La observación directa de ADN Enzimas Replicar El uso de un ADN de una sola molécula de estiramiento de ensayo

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Se describe un método para observar la replicación en tiempo real de las moléculas individuales de ADN mediada por proteínas del sistema de replicación del bacteriófago.

Cite this Article

Copy Citation | Download Citations

Kulczyk, A. W., Tanner, N. A., Loparo, J. J., Richardson, C. C., van Oijen, A. M. Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay. J. Vis. Exp. (37), e1689, doi:10.3791/1689 (2010).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Se describe un método para observar la replicación en tiempo real de las moléculas individuales de ADN mediada por proteínas del sistema de replicación del bacteriófago. Linealizado λ ADN se modifica para tener un biotina en el extremo de un hilo, y una fracción de digoxigenina en el otro extremo de la misma cadena. El final con biotina se une a un cubreobjetos funcionalizados y al final digoxigeninated a una pequeña cuenta. El montaje de estas correas de ADN derramará en la superficie de una célula de flujo permite un flujo laminar que se aplicarán para ejercer una fuerza de arrastre sobre el talón. Como resultado, el ADN se estira cerca y en paralelo a la superficie del cubreobjetos en una fuerza que está determinada por la velocidad de flujo (Figura 1). La longitud del ADN se mide mediante el control de la posición de la bola. Las diferencias de longitud entre el ADN de una sola y de doble cadena se utilizan para obtener información en tiempo real sobre la actividad de las proteínas de la replicación en el tenedor. Medición de la posición de la bola permite la determinación precisa de las tasas y processivities de anulación de ADN y la polimerización (Figura 2).

Protocol

1. Patrón de ADN de replicación

ADN para la reacción es un ADN lineal λ modificado por hibridación de oligonucleótidos para formar un tenedor de replicación. Además, la biotina se adjunta al final de una cadena del ADN λ, y una fracción de digoxigenina se une al otro extremo de la misma línea 1.

Materiales: bacteriófago λ ADN, oligonucleótidos: brazo tenedor biotinilado (A: 5'-biotina-AAAAAAAAAAAAAAAAGAGTACTGTACGATCTAGCATCAATCACAGGGTCAGGTTCGTTATTGTCCAACTTGCTGTCC-3 '), λ complementarias brazo tenedor (B: 5'-GGGCGGCGACCTGGACAGCAAGTTG GACAATCTCGTTCTATCACTAATTCACTAATGCAGGGAGGATTTCAGATATGGCA-3'), primer tenedor (C: 5 ' -TGCCATATCTGAAATCCTCCCTGC-3 '), λ complementarias final digoxigenina (D: 5'-AGGTCG CCGCCCAAAAAAAAAAAA-digoxigenina-3'), ADN ligasa de T4, T4 polinucleótido quinasa, del bloque de calor.

  1. Fosforilar los extremos 5 'de oligonucleótidos B y D utilizando T4 polinucleótido quinasa.
  2. Recocido oligonucleótidos A, B y C del ADN λ en un solo paso mediante la adición de un exceso de 10 veces de oligonucleótidos A y B, y un exceso de 100 veces de oligonucleótidos C en un tampón de T4 ADN ligasa.
  3. Calentar la mezcla a 65 ° C en el bloque de calor. Una vez caliente, a su vez el bloque de calor y deje un enfriamiento lento para templar adecuadamente oligonucleótidos.
  4. Añadir ADN ligasa de T4 a la mezcla y se incuba a temperatura ambiente durante 2 horas. T4 ADN ligasa cataliza la correcta unión de los oligonucleótidos A y B, y el ADN λ.
  5. Por último, el recocido D de oligonucleótidos para la plantilla de la replicación del ADN mediante la adición de 100 veces el exceso de oligonucleótidos D con respecto al ADN l en tampón de T4 ADN ligasa.
  6. Incubar la mezcla a 45 ° C durante 30 minutos en el bloque de calor y enfriar a temperatura ambiente lentamente girando bloquear el calor fuera.
  7. La plantilla final de la replicación del ADN ya está listo para su uso. Nosotros guardamos la plantilla a una concentración de 1,4 nM a 4 ° C durante varias semanas.

2. Cuentas

Los granos son funcionalizados con un fragmento Fab con especificidad para digoxigenina. Se pueden entonces se une a la plantilla de ADN 2 de replicación.

Materiales: Tosilo cuentas activadas, α-digoxigenina fragmento Fab, un tampón: 0,1 M H3BO3 pH 9,5, tampón B: PBS 0,1 M pH 7,4, el 0,1% w / v BSA, tampón C: 0,2 M Tris-HCl pH 8.5 (25 ° C), el 0,1% w / v BSA, separador magnético, los rotadores.

  1. Resuspender la solución de reserva de cuentas y la transferencia de una pequeña alícuota en el tubo eppendorf. Colocar el tubo en una ranura del separador magnético y se incuban hasta que la solución se aclara, a continuación, retire el sobrenadante con pipeta.
  2. Añadir un buffer, que se activará para el acoplamiento de los grupos tosilo anticuerpos. Mezclar suavemente con la pipeta y eliminar búfer con el separador magnético.
  3. Añadir fragmento Fab y cuentas de volver a suspender de nuevo en un buffer, mezclar bien e incubar 16-24 horas a 37 ° C con rotador. Después de la incubación, las cuentas por separado con el separador magnético y eliminar búfer.
  4. Lávese las cuentas mediante la adición de tampón B y se incuba a 4 ° C durante 5 min. Eliminar el buffer utilizando un separador magnético. Repetir el lavado dos veces.
  5. Añadir el tampón C y se incuba a 37 ° C durante 4 horas para los grupos tosilo bloque libre. Cuentas separadas utilizando un separador magnético y eliminar búfer.
  6. Lavar dos veces en tampón B y alícuota para su uso. Cuentas pueden ser almacenadas a 4 ° C durante 1 año o más sin una pérdida sustancial de la calidad (nuestra solución madre contiene 1 - 2x10 9 bolas / ml).

3. Cubreobjetos funcionalizados

Para permitir la instalación del ADN para el cubreobjetos de vidrio, el vidrio es el primer funcionalizados con un aminosilano, que se acopla a las moléculas de PEG con biotina. Esta capa ayuda a reducir las interacciones no específicas de ADN y las proteínas de replicación con la superficie de 3,4.

Materiales: cubreobjetos de vidrio, cubetas, 3-aminopropiltrietoxisilano, éster de metoxi-PEG5k-NHS, biotina-PEG5k NHSester, acetona, KOH 1M, etanol, horno, baño de ultrasonido

  1. Limpiar a fondo el cubreobjetos de vidrio, colocándolas en la tinción de los frascos y llenar los frascos con etanol. Sonicar durante 30 minutos, enjuague los frascos y llenar con 1 M KOH. Repita los lavados.
  2. Para la reacción de funcionalización en primer lugar, todos los rastros de agua necesitan ser removidos. Llenad las tinajas de acetona y ultrasonidos durante 10 minutos. Vaciar y llenar de nuevo con acetona.
  3. Preparar un 2% v / v solución del reactivo de silano en acetona. Añadir a la cubetas y agitar durante 2 minutos. Esta reacción se acopla el grupo alcoxi de la aminosilano al vidrio, dejando una amina reactiva para la próxima etapa de acoplamiento. Detener la reacción con un gran exceso de agua.
  4. Seque el cubreobjetos de hornearlas a 110 °; C en el horno durante 30 minutos.
  5. Prepare una metoxi 50:1: biotina mezcla de PEG en 100 mM NaHCO 3 pH 8,2. Trate de alrededor del 0,2% w / v de PEG con biotina.
  6. Pipetear 100 L de la mezcla de PEG en un portaobjetos seco silanizada y otro lugar cubreobjetos en la parte superior. Incluyendo un separador cubreobjetos permitirá la separación de las laminillas.
  7. Incubar los cubreobjetos en la solución de PEG durante 3 horas, luego se separan cada par de cubreobjetos y lavar intensamente con agua. Tenga cuidado de mantener los cubreobjetos funcionalizada hacia arriba, ya que sólo una vez que lado va a ser recubierto con PEG.
  8. Seque el cubreobjetos con aire y lo almacenan al vacío en un desecador. Las superficies se mantienen estables durante al menos un mes, por lo que decenas de cubreobjetos se puede hacer en un lote y se utiliza según sea necesario.

4. Preparación de la Cámara de flujo

El experimento se realiza con una cámara de flujo sencillo construido con un cubreobjetos funcionalizados, cinta de doble cara, una diapositiva de cuarzo y tubos. Una cámara de flujo se prepara para cada experimento de una sola molécula de 2,4.

Materiales: cinta de doble cara, una hoja de afeitar, diapositivas de cuarzo con agujeros para la tubería, de secado rápido epoxi, cubreobjetos funcionalizados, la solución de estreptavidina (25 l de 1 mg / ml en PBS), la tubería, el amortiguador de bloqueo (5 veces: 20 mM Tris pH 7,5, 2 mM EDTA, 50 mM NaCl, 0,2 mg / ml de BSA, 0,005% de Tween-20), tampón de trabajo (1X: 20 mM Tris-HCl pH 7,5, 2 mM EDTA, 50 mM NaCl).

  1. Comience por mezclar y colocar 5 ml de tampón de bloqueo y 20 ml de buffer de trabajo en un desecador para eliminar cualquier burbuja de aire para los pasos posteriores.
  2. Tome un cubreobjetos PEG-funcionalizados y la propagación de la solución de estreptavidina 125 PBS diluido a lo largo de la superficie. Dejar esta tarea a incubar durante 20 minutos a temperatura ambiente durante la preparación de otras partes de la cámara, permitiendo estreptavidina para unirse Biotins superficie.
  3. Corte un pedazo de cinta de doble cara para que coincida con el tamaño de la diapositiva de cuarzo. Marque la posición de los orificios de la tubería en la cinta de manera que un esquema de la cámara de flujo se pueden extraer de la cinta.
  4. Hacer un 3 mm de ancho del canal central y los rectángulos que contienen los dos agujeros. Usamos cámaras de flujo con dos entrada y dos canales de salida en forma de Y.
  5. Corte a lo largo de la línea trazada, por lo que los cortes rectos y limpio para asegurarse de que no sobresale adhesivo en el canal.
  6. Limpiar el cuarzo a fondo con acetona o etanol para quitar el adhesivo de la construcción de flujo de la celda anterior.
  7. Encontrar la mejor alineación de las líneas de canal, eliminar una parte de la superficie adhesiva y colocar con cuidado la cinta en el portaobjetos de cuarzo. Tenga cuidado de alinear correctamente la cinta, ya que los orificios de entrada y salida deben permanecer bloqueados.
  8. Cortar trozos de tubos para la entrada y salida de la celda de flujo. Que ayuda a cortar el extremo del tubo de aproximadamente un ángulo de 30 ° para que el tubo no se prensa plana contra el fondo de la cámara. Coloque los tubos en algún tipo de apoyo (por ejemplo, bastidores de tubo) para suspender para la conexión fácil a la celda de flujo en los próximos pasos.
  9. Enjuague el portaobjetos recubiertas de estreptavidina a fondo con agua y secar con aire comprimido. Recuerde que sólo un lado es funcionalizado. Retire el otro lado del soporte de la cinta y colocar la placa de cuarzo en el cubreobjetos.
  10. Presione suavemente el cubreobjetos para expulsar el aire atrapado en el adhesivo. Esto ayudará a evitar las burbujas de aire en el canal de flujo.
  11. Sello de los lados de la cámara con epoxy. Inserte la tubería cortada en los agujeros del cuarzo y el sello en su lugar con epoxy. Esto tiene que secar por unos minutos.
  12. Una vez seca, comenzará a bloquear la superficie tirando algunos de los buffer desgasificar el bloqueo a través de uno de los tubos. Una aguja de calibre 21 encaja perfectamente dentro de la tubería de 0,76 mm. Ras un par de veces para eliminar las burbujas de aire, y permitir que la cámara de incubación por lo menos durante media hora.

5. Una sola molécula de replicación Experimento

Una vez que la plantilla de ADN y los granos funcionalizados han sido preparados, y la cámara de flujo está listo, un experimento de una sola molécula puede llevar a cabo.

Materiales: cámara de flujo preparado, tampón de bloqueo (5 veces: 20 mM Tris-HCl pH 7,5, 2 mM EDTA, 50 mM NaCl, 1 mg / ml de BSA, 0,025% de Tween-20), tampón de trabajo (1X: 20 mM Tris-HCl pH 7,5, 2 mM EDTA, 50 mM NaCl), tampones T7 replicación con o sin 10 mM MgCl 2 (1X: 40 mM Tris-HCl pH 7,5, 50 mM de K-glutamato, 2 mM EDTA, 100 ug / ml de BSA, 10 mM TDT, 600 M dNTPs), las proteínas de replicación, microscopio invertido con objetivo óptico de 10x, cámara CCD, de imanes permanentes de tierras raras, bomba de jeringa, airspring, iluminador de fibra, ordenador con software de adquisición de imágenes.

  1. Después de la celda de flujo ha sido bloqueado, que está listo para comenzar el experimento.
  2. Tome la celda de flujo y colocarlo en la platina del microscopio. Mantenga la cámara en su lugar con clips etapay asegúrese de que el canal de flujo está situado en la alineación con la cámara CCD.
  3. Conecte los tubos de la celda de flujo de salida a la airspring utilizando un tubo de diámetro de conector más grande o una aguja. El airspring se utiliza para estabilizar el flujo de cualquier irregularidad. Un tubo de plástico de 50 ml se llena con 45 ml de agua. La tapa del tubo está sellado con resina epoxi. Tres agujeros son perforados en la tapa, y tres piezas de la tubería se introduce en el tubo. El uso de epoxy, los tubos son sellados en la tapa, evitando la entrada de aire o de escape. El airspring está conectado a la bomba de jeringa, y los tubos de salida de la celda de flujo.
  4. Coloque los tubos de entrada de la celda de flujo en el amortiguador de bloqueo y tire hacia atrás de la jeringa para eliminar el aire en el tubo. Un movimiento suave del tubo de salida va a ayudar a eliminar las burbujas de aire atrapadas en la celda de flujo.
  5. Una vez que todas las burbujas de aire se han retirado, a una cuadra de los tubos de entrada con una aguja, y uno de los tubos de salida doblando por 1800 y asegurar el tubo con cinta adhesiva.
  6. Diluir la plantilla de ADN acciones a 22:00 en 1 ml de tampón de bloqueo de desgasificado. Flujo en la cámara a una velocidad moderada para permitir el flujo de cobertura de la superficie buena de ADN (0,01 a 0,05 ml / min durante 20 minutos funciona bien). Esto puede variar según el número de moléculas de ADN están en la superficie de cada lote de cubreobjetos o cuántos se desean para el experimento.
  7. Diluir la solución madre de cordón a 2-4x10 6 cuentas / ml en 1 ml de tampón de bloqueo de desgasificado. Flujo en la cámara de 0,01-0,05 ml / min durante 15 minutos.
  8. Una vez que cuentas se añaden, a su vez el flujo y deje la cámara para alcanzar el equilibrio. A continuación, cierre los tubos de salida. Cualquier cambio a los tubos sin la cámara cerrada causará fluctuaciones en la presión que ejerce una fuerza sobre las cuentas y corte las moléculas de ADN atado.
  9. Bloquear el tubo de entrada que se utiliza para cargar las bolas con una aguja, y comenzar a lavar la celda de flujo con la segunda entrada con una solución desgasificada 1X de tampón de bloqueo en el buffer de trabajo. Lavar exhaustivamente en la tasa de 0.01-0.05 ml / min. Agitar manualmente el escenario tocando para eliminar cuentas de forma inespecífica adheridos a la superficie ( Tapping ).
  10. Una vez libre de cuentas son lo suficientemente alejada, a su vez el flujo y deje la cámara para alcanzar el equilibrio. Cerrar el tubo de salida abierta y cambiar el depósito de entrada a la solución de proteínas, abriendo lentamente la salida para evitar los cambios rápidos de presión
  11. Puede comprobar si cuentas están atados al ADN, cambiando la dirección del flujo ( ADN ).
  12. Ahora, la reacción enzimática se puede realizar. De los principales ramales experimentos de síntesis que la solución de 20nm GP4 helicasa y la solución de 20nm de la GP5 polimerasa (purificado como un complejo con el factor de procesividad tiorredoxina) en un tampón de desgasificado replicación T7 que no contiene MgCl 2.
  13. El flujo de la solución de proteína en la cámara a un caudal moderado para permitir la unión eficiente de ADN. Usamos 0.037 ml / min durante 8 minutos, y luego 0,012 ml / min durante 7 minutos.
  14. Lave la cámara con tampón desgasificado replicación T7 sin MgCl2 para eliminar las proteínas libres. La tasa de 0,037 ml / min durante 3-10 minutos funciona bien.
  15. Después del lavado, el flujo de replicación T7 tampón con MgCl 2 y comenzar la adquisición de datos. Use un caudal de 0.012 ml / min que corresponde a 3 pN fuerza de arrastre sobre las cuerdas de ADN en las condiciones descritas en el presente Protocolo.
  16. Coloque un imán permanente de tierras raras por encima de la celda de flujo antes de exponer para evitar interacciones no específicas entre los granos y la superficie.
  17. Campo de visión con un objetivo de 10X y una cámara CCD. Enfoque mediante un cordón atado.
  18. Posición de un iluminador de fibra en un ángulo de incidencia entre los 10 grados y en paralelo a la platina del microscopio cerca del microscopio. Iluminación de campo oscuro se utiliza para aumentar el contraste en la imagen de cuentas.
  19. Adquisición de datos de 20 30 minutos a una velocidad lenta (típicamente 2-4 Hz).

6. Resultados representante

En un experimento exitoso debe ser capaz de observar más de 100 cuentas de forma simultánea ( síntesis de la hebra líder ). El experimento debe producir numerosos vestigios mostrando la síntesis de los principales cadena de ADN.

Análisis de datos:

Con el fin de medir las tasas y processivities de anulación de ADN y la polimerización, la posición exacta de cuentas debe ser determinado. Se puede lograr mediante la instalación de estos puestos con dos dimensiones funciones Gaussianas. Las trayectorias se puede extraer por la posición de seguimiento de cuentas en cada fotograma utilizando un software de seguimiento (por ejemplo, DiaTrack). Ahora ya está listo para visualizar las trayectorias mediante el trazado de la posición de cuenta como una función del tiempo de usar cualquier gráfico paraftware (origen). Para obtener los datos de tasa, el ajuste de las parcelas con una regresión lineal y calcular la pendiente. Para procesividad, determinar la longitud total del ADN desde el principio hasta el final de un evento de acortamiento (Figura 3). Ambos de estos números tendrán que convertirse en pares de bases. Para convertir el movimiento de cuentas de pares de bases, primero que hay que medir la longitud de una molécula de ADN λ se extendía a la tasa de flujo de la reacción. Dado que la longitud del ADN λ es conocido (48 502 pb) se puede calibrar el número de pares de bases / pixel en la fuerza experimental. Para mayor precisión, restar de las huellas de un rastro de interés de referencia de una correa de cuentas que no es enzimáticamente alterada. Combina todas las medidas individuales y tasa de trama y la distribución de procesividad. Ajustar los datos con funciones de Gauss y la única exponencial, respectivamente (Figura 3).

Figura 1
Figura 1. Sola molécula de diseño experimental. (A) Duplex λ ADN (48,5 kb) se une a la superficie de la célula de flujo a través del extremo 5 'de una cadena utilizando una interacción biotina-estreptavidina, y el extremo 3' de la misma cadena se une a un cordón con un digoxigenina anti-digoxigenina interacción. Un tenedor de replicación preparado está formado en el extremo opuesto del cordón para permitir la carga de la polimerasa. (B) de bolas de ADN conjuntos se extendió el uso de flujo laminar de tampón y utilizando imágenes de gran campo de microscopía óptica. Mediante el seguimiento de las posiciones de las cuentas con el tiempo, mientras se mantiene una fuerza constante de estiramiento, la longitud de las construcciones de ADN pueden ser monitoreados. (C) Extensión de perfil de ADN de cadena simple (círculo relleno) y ADN de doble cadena (círculo abierto) en las fuerzas bajo. La línea de puntos muestra la longitud de la cristalografía totalmente ds-ADN λ, 16,3 micras. La gran diferencia de longitud entre el ssDNA y dsDNA a las fuerzas de alrededor de 3 PN permite una observación directa de las conversiones entre los ss-DNA de doble cadena y de vigilar los cambios en la longitud del ADN. La visualización simultánea de un gran número de cuentas, junto ADN permite el estudio de muchos replisomes individuales en un solo experimento.

Figura 2
Figura 2 bacteriófago proteínas de replicación T7:. ADN polimerasa (complejo de la GP5 y la tiorredoxina) y el ADN helicasa (gp4) sintetizar cadenas de ADN de liderazgo en la presencia de desoxirribonucleótidos y el magnesio. Este proceso es acompañado por el acortamiento de la cadena de ADN retraso debido a la espiral. La conversión de dsDNA en ssDNA cambia de posición de la bola. Medida de la posición de la bola permite la determinación precisa de la velocidad y la procesividad de la replicación del ADN.

Figura 3
Figura 3. Ejemplo de los datos típicos de una sola molécula líder del capítulo de experimento de síntesis. Procesividad de la replicación del ADN es igual a la longitud total del ADN desde el principio hasta el final de un evento de la manteca. La tasa de replicación del ADN se obtiene mediante la instalación de la parcela con una regresión lineal y el cálculo de la pendiente. La tasa de inserción y muestra las distribuciones de procesividad que se obtuvieron mediante la combinación de datos de una serie de medidas. Los datos se ajustaron utilizando funciones de Gauss y la única exponencial, respectivamente.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Es importante asegurarse de que la fuerza de arrastre ejercida sobre cuentas de flujo laminar no influye en la actividad enzimática de las proteínas de replicación. Por ejemplo, una fuerza de 3 PN que corresponde a un caudal de 0.012 ml / min no afectan a la replicación de la hebra de ADN líder. Sin embargo, sí afecta a las actividades enzimáticas que se producen durante la síntesis de ADN coordinado, y por lo tanto, tiene que reducirse a 1,5 pN. La fuerza de arrastre puede ser fácilmente controlado por el cambio de la velocidad de flujo o un ancho de canal de flujo 5.

El ADN se extiende ensayo emplea las diferencias de longitud entre el doble y el ADN de cadena sencilla. En el experimento descrito aquí la conversión de ADN de doble cadena de ADN de cadena simple se produce como resultado de la síntesis de la hebra principal (Figura 2). Usted debe recordar que el ssDNA ADN de doble cadena es más corta que sólo bajo las fuerzas de estiramiento por debajo de 6 pN (Figura 1).

Una posible mejora de este método consiste en modificar el capítulo menos de la plantilla de la replicación adjuntando una cuenta segundo a su extremo 3 '. La alternancia como permitiría la observación directa de actividades enzimáticas que tienen lugar en ambas cadenas del ADN.

Aparte de los estudios de la síntesis de la hebra principal y la réplica coordinada, el ADN se extiende ensayo se ha empleado con éxito para estudiar la cinética de una sola molécula de exonucleasa λ, y la dinámica de cambio de la polimerasa durante la replicación del 5,6. En principio, este método puede ser usado para estudiar cualquier enzima de procesamiento de ADN.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

El desarrollo del ADN se extiende ensayo fue ayudado por Paul Blainey, Bong Jong-Lee, y Samir Hamdan. Este trabajo es apoyado por los Institutos Nacionales de Salud subvenciones a Charles Richardson (GM54397), y Antoine van Oijen (GM077248).

Materials

Name Company Catalog Number Comments
Bacteriophage λ DNA New England Biolabs N3011L
DNA Oligonucleotides Integrated DNA Technologies
T4 DNA Ligase New England Biolabs M0202L
T4 Polynucleotide Kinase New England Biolabs M0201L
α-digoxigenin Fab Roche Group 11214667001
Tosyl Activated Beads Invitrogen 142-03
Magnetic Separator Invitrogen Dynal MPC
3-aminopropyl-triethoxysilane Sigma-Aldrich A3648 Other aminosilanes can be used or mixed with non-amine reactive silanes for sparser surfaces
Succinimidyl propionate PEG Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Biotin-PEG-NHS Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Double-sided tape Grace Bio-Lab Inc. SA-S-1L 100 μm thickness
Quartz slide Technical Glass 20 mm (W)x 50 mm (L)x 1mm (H) Size to fit on coverslips. Drill holes with diamond-tip drill bits (DiamondBurs.net)
Polyethylene tubing BD Biosciences 427416 0.76 mm ID, 1.22 OD
Other size tubing can be substituted.
Streptavidin Sigma-Aldrich S4762 Make 1 mg/mL solution, 25 μL aliquots in PBS pH 7.3
Deoxyribonucleotide triphosphate solution mix New England Biolabs N0447
Inverted Optical Microscope with 10X Objective Olympus Corporation Olympus IX-51
Permament rare-earth magnet National Imports www.rare-earth-magnets.com
CCD Camera QImaging Rolera-XR Fast 139
Syringe Pump Harvard Apparatus 11 Plus Operate in refill mode to facilitate solution changes
Fiber Illuminator Thorlabs Inc. OSL1

DOWNLOAD MATERIALS LIST

References

  1. Lee, J. B. DNA primase acts as a molecular brake in DNA replication. Nature. 439, 621-624 (2006).
  2. Tanner, N. A., van Oijen, A. M. Single-molecule observation of prokaryotic DNA replication. Methods Mol Biol. 521, 397-410 (2009).
  3. Sofia, S. J., Premnath, V. V., Merrill, E. W. Poly(ethylene oxide) Grafted to Silicon Surfaces: Grafting Density and Protein Adsorption. Macromolecules. 31, 5059-5070 (1998).
  4. Tanner, N. A., Loparo, J. J., van Oijen, A. M. Visualizing single-molecule DNA replication with fluorescence microscopy. J Vis Exp. (2009).
  5. Hamdan, S. M., Loparo, J. J., Takahashi, M., Richardson, C. C., van Oijen, A. M. Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis. Nature. 457, 336-339 (2009).
  6. van Oijen, A. M. Single-molecule kinetics of lambda exonuclease reveal base dependence and dynamic disorder. Science. 301, 1235-1238 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics