Osservazione diretta del DNA Enzimi Replica utilizzando un singolo-molecola di DNA Stretching Assay

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Descriviamo un metodo per osservare la replicazione in tempo reale di singole molecole di DNA mediate da proteine ​​del sistema di replica batteriofago.

Cite this Article

Copy Citation | Download Citations

Kulczyk, A. W., Tanner, N. A., Loparo, J. J., Richardson, C. C., van Oijen, A. M. Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay. J. Vis. Exp. (37), e1689, doi:10.3791/1689 (2010).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Descriviamo un metodo per osservare la replicazione in tempo reale di singole molecole di DNA mediate da proteine ​​del sistema di replica batteriofago. Linearizzato λ DNA è modificato in modo da avere un biotina alla fine di un filo, e un residuo di digossigenina sull'altra estremità del filo stesso. La fine biotinilato è collegato a un coprioggetto di vetro funzionalizzati e la fine digoxigeninated ad una piccola biglia. L'assemblaggio di questi DNA-tallone attacchi sulla superficie di una cellula di flusso consente un flusso laminare da applicare a esercitare una forza di resistenza sul tallone. Di conseguenza, il DNA è allungata vicina e parallela alla superficie del vetrino con una forza che è determinata dalla velocità di flusso (Figura 1). La lunghezza del DNA viene misurata attraverso il monitoraggio della posizione del tallone. Differenze di lunghezza tra il DNA a singolo e doppio filamento sono utilizzati per ottenere informazioni in tempo reale l'attività delle proteine ​​replica al bivio. Misurare la posizione del tallone consente precisa determinazione dei tassi e processivities del DNA di svolgimento e di polimerizzazione (Figura 2).

Protocol

1. DNA replica Template

DNA per la reazione è un DNA λ linearizzato modificato dalla ricottura di oligonucleotidi per formare una forcella di replica. Inoltre, la biotina è fissata alla fine di un filamento del DNA λ, e un residuo di digossigenina è collegata all'altra estremità del filo stesso 1.

Materiali: batteriofago λ DNA, Oligonucleotidi: braccio forcella biotinilato (A: 5'-biotina-AAAAAAAAAAAAAAAAGAGTACTGTACGATCTAGCATCAATCACAGGGTCAGGTTCGTTATTGTCCAACTTGCTGTCC-3 '), λ-complementare braccio a forcella (B: 5'-GGGCGGCGACCTGGACAGCAAGTTG GACAATCTCGTTCTATCACTAATTCACTAATGCAGGGAGGATTTCAGATATGGCA-3'), primer forcella (C: 5 ' -TGCCATATCTGAAATCCTCCCTGC-3 '), λ-end digoxigenin complementare (D: 5'-AGGTCG CCGCCCAAAAAAAAAAAA-digossigenina-3'), DNA ligasi T4, chinasi polinucleotide T4, blocco termico.

  1. Fosforilare estremità 5 'di oligonucleotidi B e D utilizzando chinasi T4 polinucleotide.
  2. Ricottura oligonucleotidi A, B e C al DNA λ in un unico passaggio con l'aggiunta di 10 volte l'eccesso di oligonucleotidi A e B, e un eccesso di 100 volte di C oligonucleotide nel buffer di T4 DNA ligasi.
  3. Scaldare la miscela a 65 ° C nel blocco di calore. Una volta riscaldato, ruotare il blocco fuoco spento e consentire il raffreddamento lento a temprare correttamente oligonucleotidi.
  4. Aggiungi ligasi T4 DNA per la miscela e incubare a temperatura ambiente per 2 ore. T4 DNA ligasi catalizza la giusta unione di oligonucleotidi A e B, e DNA λ.
  5. Infine, ricuocere il D oligonucleotide al modello di replicazione del DNA con l'aggiunta di 100 volte superiori a D oligonucleotide relativi al DNA l in tampone T4 DNA ligasi.
  6. Incubare la miscela a 45 ° C per 30 minuti nel blocco calore e raffreddare lentamente a temperatura ambiente girando bloccare il calore fuori.
  7. Il modello finale replicazione del DNA è ora pronto per l'uso. Noi registriamo il modello ad una concentrazione di 1,4 Nm a 4 ° C per diverse settimane.

2. Perline

Perle sono funzionalizzati con un frammento Fab con specificità per digossigenina. Possono essere quindi collegato alle 2 modello di replicazione del DNA.

Materiali: Tosyl perline attivato, α-digossigenina frammento Fab, tampone A: H3BO3 0,1 M pH 9,5, Buffer B: 0,1 M PBS pH 7,4, 0,1% w / v BSA, Buffer C: 0,2 M Tris-HCl pH 8.5 (25 ° C), 0,1% w / v BSA, separatore magnetico, Rotator.

  1. Risospendere la soluzione stock di perline e trasferire una piccola aliquota nella provetta Eppendorf. Posizionare il tubo in un alloggiamento del separatore magnetico e incubare fino soluzione schiarisce, quindi rimuovere il surnatante pipettando.
  2. Aggiungi tampone A, che si attiverà gruppi tosyl per l'accoppiamento degli anticorpi. Mescolare delicatamente pipettando e rimuovere buffer con il separatore magnetico.
  3. Aggiungi frammento Fab e perline risospendere ancora nel buffer A, mescolare accuratamente, e incubare 16-24 ore a 37 ° C utilizzando dei rotatori. Dopo l'incubazione, perline separati utilizzando il separatore magnetico e rimuovere tampone.
  4. Lavare perle con l'aggiunta di tampone B e incubare a 4 ° C per 5 min. Rimuovere il tampone con separatore magnetico. Ripetere il lavaggio due volte.
  5. Aggiungi tampone C e incubare a 37 ° C per 4 ore al blocco libero gruppi tosyl. Perline separato con separatore magnetico e rimuovere tampone.
  6. Lavare due volte in B buffer e aliquota per l'uso. Sfere possono essere conservati a 4 ° C per 1 anno o più senza perdita sostanziale di qualità (la nostra soluzione madre contiene 1 - 2x10 9 perline / ml).

3. Coprivetrini funzionalizzati

Per consentire il fissaggio del DNA per il coprioggetto di vetro, il vetro viene prima funzionalizzati con un aminosilane, che viene poi accoppiato a molecole PEG biotinilato. Questo rivestimento consente di ridurre le interazioni non specifiche di DNA e proteine ​​replica con la superficie di 3,4.

Materiali: coprioggetto di vetro, barattoli di colorazione, 3-amminopropiltrietossisilano, metossi-PEG5k NHS-estere, biotina-PEG5k-NHSester, acetone, KOH 1M, etanolo, Forno, sonicatore Bagno

  1. Pulire accuratamente i coprioggetti vetro mettendoli in colorazione vasi e riempire i vasi con etanolo. Con ultrasuoni per 30 minuti, sciacquare i vasi e riempire con 1 M KOH. Ripetere le due lavaggi.
  2. Per la reazione di funzionalizzazione primo, tutte le tracce di acqua devono essere rimosse. Riempite i barattoli con acetone e ultrasuoni per 10 min. Svuotare e riempire di nuovo con acetone.
  3. Preparare un 2% v / v soluzione del reagente silano in acetone. Aggiungi ai contenitori per i lavaggi e agitare per 2 minuti. Questa reazione coppie del gruppo alcossi del aminosilane al vetro, lasciando una ammina reattiva per il passo successivo accoppiamento. Spegnere la reazione con un eccesso d'acqua.
  4. Asciugare il coprioggetto dalla loro cottura a 110 °; C in forno per 30 minuti.
  5. Preparare un 50:1 metossi: biotina miscela PEG in 100 mM NaHCO 3 pH 8,2. Obiettivo per circa lo 0,2% w / v PEG biotinilato.
  6. Pipettare 100 ul della miscela PEG su un vetrino asciutto silanizzata e posto un altro coprioggetti sopra. Compreso un distanziatore coprioggetto di vetro permette la separazione delle lamelle.
  7. Incubare i coprioggetti nella soluzione di PEG per 3 ore, poi separare ogni coppia di coprioggetto e lavare a lungo con acqua. Fare attenzione a tenere i coprioggetti funzionalizzate verso l'alto come unico lato una volta saranno rivestiti con PEG.
  8. Asciugare il coprioggetto con l'aria e conservare sotto vuoto in essiccatore. Le superfici sono stabili per almeno un mese, in modo da decine di coprioggetto può essere fatta in un batch ed utilizzato secondo necessità.

4. Flusso Camera di preparazione

L'esperimento viene eseguita utilizzando una camera di flusso semplice costruito con un coprioggetto funzionalizzati, nastro biadesivo, una diapositiva quarzo e tubi. Una camera di flusso viene preparato per ogni singola molecola esperimento 2,4.

Materiali: su entrambi i lati del nastro, lametta, scivolo al quarzo con fori per tubi, ad asciugatura rapida epossidica, coprioggetti Functionalized, soluzione di streptavidina (25 ml di 1 mg / ml in PBS), tubi, tampone di bloccaggio (5X: 20 mM Tris pH 7.5, 2 mM EDTA, 50 mM NaCl, 0,2 mg / ml BSA, 0,005% Tween-20), tampone di lavoro (1X: 20 mM Tris-HCl pH 7.5, 2 mM EDTA, 50 mM NaCl).

  1. Inizia miscelazione e l'immissione 5 mL di tampone di bloccaggio e 20 ml di tampone di lavoro in un essiccatore per rimuovere eventuali bolle d'aria per fasi successive.
  2. Prendete un PEG-funzionalizzati coprioggetto e diffusione di PBS-125 una soluzione diluita di streptavidina sulla superficie. Lasciare questo ad incubare per 20 minuti a temperatura ambiente durante la preparazione di altre parti della camera, che permette di legare streptavidina biotins superficie.
  3. Tagliare un pezzo di nastro biadesivo per adattarla alle dimensioni della diapositiva quarzo. Segnare la posizione dei fori tubo sul nastro in modo che il contorno della camera di flusso si possono trarre sul nastro.
  4. Fai di 3 mm di larghezza del canale centrale e rettangoli contenenti entrambi i fori. Noi usiamo il flusso con due camere di aspirazione e due di uscita Y canali.
  5. Tagliare lungo il contorno disegnato, rendendo dritto, tagli netti per assicurarsi che non sporge adesivo nel canale.
  6. Pulire il quarzo accuratamente con acetone o etanolo per rimuovere l'adesivo dalla costruzione precedente cella di flusso.
  7. Trova la migliore allineamento del contorno canale, rimuovere un lato del supporto adesivo e posizionare con attenzione il nastro sul vetrino di quarzo. Prestare attenzione ad allineare il nastro correttamente, come i fori di ingresso e di uscita devono rimanere sbloccato.
  8. Tagliare le lunghezze dei tubi per l'ingresso el'uscita della cella di flusso. Essa aiuta a tagliare l'estremità del tubo a circa 30 ° di inclinazione in modo che il tubo non si stampa contro il fondo piatto della camera. Posizionare i tubi su una sorta di supporto (portaprovette ad esempio) di sospendere la loro per un facile collegamento alla cella di flusso nelle fasi successive.
  9. Sciacquare la streptavidina rivestite coprioggetto accuratamente con acqua e asciugare con aria compressa. Ricordati che solo un lato è funzionalizzati. Rimuovere l'altro lato del supporto a nastro e posto il vetrino di quarzo sul vetrino.
  10. Premere leggermente il vetrino per far uscire l'aria intrappolata nel adesivo. Questo aiuterà a evitare eventuali bolle d'aria di entrare nel canale di flusso.
  11. Sigillare i lati della camera con resina epossidica. Inserire il tubo tagliato nei fori del quarzo e tenuta in posizione con resina epossidica. Questo deve asciugare per qualche minuto.
  12. Una volta asciutto, cominciano bloccando la superficie tirando alcuni dei buffer degasato blocco attraverso uno dei tubi. Un 21-gauge si adatta perfettamente all'interno del tubo di 0,76 mm. Stanare un paio di volte per eliminare le bolle d'aria, e permettere la camera di incubazione per almeno mezz'ora.

5. Singola molecola di replica Experiment

Una volta che il modello di DNA e perline funzionalizzati sono stati preparati, e la camera di flusso è pronto, una singola molecola esperimento può essere eseguita.

Materiali: camera di flusso preparati, tampone di bloccaggio (5X: 20 mM Tris-HCl pH 7.5, 2 mM EDTA, 50 mM NaCl, 1 mg / ml BSA, 0,025% Tween-20), tampone di lavoro (1X: 20 mM Tris-HCl pH 7,5, 2 mM EDTA, 50 mM NaCl), T7 replica buffer con o senza 10mM MgCl 2 (1X: 40 mM Tris-HCl pH 7,5, 50 mM K-glutammato, 2 mM EDTA, 100 mg / ml BSA, 10 mM DTT, 600 mM dNTPs), proteine ​​replica, invertite microscopio ottico con obiettivo 10X, telecamera CCD, permanente di terre rare magnete, pompa a siringa, airspring, illuminatore in fibra, computer con software di acquisizione immagini.

  1. Dopo la cella di flusso è stato bloccato, è pronto per iniziare l'esperimento.
  2. Prendere la cella di flusso e posizionarlo sul palco microscopio. Tenere la camera in posizione con clip stadioed essere sicuri che il canale di flusso è posizionato in allineamento con la camera CCD.
  3. Collegare i tubi di scarico delle cellule di flusso al airspring usando un più grande tubo connettore diametro o un ago. Il airspring viene utilizzata per stabilizzare eventuali irregolarità di flusso. Un tubo di plastica da 50 ml è piena di 45ml di acqua. Il coperchio del tubo è sigillato con resina epossidica. Tre fori sono forate nel coperchio, e tre pezzi di tubi vengono inseriti nel tubo. Utilizzando epossidica, i tubi vengono sigillati per il coperchio, evitando l'aria di entrare o uscire. Il airspring è collegato alla pompa siringa, e ai tubi di uscita della cella di flusso.
  4. Posizionare i tubi di aspirazione della cella di flusso nel tampone di bloccaggio e tirare indietro la siringa per rimuovere l'aria nel tubo. Un film delicato del tubo di uscita aiuterà chiaro eventuali bolle d'aria intrappolate nella cella di flusso.
  5. Una volta che tutte le bolle d'aria sono stati rimossi, bloccare uno dei tubi di aspirazione con un ago, e uno dei tubi di scarico per piegarla per il 1800 e il fissaggio del tubo con nastro adesivo.
  6. Diluire il modello del DNA stock 22:00 in 1 ml di tampone di bloccaggio degasato. Flusso nella camera a portata moderata per consentire una buona copertura della superficie del DNA (0,01-0,05 ml / min per 20 minuti funziona bene). Questo può essere variata in base al numero di molecole di DNA sono sulla superficie di ciascun lotto di coprioggetto o quanti sono voluti per l'esperimento.
  7. Diluire la soluzione stock tallone 2-4x10 6 perle / ml a 1 ml di degasato tampone di bloccaggio. Flusso nella camera di 0,01-0,05 ml / min per 15 minuti.
  8. Una volta perline vengono aggiunti, girare il flusso off camera e permettere di raggiungere l'equilibrio. Quindi chiudere entrambi i tubi di uscita. Eventuali modifiche ai tubi senza la camera chiusa causerà variazioni di pressione che esercitano una grande forza sulla perline e taglio le molecole di DNA legato.
  9. Bloccare il tubo di ingresso che è stato utilizzato per il caricamento perline con un ago, e iniziare a lavare la cella di flusso utilizzando l'ingresso secondo con degasato soluzione 1X tampone di blocco nel buffer di lavoro. Lavare estesamente alla velocità di 0,01-0,05 ml / min. Agitare manualmente la fase toccando di togliere qualunque perline non specifico attaccato alla superficie ( Tapping ).
  10. Una volta liberi perle sono sufficientemente rimosse, girare il flusso off camera e permettere di raggiungere l'equilibrio. Chiudere il tubo di scarico aperto e passare il serbatoio di aspirazione alla soluzione proteica, lentamente aprendo la presa per evitare rapidi cambiamenti di pressione
  11. È possibile controllare se perle sono legati al DNA, modificando la direzione del flusso ( DNA ).
  12. Ora, la reazione enzimatica può essere eseguita. Per i leader filo-esperimenti di sintesi fanno la soluzione 20Nm di gp4 elicasi e la soluzione di 20 nm di GP5 polimerasi (purificata come un complesso con i suoi tioredoxina fattore di processività) in degasato tampone replica T7 che non contiene MgCl 2.
  13. Il flusso di soluzione proteica nella camera a portata moderata per consentire vincolante efficiente al DNA. Noi usiamo 0,037 ml / min per 8 minuti, e poi 0,012 ml / min per 7 minuti.
  14. Lavare la camera con degasato tampone replica T7 senza MgCl 2 per rimuovere le proteine ​​libero. Il tasso di 0,037 ml / min per 3-10 minuti funziona bene.
  15. Dopo il lavaggio, la replica di buffer di flusso T7 con MgCl 2 e iniziare l'acquisizione dati. Utilizzare un flusso di 0,012 ml / min corrispondente a 3 pN sulla forza di resistenza le pastoie del DNA nelle condizioni descritte in questo protocollo.
  16. Inserire una delle terre rare magnete permanente al di sopra della cella di flusso prima di imaging per evitare interazioni aspecifiche tra perle e di superficie.
  17. Visualizza campo con un obiettivo 10X e camera CCD. Messa a fuoco con un cordone legato.
  18. Posizione di un illuminatore fibra con un angolo di incidenza tra i 10 gradi e in parallelo alla fase microscopio vicino al microscopio. Campo scuro illuminazione è usato per aumentare il contrasto nella stampa tallone.
  19. Acquisire dati per 20 30 min a un frame rate lento (di solito 2-4 Hz).

6. Rappresentante Risultati

In un esperimento di successo si dovrebbe essere in grado di osservare più di 100 perle contemporaneamente ( sintesi filone Leading ). L'esperimento dovrebbe produrre numerose tracce visualizzazione leader sintesi del DNA filamento.

Analisi dei dati:

Al fine di misurare i tassi e processivities del DNA di svolgimento e di polimerizzazione, le posizioni precise di perle deve essere determinato. È possibile ottenere inserendo queste posizioni con 2-dimensionale funzioni gaussiana. Traiettorie possono essere estratte dal cordone inseguimento di posizione ad ogni frame utilizzando il software di monitoraggio (DiaTrack ad esempio). Ora siete pronti per visualizzare traiettorie tracciando posizione tallone in funzione del tempo utilizzando qualsiasi immagine in modoftware (per esempio l'origine). Per ottenere dati di frequenza, misura le trame con una regressione lineare e calcolare la pendenza. Per processività, determinare la lunghezza totale del DNA, dall'inizio alla fine di un evento di accorciamento (Figura 3). Entrambi questi numeri dovranno essere convertiti in paia di basi. Per convertire il movimento del tallone paia di basi, in primo luogo è necessario misurare la lunghezza di una molecola di DNA λ tesa alla portata di reazione. Dal momento che la lunghezza del DNA λ è nota (48502 bp) è possibile calibrare il numero di coppie di basi / pixel a forza sperimentale. Per una maggiore precisione, sottrarre dalle tracce di interesse una traccia di base di un cavo di perle che non è enzimaticamente alterato. Combina tutte le misure singole e tasso di trama e distribuzioni processività. Montare i dati utilizzando le funzioni gaussiana e single-esponenziale, rispettivamente (Figura 3).

Figura 1
Figura 1. Singola molecola sperimentale. (A) Duplex λ DNA (48,5 kb) è attaccato alla superficie della cellula che attraverso l'estremità 5 'di un filo con una interazione biotina-streptavidina, e il 3' del filamento stesso è collegato a un tallone utilizzando un digossigenina anti-digossigenina interazione. Una forchetta replica innescato è formata alla fine di fronte al cordone per consentire il caricamento della polimerasi. (B) Bead-DNA assemblee sono allungati con flusso laminare di buffer e ripreso con grande campo microscopia ottica. Tenendo traccia delle posizioni delle perle nel tempo, pur mantenendo una forza costante stretching, le lunghezze dei costrutti di DNA possono essere monitorati. (C) il profilo Estensione di ssDNA (cerchio pieno) e dsDNA (cerchio aperto) con le forze basso. Linea tratteggiata indica la lunghezza cristallografiche di completamente ds-λ DNA, 16,3 micron. La grande differenza di lunghezza tra ssDNA e dsDNA in forze attorno al 3 pN permette l'osservazione diretta di conversioni tra ss-dsDNA e monitorando i cambiamenti nella lunghezza del DNA. La visualizzazione simultanea di grandi quantità di DNA ad accoppiamento di perline permette per lo studio di molte replisomes individuali in un esperimento.

Figura 2
Figura 2 batteriofago T7 proteine ​​replica:. DNA polimerasi (complesso di GP5 e tioredoxina) e DNA elicasi (gp4) sintetizzare DNA che porta alla presenza di deossiribonucleotidi e magnesio. Questo processo è accompagnato da un accorciamento del filamento di DNA in ritardo a causa di avvolgimento. Conversione di dsDNA in posizione ssDNA cambiamenti del tallone. Misurazione posizione del tallone consente la determinazione precisa della velocità e processività della replicazione del DNA.

Figura 3
Figura 3. Esempio di dati tipici di una singola molecola leader filo-esperimento di sintesi. Processività della replicazione del DNA è uguale a una lunghezza totale del DNA, dall'inizio alla fine di un evento di accorciamento. Il tasso di replicazione del DNA si ottiene inserendo la trama con una regressione lineare e calcolare la pendenza. Il tasso di inserto spettacoli e distribuzioni processività che sono stati ottenuti combinando i dati da una serie di misurazioni. I dati sono stati montati utilizzando le funzioni gaussiana e single-esponenziali, rispettivamente.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

E 'importante assicurare che la forza di trascinamento esercitata dal flusso laminare perle non influenza le attività enzimatiche delle proteine ​​di replica. Per esempio, un 3 pN forza che corrisponde ad una portata di 0,012 ml / min non influenza la replicazione del filamento di DNA di primo piano. Si pregiudica tuttavia l'attività enzimatiche che avvengono durante la sintesi del DNA coordinato, e deve quindi essere ridotta a 1,5 pN. La forza di trascinamento può essere facilmente controllato modificando la portata o di una larghezza del canale di flusso 5.

Il test del DNA che si estende impiega differenze di lunghezza tra doppio e singolo filamento di DNA. Nell'esperimento descritto qui la conversione del dsDNA a ssDNA avviene come risultato della sintesi filone principale (Figura 2). Si dovrebbe ricordare che il ssDNA è più breve di dsDNA solo a basse forze che si estende sotto di 6 pN (Figura 1).

Un possibile miglioramento di questo metodo è di modificare il filamento in ritardo di sviluppo del modello replica attaccando un secondo tallone alla sua 3'-end. Tale alternanza permetterebbe l'osservazione diretta di attività enzimatiche che si svolgono in entrambi i filamenti di DNA.

A parte gli studi della sintesi filamento leader e replica coordinato, il DNA che si estende saggio è stato impiegato con successo per esaminare la singola molecola cinetica di esonucleasi λ, e le dinamiche di scambio polimerasi durante la replicazione 5,6. In linea di principio, questo metodo può essere utilizzato per studiare ogni enzima di elaborazione del DNA.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Lo sviluppo del DNA che si estende test è stato aiutato da Paolo Blainey, Lee Jong-Bong, e Samir Hamdan. Questo lavoro è supportato dal National Institutes of Health per borse di Charles Richardson (GM54397), e Antoine van Oijen (GM077248).

Materials

Name Company Catalog Number Comments
Bacteriophage λ DNA New England Biolabs N3011L
DNA Oligonucleotides Integrated DNA Technologies
T4 DNA Ligase New England Biolabs M0202L
T4 Polynucleotide Kinase New England Biolabs M0201L
α-digoxigenin Fab Roche Group 11214667001
Tosyl Activated Beads Invitrogen 142-03
Magnetic Separator Invitrogen Dynal MPC
3-aminopropyl-triethoxysilane Sigma-Aldrich A3648 Other aminosilanes can be used or mixed with non-amine reactive silanes for sparser surfaces
Succinimidyl propionate PEG Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Biotin-PEG-NHS Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Double-sided tape Grace Bio-Lab Inc. SA-S-1L 100 μm thickness
Quartz slide Technical Glass 20 mm (W)x 50 mm (L)x 1mm (H) Size to fit on coverslips. Drill holes with diamond-tip drill bits (DiamondBurs.net)
Polyethylene tubing BD Biosciences 427416 0.76 mm ID, 1.22 OD
Other size tubing can be substituted.
Streptavidin Sigma-Aldrich S4762 Make 1 mg/mL solution, 25 μL aliquots in PBS pH 7.3
Deoxyribonucleotide triphosphate solution mix New England Biolabs N0447
Inverted Optical Microscope with 10X Objective Olympus Corporation Olympus IX-51
Permament rare-earth magnet National Imports www.rare-earth-magnets.com
CCD Camera QImaging Rolera-XR Fast 139
Syringe Pump Harvard Apparatus 11 Plus Operate in refill mode to facilitate solution changes
Fiber Illuminator Thorlabs Inc. OSL1

DOWNLOAD MATERIALS LIST

References

  1. Lee, J. B. DNA primase acts as a molecular brake in DNA replication. Nature. 439, 621-624 (2006).
  2. Tanner, N. A., van Oijen, A. M. Single-molecule observation of prokaryotic DNA replication. Methods Mol Biol. 521, 397-410 (2009).
  3. Sofia, S. J., Premnath, V. V., Merrill, E. W. Poly(ethylene oxide) Grafted to Silicon Surfaces: Grafting Density and Protein Adsorption. Macromolecules. 31, 5059-5070 (1998).
  4. Tanner, N. A., Loparo, J. J., van Oijen, A. M. Visualizing single-molecule DNA replication with fluorescence microscopy. J Vis Exp. (2009).
  5. Hamdan, S. M., Loparo, J. J., Takahashi, M., Richardson, C. C., van Oijen, A. M. Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis. Nature. 457, 336-339 (2009).
  6. van Oijen, A. M. Single-molecule kinetics of lambda exonuclease reveal base dependence and dynamic disorder. Science. 301, 1235-1238 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics