CCD-Kamera. Fokus mit Anbindung an eine Perle.
  18. Position einer Faser-Hilfslicht bei einem Einfallswinkel von 10 Grad und parallel zu den Mikroskoptisch in der Nähe des Mikroskops. Dunkelfeldbeleuchtung wird verwendet, um den Kontrast in der Perle Bildgebung zu erhöhen.
  19. Erfassung von Daten für 20 30 min bei einer langsamen Frame-Rate (typischerweise 2-4 Hz).

6. Repräsentative Ergebnisse

In einem erfolgreichen Experiment sollte es möglich sein, mehr als 100 Perlen gleichzeitig beobachten ( Leading-Strang-Synthese ). Das Experiment sollte Ausbeute zahlreiche Spuren Anzeige führenden DNA-Synthese.

Data Analysis:

Um Preise und processivities von DNA Abwickeln und Polymerisation zu messen, muss die genauen Positionen der Kugeln bestimmt werden. Sie können es durch den Einbau dieser Positionen mit 2-dimensionale Gauß-Funktionen zu erreichen. Trajektorien kann dann von Tracking bead Position bei jedem Frame mit Tracking-Software (zB DiaTrack) extrahiert werden. Nun sind Sie bereit, um Trajektorien durch Auftragen bead Position als eine Funktion der Zeit mit einem beliebigen Grafik so zu visualisierenftware (zB Origin). Um Tarifdaten, passen die Parzellen mit einer linearen Regression und die Berechnung der Steigung. Für Prozessivität, bestimmen die Gesamtlänge der DNA von Anfang bis Ende eine Verkürzung Veranstaltung (Abbildung 3) zu beenden. Beide Zahlen werden sich an Basenpaare umgewandelt werden. So konvertieren bead Bewegung Basenpaare, müssen Sie zuerst die Länge eines gestreckten λ DNA-Molekül an der Reaktion Durchfluss messen. Da die Länge der λ DNA bekannt ist (48502 bp) können Sie die Anzahl der Basenpaare / Pixel bei experimentellen Kraft zu kalibrieren. Zur Erhöhung der Genauigkeit, von den Spuren des Interesses eine Grundlinie Spur von einem Wulst Leine, die nicht enzymatisch verändert subtrahieren. Kombinieren Sie alle Einzelmessungen und Plot-Rate und Prozessivität Distributionen. Fit der Daten mit Gauß-und Single-Exponentialfunktionen, (Abbildung 3).

Abbildung 1
Abbildung 1. Einzel-Molekül-Versuchsaufbau. (A) Duplex λ DNA (48,5 kb) wird auf die Oberfläche der Messzelle über die 5 'befestigt Ende eines Stranges mit einer Biotin-Streptavidin-Wechselwirkung, und das 3' Ende des gleichen Strang, um eine Perle befestigt mit einem Digoxigenin Anti-Digoxigenin-Interaktion. Ein grundiert Replikationsgabel ist am gegenüberliegenden Ende der Wulst ausgebildet, damit Belastung der Polymerase. (B) Bead-DNA-Baugruppen sind gestreckt mit Laminar-Flow-Puffer und aufgenommen mit Weitwinkel-optische Mikroskopie. Durch die Verfolgung der Positionen der Kugeln im Lauf der Zeit, unter Beibehaltung einer konstanten Dehnung Kraft, kann die Länge der DNA-Konstrukte, überwacht werden. (C) Verlängerung Profil von ssDNA (gefüllter Kreis) und dsDNA (offener Kreis) unter geringen Kräften. Eine gestrichelte Linie zeigt kristallographische Länge voll ds-λ DNA, 16,3 um. Der große Unterschied in der Länge zwischen ssDNA und dsDNA bei Kräften rund 3 pN erlaubt eine direkte Beobachtung der Umwandlungen zwischen ss-und dsDNA durch die Überwachung der Veränderungen in der DNA Länge. Die gleichzeitige Visualisierung von einer großen Anzahl von DNA-gekoppelten Beads ermöglicht die Untersuchung von vielen einzelnen replisomes in einem Experiment.

Abbildung 2
Abbildung 2 Bakteriophagen T7-Replikation Proteine:. DNA-Polymerase (Komplex von gp5 und Thioredoxin) und DNA-Helikase (gp4) zu synthetisieren DNA-Strang führt in Gegenwart von Desoxyribonukleotiden und Magnesium. Dieser Prozess wird durch die Verkürzung der DNA-Strang Rückstand durch Wickeln begleitet. Umwandlung der dsDNA in ssDNA Veränderungen Position der Kugel. Mess-Position der Sicke ermöglicht eine präzise Bestimmung der Geschwindigkeit und Prozessivität der DNA-Replikation.

Abbildung 3
Abbildung 3. Beispiel eines typischen Daten aus einer Einzel-Molekül-führenden-Synthese zu experimentieren. Prozessivität der DNA-Replikation ist gleich einer Gesamtlänge der DNA von Anfang bis Ende eine Verkürzung Veranstaltung zu beenden. Die Rate der DNA-Replikation, indem man die Handlung mit einer linearen Regression und die Berechnung der Steigung erhalten. Der Einschub zeigt Geschwindigkeit und Prozessivität Distributionen, die durch die Kombination von Daten aus einer Anzahl von Messungen erhalten wurden. Die Daten wurden ausgestattet mit Gauß-und Single-Exponentialfunktionen bzw..

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Es ist wichtig, um sicherzustellen, dass die Zugkraft auf Kügelchen von Laminar-Flow ausgeübt hat keinen Einfluss auf enzymatische Aktivitäten der Replikation Proteine. Zum Beispiel hat ein 3 pN Kraft, die zu einem Durchfluss von 0,012 ml / min entspricht nicht berührt Replikation der DNA-Strang führt. Es hat jedoch Auswirkungen auf enzymatische Aktivitäten, die während koordiniert die DNA-Synthese, und es muss daher auf 1,5 pN reduziert werden. Die Zugkraft kann durch Änderung der Strömungsgeschwindigkeit oder eine Breite des Strömungskanals 5 gesteuert werden.

Die DNA-Stretching-Assay beschäftigt Länge Unterschiede zwischen Doppel-und Einzelstrang-DNA. In dem hier beschriebenen Experiment die Umwandlung von dsDNA auf ssDNA tritt als Folge der führenden Strang-Synthese (Abbildung 2). Sie sollten daran denken, dass die ssDNA kürzer als dsDNA ist nur bei niedrigen Dehnungskräfte unter 6 pN (Abbildung 1).

Eine mögliche Verbesserung dieser Methode ist, um die rückständigen Strang der Replikation Vorlage durch die Anbringung eines zweiten Wulst an seinem 3'-Ende zu ändern. Solche Wechsel ermöglichen würde die direkte Beobachtung der enzymatischen Aktivitäten, die stattfinden in beiden DNA-Stränge.

Abgesehen von Studien zu den führenden Strang-Synthese und koordiniert die Replikation, die DNA Stretching-Assay wurde erfolgreich eingesetzt, um die Einzel-Molekül-Kinetik von λ-Exonuklease, und die Dynamik der Polymerase-Austausch während der Replikation 5,6 untersuchen. Im Prinzip kann diese Methode verwendet werden, um DNA Verarbeitung Enzym zu untersuchen.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Die Entwicklung der DNA Stretching Assay wurde durch Paul Blainey, Jong-Bong Lee, und Samir Hamdan unterstützt. Diese Arbeit wird durch die National Institutes of Health gewährt Charles Richardson (GM54397) und Antoine van Oijen (GM077248) unterstützt.

Materials

Name Company Catalog Number Comments
Bacteriophage λ DNA New England Biolabs N3011L
DNA Oligonucleotides Integrated DNA Technologies
T4 DNA Ligase New England Biolabs M0202L
T4 Polynucleotide Kinase New England Biolabs M0201L
α-digoxigenin Fab Roche Group 11214667001
Tosyl Activated Beads Invitrogen 142-03
Magnetic Separator Invitrogen Dynal MPC
3-aminopropyl-triethoxysilane Sigma-Aldrich A3648 Other aminosilanes can be used or mixed with non-amine reactive silanes for sparser surfaces
Succinimidyl propionate PEG Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Biotin-PEG-NHS Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Double-sided tape Grace Bio-Lab Inc. SA-S-1L 100 μm thickness
Quartz slide Technical Glass 20 mm (W)x 50 mm (L)x 1mm (H) Size to fit on coverslips. Drill holes with diamond-tip drill bits (DiamondBurs.net)
Polyethylene tubing BD Biosciences 427416 0.76 mm ID, 1.22 OD
Other size tubing can be substituted.
Streptavidin Sigma-Aldrich S4762 Make 1 mg/mL solution, 25 μL aliquots in PBS pH 7.3
Deoxyribonucleotide triphosphate solution mix New England Biolabs N0447
Inverted Optical Microscope with 10X Objective Olympus Corporation Olympus IX-51
Permament rare-earth magnet National Imports www.rare-earth-magnets.com
CCD Camera QImaging Rolera-XR Fast 139
Syringe Pump Harvard Apparatus 11 Plus Operate in refill mode to facilitate solution changes
Fiber Illuminator Thorlabs Inc. OSL1

DOWNLOAD MATERIALS LIST

References

  1. Lee, J. B. DNA primase acts as a molecular brake in DNA replication. Nature. 439, 621-624 (2006).
  2. Tanner, N. A., van Oijen, A. M. Single-molecule observation of prokaryotic DNA replication. Methods Mol Biol. 521, 397-410 (2009).
  3. Sofia, S. J., Premnath, V. V., Merrill, E. W. Poly(ethylene oxide) Grafted to Silicon Surfaces: Grafting Density and Protein Adsorption. Macromolecules. 31, 5059-5070 (1998).
  4. Tanner, N. A., Loparo, J. J., van Oijen, A. M. Visualizing single-molecule DNA replication with fluorescence microscopy. J Vis Exp. (2009).
  5. Hamdan, S. M., Loparo, J. J., Takahashi, M., Richardson, C. C., van Oijen, A. M. Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis. Nature. 457, 336-339 (2009).
  6. van Oijen, A. M. Single-molecule kinetics of lambda exonuclease reveal base dependence and dynamic disorder. Science. 301, 1235-1238 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics