의 유전자 표현 프로필 결정 C. 엘레간스 Microarray 및 실시간 PCR을 사용하여

Biology
 

Summary

Microarray 분석은 유전자 표현의 프로필을 결정하기 위해 실시되었다

Cite this Article

Copy Citation | Download Citations

Guthmueller, K. L., Yoder, M. L., Holgado, A. M. Determining Genetic Expression Profiles in C. elegans Using Microarray and Real-time PCR. J. Vis. Exp. (53), e2777, doi:10.3791/2777 (2011).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

시냅스는 대상 세포에 신호 세포와 postsynaptic 터미널에서 presynaptic 활성 영역으로 구성되어 있습니다. 화학 시냅스의 경우, 메시지는 presynaptic 터미널에서 발표하고 postsynaptic 수용체 세포에 신경 전달 물질에 의해 접수 실시하고 있습니다. Caenorhabditis 엘레간스에있는 우리 이전의 연구는 VSM - 1 부정 exocytosis을 조절하는 것으로 나타났습니다. 또한 vsm - 1 돌연변이에 시냅스의 분석 보여준 완벽한 기능 VSM - 1 증가 시냅스 연결을 부족한 동물. 이러한 예비 조사 결과를 바탕으로, 우리는 가상 그 C. 엘레간스 VSM - 1 synaptogenesis에서 중요한 역할을 수 있습니다. 이 가설을 테스트하려면 두 번 표시 microarray 분석이 수행되었고, 유전자 발현 프로파일이 결정됩니다. 첫째, 총 RNA는 고립되었다, reversely cDNA로 베꼈는데하고, DNA를 microarrays에 hybridized. 그런 다음, 형광 프로브 하이브 리다이 제이션의 인 silico 분석 향상된 synaptogenesis과 돌연변이의 주요 정자 단백질 가족 (MSP)의 회원 코딩 많은 유전자의 중요한 유도을 공개했다. MSPs는 C로 정자의 주요 구성 요소입니다 엘레간스 및 선충류의 oocyte의 성숙과 배란 신호를 나타납니다. 과일 파리에서 차이와 동료 1 MSP 같은 분자가 신경근육학 교차로에서 presynaptic 부통 번호와 크기를 규제 것을 보여주었다. 또한, 쓰다 및 동료에 의해 ​​수행 분석 2 MSPs는 에프 수용체와 트리거 수용체 티로신 키나제의 신호 폭포에 대한 리간드 역할을 수 있습니다 것을 제안했습니다. 마지막으로, 실시간 PCR 분석 MSP - 32에 대한 코딩 유전자가 vsm - 1 (ok1468) 돌연변이의 유발 것을 뒷받침. 함께 찍은, 우리 실험실에 의해 수행 연구 vsm - 1 돌연변이 MSP - 32 신호에 의해 중재 수 시냅스 밀도에 상당한 증가를 가지고 나타났습니다.

Protocol

1. 총 RNA의 분리

  1. 건강한 동기 nematodes는 판 당 2-3 ML을 사용하여 방 온도 M9 매체와 접시 세척하여 수확했다. Resuspended nematodes 4 분 동안 4 ° C에서 원심 분리, 3,200그램 15 ML 원뿔 튜브 및 pelleted 아래로 전학했다. 수확 nematodes는 0.1M NaCl 7 ML 얼음 차가운 60% W / V 자당 7 ML와 펠렛을 resuspending로 떠올 랐 박테리아에서 밖으로 청소했다. resuspended 혼합물은 자당 솔루션을 통해, 4 분 동안 4 ° C에서 3천2백g에서 혼합 centrifuging 후 수집되었던 수영 - 최대 15 분 깨끗한 nematodes위한 얼음 incubated되었습니다. 세균없는 벌레는 살균 pipettes를 사용하여 새 원뿔 튜브로 전송하고 4 3천2백그램의 원심 분리 ° C 2 분 뒤에 최대 15 ML RNase 무료 물로 두 번 씻어했다. 깨끗한 느슨하게 압축 펠렛은 1.5 ML의 microcentrifuge 관에 전송하고 30 초 동안 최대 속도 (10,000 g)에서 centrifuged되었습니다. 마지막으로, 대부분의 RNase없는 물이 제거되었으며 RNAlater 10 볼륨 펠렛에 추가되었고, 4 ° C 보관 진행 준비까지.
  2. 총 RNA 샘플을 준비하려면, 수확 nematodes 4 분 최대 속도 (10,000 g)에 centrifuged되었고 RNAlater가 삭제되었습니다. 그런 다음, 분자 연삭 수지 (bioscience G)의 핀치는 펠렛에 추가되었으며 혼합물은 액체 질소를 사용하여 냉동되었습니다. 냉동 웜 정지는 유봉과 액체 질소로 좋은 분말로 grinded되었고 가루가 차가운 유지하는 데 필요한 같은 추가되었습니다. 연삭 후, 추출물은 5 분 동안 얼음에 보관되었으며 다음 700 μl RLT / BME (비율 RLT 100 볼륨 : BME 1 볼륨)과 함께 혼합 (Qiagen)와 472 μl 100 % 에탄올.
  3. 총 RNA는 RNeasy 미니 키트 (Qiagen)을 사용하여 제조 업체 권장 프로토콜을 다음과 고립되었다. 절연 RNA의 최종 부피는 생물 학적 시료 60 μl했다.

2. DNA의 소화 및 RNA 정리

  1. 잠재적으로 게놈 DNA와 RNA 오염 총 50 μg는 DNase I (Qiagen)를 소화했다. 0.1 U DNase / 1 μg RNA 및 1X 버퍼 RDP를 포함 다이제스트 반응은 10 분 동안 상온에서 incubated했다.
  2. RNA 샘플은 내가 청소 접속 RNeasy MinElute 청소 키트 (Qiagen)를 사용했다 DNase로 처리. 제조 업체에서 권장하는 프로토콜은 다음되었습니다 60 μl 최종 eluted 볼륨이 얻은 것입니다.

3. RNA의 질적 및 양적 분석

  1. RNA 농도는 자외선 분광 광도계의 Nanodrop (써모 과학)를 사용하여 결정되었다.
  2. RNA 샘플의 무결성 아가로 오스의 전기를 사용하여 평가되었다. 간단히, 1 % RNase 무료 아가로 오스의 젤은 1X 북부 최대 Gly 젤 준비 / 실행 버퍼 (앰비온), 1 % RNase 무료 아가로 오스 LE (앰비온) 및 0.5 μg / ML의 ethidium의 브로마이드를 사용하여 준비되었습니다. 젤 polymerizing 동안, RNA 샘플은 50 염료 / 샘플 및 잠복기 샘플을 로딩 ° C를 30 분 Glyoxyl 샘플 5 μl를 추가하여 glyoxylated되었습니다. RNA의 사다리도 glyoxylated과 크기 비교를로드했습니다.

4. cDNA 합성

  1. 각 합성 반응의 경우, 8.4 μg RNA 샘플은 1 μl RT 프라이머 (1 pmole / μl)와 혼합했습니다. 한 샘플 (WT 또는 돌연변이) Cy5 캡처 RT 프라이머를받은, 다른 예제는 Cy3 캡처 RT 프라이머를 (배열 350 라벨링 - 탐지 키트, Genisphere와 함께 제공) 받았습니다. 샘플 혼합물은 75-80에서 온수 10 분 ° C이 후 2-3 분 동안 얼음으로 전달했다.
  2. RNA 샘플 품어, MasterMix (Genisphere)는 다음과 같이 준비하는 동안 각 RT 반응에 대해, 우리는 RT 4 μl 배 반응 완충액, 1 μl dNTP (10 MM 각 dATP, dCTP, dGTP, dTTP), 1 μl Superase을 결합 - 인 RNase 억제제 (배열 350 라벨링 - 탐지 키트, Genisphere와 함께 제공), 1 μl RT 효소 (200 U / μl). 마지막 MasterMix 7 μl는 부드럽게 혼합 각 RNA 샘플에 추가 (소용돌이를 사용하지 않음) 42 2 시간 incubated되었다 ° C.를

5. RNA의 저하와 cDNA 샘플의 정제

  1. cDNA 합성은 3.5 μl 0.5M EDTA (에틸렌 다이아 민 테트라 초산)을 NaOH/50mM (최종 농도)을 추가하여 중지하고 ° C 15 분 65 incubated했다. 그렇다면 반응은 850 밀리미터 트리스 - HCL의 최종 농도에 도달 1M 트리스 - HCL, pH를 8.0을 사용하여 무력화되었다. 마지막으로, WT 및 돌연변이 cDNAs 한 microcentrifuge 관에 결합되었다. 빈 튜브는 73 μl 1X TE 버퍼로 씻어서 cDNA가 포함된 튜브에 추가되었다; 결합 cDNAs 튜브의 최종 볼륨을 130 μl되었습니다.
  2. 혼합 cDNA는 다음과 같은 제조 업체의 프로토콜과 QIAquick PCR의 정화 키트 (Qiagen)를 정화했다. cDNA 정화의 결과 eluted 볼륨은 60 μl되었습니다.

6. 첫 Microarray의 하이브리드화

  1. C. 엘레간스 microarray는 GCAT (운영중 교육을위한 게놈 컨소시엄)를 통해 얻은 슬라이드가에 차단되었습니다0.1 MG / 배 SSC에 ML sonicated 연어 정자 DNA, 0.1 % SDS를 사용하여 1 시간 동안 실온. 차단된 슬라이드는 ddH2O과 하단에 KimWipe과 함께 50 ML 원뿔 튜브에 2천g에서 1 분 centrifuging에 의해 스핀 건조에 찍기로 씻어서되었습니다.
  2. 그런 다음, 2X 포름 아미드 기반의 하이브리드화 버퍼 (Genisphere)는 ° 10 분 C는 크리스탈을 해산에 잘 혼합하여 만에서 1 분 centrifuged G. 55 incubated되었습니다 다음, 25 μl cDNA 샘플은 부드럽게 2X 포름 아미드 기반의 하이브리드화 버퍼 25 μl와 flicking에 의해 혼합되었다. 희석 cDNA 샘플은 15 초 동안 플래시 회전 수집하여 80 ° C 10 분 incubated했다.
  3. 마지막 cDNA는 신중하게 슬라이드를 건드리지 않고 전체 가열 cDNA 샘플을 pipetting하여 슬라이드를 microarray에 hybridized되었다. 예제는 균일하게 부드럽게 주사 바늘을 사용하여 커버 슬립을 낮추는 방법으로 microarray에 확산되었다. 커버 슬립이 완전히 저하되기 전에 커버 슬립 다시 다음 바늘로 낮춘, 다시 뽑아, 장소에 부드럽게 가을 허용 공기 거품의 형성을 최소화했다. 설정 먼저 하이브 리다이 제이션은 슬라이드 아래 ddH 2 O 50 μl와 50 ML 원뿔 관에 가로로 슬라이드를 넣어 최고봉 37 ° C.에서 하룻밤 incubated되었습니다

7. 둘째 하이브 리다이 제이션

  1. Hybridized microarrays은 다양한 온도에서 2X SSC로 세탁했다. 첫째, microarray 슬라이드는 방 온도 2X SSC와 0.2 % SDS를 포함하는 원뿔 튜브로 전송된 및 커버 전표를 제거하기 위해 부드럽게 sloshed. 그런 다음, microarray 슬라이드 55 ° C 2X SSC와 0.2 % SDS를 포함하는 원뿔 튜브에 옮겨 15 분 ° C 55 incubated했다. 다음 슬라이드는 부드럽게 주기적으로 떨고, 15 분 동안 실온에서 SSC를 2X로 전송하고 incubated했다. 마지막 슬라이드가 0.2X SSC로 전송된 정기적으로 부드럽게 떨고, 실온에서 15 분 동안 incubated. 씻은 슬라이드 하단에 KimWipe과 함께 50 ML 원뿔 튜브에서 슬라이드 아래 라벨 쪽을 도입하여 스핀 건조되었으며 2000 G.에서 1 분 centrifuged
  2. 다음 두번째 하이브 리다이 제이션 혼합물은 2X 포름 아미드 기반의 하이브리드화 버퍼 (Genisphere)를 사용하여 준비되었습니다. 하이브리드화 버퍼는 10 분 동안 55 ° C에서 incubated 및 10000에서 1 분 G.를 centrifuged했습니다 형광 시약을 캡처 (Cy3와 Cy5)과 안티 - 페이드 시약은 실온에서 해동하고 photobleaching에서 시약을 보호하기 위해 호일로 덮여 있었다. 다음 하이브 리다이 제이션 단계를 최소화 빛의 노출에 어둠 속에서 실시했다. 2X 포름 아미드 기반의 하이브리드화 버퍼 150 μl은 안티 - 페이드 - 처리 하이브 리다이 제이션 혼합물을 1.5 μl 방지 퇴색 시약과 함께했다.
  3. Cy3와 Cy5가 3 초 vortexed, 15 초 centrifuged되었습니다 시약, 10000 G.를 캡처 둘째 하이브 리다이 제이션 혼합물은 75 μl 방지 퇴색 - 처리 하이브리드화 믹스 60 μl nuclease - 무료 물, 7.5 μl Cy3 캡처 시약 및 7.5 μl Cy5 캡처 시약을 결합 준비했습니다. 둘째 하이브리드화 믹스는 ° C와 가열 혼합 50 μl가 건조 / 세탁 microarray 슬라이드에 매우 신중하게 pipetted했습니다 75 10 분 incubated했다. 균일 microarray에 샘플을 확산하기 위해 커버 전표가 부드럽게 주사 바늘을 사용하여 인하했다. 커버 슬립이 완전히 저하되기 전에 커버 슬립 다시 다음 바늘로 낮춘, 다시 뽑아, 장소에 부드럽게 가을 허용 공기 거품의 형성을 최소화했다. microarray 슬라이드 Hybridizing하면 호일과 ddH 2 O 50 μl으로 덮여 50 ML 원뿔 관에 수평으로 배치되었고 습기 챔버를 만들 수 슬라이드 아래에 추가되었습니다. 두번째 하이브 리다이 제이션은 2~5시간에 대한 37 ° C에서 incubated했다.
  4. 둘째 hybridizing microarray는 어두운 방에서 사용 온도 2X SSC, 0.2 % SDS, 1 ㎜ DTT의 세탁 및 커버 슬립을 제거 부드럽게 sloshed되었습니다. 그런 다음, microarray 55 ° C 2X SSC, 0.2 % SDS, 1 ㎜의 DTT를 포함하는 보상 원뿔 관에 전송하고 55 ° C.에 15 분 동안 incubated되었다 다음 슬라이드는 주기적으로 부드럽게 흔들어 2X SSC, 1 ㎜의 DTT와 실온에서 15 분 동안 incubated을 포함하는 보상 원뿔 튜브로 전송되었습니다. 마지막 슬라이드 0.2X SSC, 1 ㎜의 DTT로 전송하고 부드럽게 주기적으로 떨고, 15 분 동안 상온에서 incubated했다. Microarray 슬라이드는 1 분, 2천그램, 바닥에 KimWipe으로 덮여 50 ML 원뿔 튜브 슬라이드 레이블 쪽 다운 centrifuging에 의해 건조되었다. 드라이 microarray 슬라이드는 데이비슨 대학에서 GenePix 개인 스캐너 모델 4100A를 사용하여 스캔했습니다.

8. Microarray 분석

  1. 스캔 후 얻은 이미지 로리 하이어와 그녀의 학부 학생들이 데이비슨 대학에서 개발된 MAGICTool 소프트웨어를 사용하여 분석했다. 간단히, "프로젝트"탭에서 "새 프로젝트"가 만들어지고 저장되었습니다. "빌드 표현 프로필"탭에서 "로드 이미지 페어"가 선택되고 있던 붉은 이미지 파일 (_635.TIF)는 "레드"로 업로드되어 녹색 이미지 파일 (_532.tif)은 "그린"으로 업로드되었습니다. 그런 다음 "빌드 표현 프로필"탭을 "로드 진 목록", C.를 사용하여 GCAT 웹사이트에서 얻은 엘레간스 유전자 목록 파일이 업로드되었습니다.
  2. Microarray 이미지는 "건설 표현 프로필"탭을 "편집 / 만들기 그리드"옵션을 사용하여 해결하고 gridded되었습니다. "그리드 설정"대화 상자가 격자의 숫자에 대해 "48"을 사용하여 편집한, 명소는 "위에서 아래로" "22 행"각 그리드에 대해 "22 열에" "왼쪽에서 오른쪽으로"번호를합니다. 개인 명소를 쉽게 구별할 수 있었다 때까지 "비율 대비 변경"가 증가하고 그리드에에 확대되었다. 격자 먼저 왼쪽 패널에서 "설정 왼쪽 상단 스팟"를 선택하여 만들어졌습니다. 그런 다음, 왼쪽 상단 지점의 중심은 오른쪽 상단과 하단 지점 로우는 "그리드 1"클릭되었습니다. 이 gridding 절차는 오른쪽 하단 맨 왼쪽으로 진행, 48 격자의 각각에 대해 반복했다. gridding이 완료되었을 때, 현재 그리드는 " '다른 이름으로 현재 그리드 저장"파일 "에 저장되었습니다. 그리드가 성공적으로 저장되었을 때 "완료"탭을가 선택되었다.
  3. 분석에서 어떠한 관련이없는 장소를 제거하려면 "빌드 표현 프로필"탭을가 열렸습니다. 아래의 옵션 "신고 스팟"을 "Gridding 주소 것은"선정되었습니다. 줄무늬 반점이나 배경 형광이 표시되었으며 "파일 탭"아래 "로 현재 깃발 저장"을 선택하여 저장됩니다.
  4. 표시 파일은 "빌드 표현 프로필"탭을 사용하여 원하는 분할 방법으로 "고정 반경"를 선택 세그먼트했다. 반경은 원하는 크기로 설정되었고, "업데이트 데이터는"클릭했습니다. 원형이 gridded 지역 (노란색 사각형) 내에 체류 있는지 확인하기 위해 우리는 위에서 아래로 스크롤하고 오른쪽에서 왼쪽으로 한 번 확인 "표현 프로필 만들기"를 선택했습니다.
  5. 신고 후 남은 명소 각각 녹색 형광 비율 : 분할 동안, 소프트웨어는 레드 계산. "표현"탭에서 "데이터를 조작할" "변환"을 사용하는 것은 선정되었습니다. "변환 데이터"대화 상자는 "logb는 (X)"옵션을, 그리고 B = 2를 입력 곳이 나타났다. "워킹 표현식 파일"의 "표현"탭에서 탐색했다. 야생 유형이 Cy3 (녹색) 캡처 시퀀스를 받아 돌연변이 Cy5 (적색) 캡처 시퀀스를받은있는 실험 들어, 로그 변환 비율의 값은 억압 유전자에 대한 유도하고 부정되었다 유전자에 대한 긍정했다.
  6. 마지막으로, 지정된 요소를 기준으로 유도하거나 억압 유전자는 "표현"탭 아래 "보기"를 선택 분석했다. "탐험"대화 상자에서 '맥스. 값이> X (긍정 유발 유전자에 대한 번호) "또는"분. 값이 <X (억압 유전자에 대한 음수) "에 함께 유전자로 설정했다"기준과 일치하는 유전자를 찾기 " # 5에서 설명한 것과 같이 실험. 접이식 표현은 'X'가 선정 기준에 입력한 숫자의 가치를 어디에, 2X와 동일했다.

9. cDNA 합성 및 실시간 PCR

  1. 총 RNA는 이전에 설명한대로 고립되었다. 격리된 RNA의 품질과 수량이 결정되었습니다되면, cDNA는 cDNA 합성 iScript 키트 (BioRad), 야생 유형 및 돌연변이, 그리고 제조 업체 권장 프로토콜에서 격리 500 μl / NG 총 RNA를 사용하여 합성되었다.
  2. 실시간 PCR 반응은 IQ SYBR 녹색 Supermix (BioRad), 100-500 nmoles 유전자 특정 primers (표 1) 이전 단계에 의해 만들어진 4 μl cDNAs를 이용하여 설정되었다. 10 μl 반응은 thermocycler CFX96 리얼 타임 시스템 (BioRad)를 사용하여 실행되었습니다.
  3. thermocycler 먼저 ° C 3 분 95 가열되었다. 이것은 5 초 동안 95 ° C에서 단계와 58 ° C 30 초 동안 다음되었다. 이 루프는 마흔 총 회 완료하고, 0.5도 정도의 기울기와 65-95 ° C 용융 곡선도 삽입되었습니다. ΔΔCT 값은 컨트롤을 피해 3 가사 유전자 (ACT - 1, CDC - 42 및 PMP - 3)를 사용하여 계산되었다.
FORWARD 프리머 역방향 프라이머
GST - 5 CTGCTCCATTCGGACAACTT TCCGTTGAGCTTGAACTCAC
GST - 9 GGAAGACAACTGGCACAATC ACCGAGAGCATCAACTTGAG
kcnl - 1 TACGCTCGGCATGTGTTGTATC CCAATCATCGGCTCCACTATCT
KSR - 2 CGAACTGCTGCTGGAATGCT GTGCTGCGTCTCTTCTGCTT
림 - 9 CTCATCGAGTGGCTCAATCT CACCTTGCTCCATCTTCAAC
LPR - 6 CAGCAGTCACTTCTGTTCAC TCTCCAATAGCGGTACTCC
MES - 6 TTGTTCCGTTGGCTCACGTACAG CGACAGACGCAGATACACGATCA
MSP - 32 GCCGCACAGGTATGATCCAG ATCCAATACGGCGAGCCGAG
MSP - 142 GATCCACCATGTGGAGTTCT GATTCTTGCGACGGACCATA
MSP - 38 GCCTTCGGACAAGAGGATACC CCATACCGTCTCCTTGGAACC
MSP - 45 TCACCGTTGAGTGGACCAAT ACGAACCAACCGTCTCCTT
MSP - 49 CGACGACAAGCACACCTACCACATCAA TCGAGGACTCCACATGGTGGATCAACT
MSP - 56 CGAAGATCGTCTTCAATGCGCCATAC TCCACATGGTGGATCAACTCCAAGTC

앞으로 표 1.과 실시간 PCR을위한 프리머 순서를 역방향

10. 대표 결과 :

RNA 격리 및 분석

presynaptic 사이트에서 활성화 영역의 전구체 vesicles의 융합은 synaptogenesis 동안 필수 단계 (3)입니다. VSM - 1, 최근에 확인된 V - 스내어 마스터 단백질은 불확 실한 메커니즘 (4, 우리되지 않은 작업)에 의해 nematodes에서 효모와 synaptogenesis에 소포의 융합을 (그림 1 참조) 억제하기 위해 제안되었다. 더 기본적인 분자 경로를 이해하기 위해서는 VSM - 1 nematodes에서 규제하고 synaptogenesis 필드에 어떤 빛을 가지고, 우리는 게놈 - 와이드 스크린을 시작 주요 정자 단백질 유전자 (MSP)가 완벽하게 기능 VSM - 1의 부재에 유발되는 결정 .

C.의 vsm - 1 (ok1468) 돌연변이 스트레인에 유도된 유전자를 조사 엘레간스, 우리는 microarray 유전자 분석을 실시했다. 이것은 야생 유형에서 격리 증명서 및 vsm - 1 돌연변이 변형을 테스트하고 농축을 결정함으로써 이루어졌다. 특히, 우리가 처음 동기 L4와 L3 야생 유형과 vsm - 1 돌연변이 애벌레의 nematodes에서 총 RNA를 분리. 그렇다면, 우리는 DNase I로 얻은 총 RNA를 취급 아가로 오스 겔 전기 영동을 사용하여 추출한 RNA의 품질을 조사. 그림 2에 표시된 실험에서, 사다리는 표준 기본 쌍의 개수를 나타내는 가장 먼저 차선에 사용되었다. 와일드 타입 샘플 사전 처리와 DNase와 사후 처리가 나는 차선 2, 4로드하고, vsm - 1 돌연변이 샘플 사전 처리와 내가 각각 차선 3과 5에로드되었습니다 DNase와 사후 처리되었습니다. RNA 젤 전기 영동 분석은 양질의 온전하고 있다고 야생의 종류와 vsm - 1 돌연변이 RNA 샘플을 보여주었다. 이것은 ribosomal RNA의 두 subunits를 나타내는 두 그룹을 관찰에 의해 결정되었다.

Microarray의 하이브리드화

RNA의 품질이 결정되었습니다되면, 우리는 cDNA 합성과 함께 진행. 이렇게하려면, 우리는 mRNA를 베꼈는데 반대하고 꼬리에 캡처 시퀀스를 추가했습니다. Cy3와 Cy5에 대한 캡처 시퀀스를 포함하는 생산 cDNAs은 슬라이드를 microarray에 hybridized 및 스캔을 위해 퇴장했다. Microarray 이미지는 다음 로리 하이어와 그녀의 학부 학생들이 데이비슨 대학에서 개발한 MAGICTool라는 오픈 소스 컴퓨터 소프트웨어 프로그램에 입력했다. 이 소프트웨어를 사용하여 우리는 Cy3와 Cy5 이미지, gridded microarrays 및 분석 형광 프로파일 (그림 3 참조) 입혔다. 일단 gridding은 각 사각형은 전체 인쇄 oligonucleotide를 검토하고 확실하게 우리가 다음 세그먼트 완료되었습니다. 그럼 우리가 유도 비율을 분석하고 MSP 가족에 대한 코딩 유전자가 강화된 synaptogenesis와 nematodes에서 유도되는 유전자 보여주 프로필 표정을 만들었습니다. (표 3).

검증 및 실시간 PCR을 사용하여 유전자 발현의 부량.

MSP 가족의 구성원에 대한 코드를 실시간 PCR을 사용하는 것이 더욱 vsm - 1 돌연변이의 유전자 프로파일을 이해하기 위해서 우리는 유전자의 숫자를 분석했다. 첫째, 총 RNA는 야생 유형과 vsm - 1 (ok1468) 돌연변이 종자로부터 격리되었다. RNA 샘플은 다음 reversely cDNAs에 베꼈는데 실시간 PCR 분석에 사용되었다. 실시간 PCR 표현 프로필 평가 MSP 가족 중 하나가 구성원 vsm - 1 (ok1468) 돌연변이의 유발 것으로 보인다 것을 보여주었다. 또한, 실시간 PCR 데이터는 연구 결과를 검증microarrays에서 한 MSP 유전자 후보 (그림 4)로 검색 결과를 좁혀.

그림 1
그림 1. A. UNC - 17 Immunostaining는 vsm - 1 돌연변이 등의 신경 코드를 따라 높은 시냅스 밀도를 전시하는 것으로 나타났습니다. 이미지는 외음부에 후부 63x 배율 (오른쪽)에서 분석했다. WT 및 vsm - 1 (ok1468)의 B. 분석 돌연변이 시냅스는 vsm - 1 돌연변이 (** P <0.01)에서 통계적으로 의미있는 향상 시냅스 밀도 표시됨. 스물 nematodes 각 유전자형에 대한 이미지를했다.

그림 2
그림 2. 추출한 RNA의 품질 아가로 오스 겔 전기 영동을 사용하여 결정되었다. DNase I 처리 이전과 이후 두 그대로 ribosomal subunits의 존재는 와일드 입력하고 vsm - 1 (ok1468) 시료에서 추출한 RNA에 분명했다.

그림 3
그림 3. A. 컨트롤이 빨간색 (Cy5) 표시했습니다 실험 vsm - 1 돌연변이에 대한 Microarray 이미지는 녹색 (Cy3) 표시했습니다. microarray 분석 당 48 그리드 1을 보여주는 B. 대표 이미지. 그리드의 각 작은 정사각형은 단일 인쇄 oligonucleotide의 대표, 각 격자 22 행, 22 열에 의해 구성되어있다.

표 2
애벌레 4 (A)와 애벌레 3 (B) C.으로부터 격리 성적 표 2. Microarray 분석 엘레간스의 nematodes은 주요 정자 단백질에 대한 코딩 유전자가 강화된 synaptogenesis와 돌연변이에 유도되는 보여주었다. 강조 유전자 애벌레의 유충 3 4 모두에서 유도된 유전자를 나타냅니다.

그림 4
그림 4. MSP 유전자 가족 MSP -32 한 회원이 vsm - 1 (ok1468) 돌연변이의 유발 것을 보여주 실시간 PCR 분석. 대표 정규 접어 표현 그래프는 VMS는 - 1 야생 유형 (WT) 세 가사 유전자에 비해 MSP - 32 ΔΔCT 값이 크게 다른 (ok1468)이 (ACT - 1, CDC - 42, 그리고 PMP 정상화를 위해 사용하는 것을 보여줍니다 -3). 표준 편차 - 세 복제본의 평균 + / 해본 있습니다.

Discussion

본 연구에서는 다양한 생물 학적 현상을 기본 결정 유전자 발현 프로필을 사용할 수있는 쉽고 사용자 친화적인 프로토콜을 개발했습니다. 이 프로토콜에서 총 RNA가 먼저 격리와 RNA의 분리 우리의 방법은 크게 페놀 extractions를 생략하고 5,6 정리를위한 화성 수지를 사용하여 간단하게되었습니다 DNase I.를 사용하여 치료했습니다. 간단히, C. 엘레간스의 cuticule 및 세포 세포막은 액체 질소와 분자 수지로 분쇄와 냉동 nematodes에 의해 금이 - 오픈되었습니다. 다음 추출된 RNA는 cDNA 합성 전에 DNase I로 치료했다. 나중에 단계는 unspecific hybridizations을 최소화하기 위해 추가되었다; 게놈 DNA와 RNA 오염된 샘플 간섭을 소개하고 많은 거짓 - 반응을 생산 수 있습니다. 그런 다음, 야생 입력하고 vsm - 1 (ok1468) 돌연변이의 cDNAs은 Cy3와 Cy5 캡처 시퀀스 태그와 C.로 hybridized되었다 엘레간스의 microarrays은 GCAT 프로그램을 통해 얻은. 이 시스템은 유사 제품보다 더 민감하고, 그 두 색상의 디자인은 큰 시간과 비용 효율 7,8의 결과, 필요한 배열의 수를 감소시킵니다. 또한이 시스템은 다른 유사한 시스템의 전문 장비가 필요하지 않으므로,이 절차는 표준 실험실 설정 7 수행할 수 없습니다. 셋째, 형광 hybridized 배열 이미지는 오픈 소스 소프트웨어 MAGICTool를 사용하여 분석되었고, 유전자 발현 프로파일이 만들어졌습니다. MAGICTool은 학부에서 포스트 박사로, 쉽게 모든 경험 수준의 개인에 의해 활용되는 사용자 친화적인 프로그램입니다. 그러나, 최적의 성능은 대용량 메모리 가용성을 필요로합니다. 마지막으로, 후보 유전자 실시간 PCR과 검증되었습니다 microarray 분석을 사용하여 획득하였습니다.

게놈 접근 방식이 생물 학적 현상을 연구를위한 효율적인 방법에도 불구하고, 하나는 고려 소요됩니다 몇 가지 제한이있다. 인쇄 oligonucleotide가 보존 시퀀스에서 가져온 경우 첫째,이 microarray 프로토콜의 특이성에도 불구하고, 가족 내에서 성적은 서로 구별할 수 있습니다. 실시간 PCR은 유전자 가족 내에서 공통점에 대한 보상, 심지어 같은 유전자의 특정 isoforms 구별 수 있습니다. 그러나, 실시간 PCR과 동일하게 생명체의 수명에 걸쳐 표현 진정한 컨트롤을 찾기 위해 도전입니다. 이 때문에, 결과는 상대적인 것입니다. proteomic 접근은 우리의 기술을 하나의 대안입니다. 개별 단백질은 2D 겔 전기 영동과 질량 분석계로 확인을 사용하여 격리 수 있습니다.

우리의 연구는 특히 주요 정자 단백질 (MSP) 가족의 여러 구성원이 향상된 시냅스 밀도 vsm - 1 돌연변이 nematodes에서 유도되는 보여줍니다. MSPs는 C.에 고유한 엘레간스 및 oocyte의 성숙과 배란에 대한 책임이 있습니다. 차이 1 과일 파리의 신경근육학 교차점에서 presynaptic 부통 번호 및 크기의 조절 가능성이 주요 정자 단백질 도메인을 포함하는 분자에 의해 제어됩니다 것을 보여주었다. 쓰다 및 동료에 의해 ​​연구는 2 개의 주요 정자 단백질 도메인 수용체 티로신 키나제 신호 폭포를 실행, Ephrine 수용체에 대한 리간드 역할을 수 증명하고있다. 또한, 실시간 PCR 분석 확인 및 MSP 가족, MSP - 32 중 하나를 회원에게 microarray 결과를 좁혀. 함께 촬영, 여기에서 제시한 작품은 중앙 신경 과학의 딜레마의 게놈 차원의 분석뿐만 아니라 과학적 노력의 학부 연구의 파워를 나타냅니다.

Disclosures

관심 없음 충돌 선언하지 않습니다.

Acknowledgments

이 작품은 사우스 웨스턴 오클라호마 주립 대학, 웨더 확인에서 학부 학생들이 수행되었다. 이 작품은 루이 NSF - 0963258, NIH OK - INBRE 2P20RR016478, GCAT 및 OCAST HR09 - 137S에 의해 지원되었다.

vsm1 (ok1468) 돌연변이가 오클라호마 진 넉아웃 컨소시엄에 의해 고립되었다.
저자는 프로젝트 수행 중에 귀중한 도움을 댄 Stefanovic와 태너 휠러 감사드립니다.

Materials

Name Company Catalog Number Comments
RNA Later Ambion AM7020
Molecular Grinding Resin G-Biosciences 786-138
RNeasy Mini Kit Qiagen 74104
Rnase-free Agarose LE Ambion AM9040
NorthernMax Gly 10X Gel Prep/Running Buffer Ambion 8678
RNA Millenium Marker Ambion AM7150
Glyoxal Sample Loading Dye Ambion 8551
DNase set Qiagen 79254
RNeasy MinElute Kit Qiagen 74204
RT Enzyme and 5X Reaction Buffer Genisphere RT300320
Array 350 Genisphere W300180
QIAquick PCR Purification Kit Qiagen 28104
20X SSC VWR international 82021-4846
Sheared Salmon Sperm DNA Ambion AM9680
SDS Solution Promega Corp. V6551
DTT EM VWR international 3860
iScript cDNA Synthesis Kit Bio-Rad 170-8890
iQ SYBR Green Supermix Bio-Rad 170-8880

DOWNLOAD MATERIALS LIST

References

  1. Chai, A., Withers, J., Koh, Y. H., Parry, K., Bao, H., Zhang, B., Budnik, V., Pennetta, G. hVAPB, the causative gene of a heterogeneous group of motor neuron diseases in humans, is functionally interchangeable with its Drosophila homologue DVAP-33A at the Neuromuscular Junction. Hum Mol Genet. 17, 266-280 (2008).
  2. Tsuda, H., Han, S. M., Yang, Y., Tong, C., Lin, Y. Q., Mohan, K., Haueter, C., Zoghbi, A., Harati, Y., Kwan, J., Miller, M., Bellen, H. J. The Amyotrophic Lateral Sclerosis 8 protein VAPB is cleaved, secreted, and acts as a ligand for Eph receptors. Cell. 133, 963-977 (2008).
  3. Dresbach, T., Torres, V., Wittenmayer, N., Altrock, W. D., Zamorano, P., Zuschratter, W., Nawrotzki, R., Ziv, N. E., Garner, C. C., Gundelfinger, E. D. Assembly of Active Zone Precursor Vesicles. Journal of Biological Chemistry. 281, 6038-6047 (2005).
  4. Lustgarten, V., Gerst, J. E. Yeast VSM1 Encodes a v-SNARE Binding Protein That May Act as a Negative Regulator of Constitutive Exocytosis. Molecular and Cellular Biology. 19, 4480-4494 (1999).
  5. Viñuela, A., Snoek, L., Riksen, J., Kammenga, J. Genome-Wide Gene Expression Analysis in Response to Organophosphorous Pesticide Chlorpyrifos and Diazinon in C. elegans. PloS one. 5, 1-8 (2010).
  6. Niwa, R., Hada, K., Moliyama, K., Ohniwa, R., Tan, Y., Olsson-Carter, K., Chi, W., Reinke, V., Slack, F. C. elegans sym-1 is downstream target of the hunchback-like-1 developmental timing transcription factor. Cell Cycle. 8, 4147-4154 (2009).
  7. Kershner, A., Kimble, J. Genome-wide analysis of mRNA targets for Caenorhabditis elegans FBF, a conserved stem cell regulator. PNAS. 107, 3963-3941 (2010).
  8. Hammock, E., Eagleson, K., Barlow, S., Earls, L., Miller, D., Levitt, P. Homologs of genes expressed in Caenorhabditis elegans GABAergic neurons are also found in the developing mouse forebrain. Neural Development. 5, 1-14 (2010).

Comments

2 Comments

  1. Thanks for the informative material. Could you post something about RealTime PCRs and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM
  2. Thanks for the informative material. Could you post something about http://www.fluoresentric.com/">RealTime PCTR and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics