تحديد ملامح التعبير الجيني في C. ايليجانس استخدام ميكروأري وPCR الوقت الحقيقي

Biology
 

Summary

وقد أجري تحليل لتحديد ميكروأري ملامح التعبير الجيني في

Cite this Article

Copy Citation | Download Citations

Guthmueller, K. L., Yoder, M. L., Holgado, A. M. Determining Genetic Expression Profiles in C. elegans Using Microarray and Real-time PCR. J. Vis. Exp. (53), e2777, doi:10.3791/2777 (2011).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

وتتكون من نقاط الاشتباك العصبي قبل المشبكي منطقة نشطة في الخلية إشارات ومحطة بعد المشبكي في الخلية المستهدفة. في حالة المشابك الكيميائية ، وتنفذ على رسائل كتبها العصبية أطلق سراحهم من قبل المشبكي والمحطات التي تلقتها المستقبلات على الخلايا بعد المشبكي. وقد أظهرت أبحاثنا السابقة في ايليجانس انواع معينة أن VSM - 1 ينظم سلبا إيماس. بالإضافة إلى ذلك ، أظهر تحليل نقاط الاشتباك العصبي في المسوخ 1 - VSM أن الحيوانات التي تفتقر إلى وظيفية بالكامل اتصال متشابك VSM - 1 قد زادت. بناء على هذه النتائج الأولية ، ونحن افترضنا أن جيم قد ايليجانس VSM - 1 تلعب دورا حاسما في synaptogenesis. لاختبار هذه الفرضية ، تم إجراء تحليل المزدوج المسمى ميكروأري ، وتحددت ملامح التعبير الجيني. أولا ، تم عزل الحمض النووي الريبي مجموع كتب reversely ل[كدنا] ، وتهجين للميكروأرس الحمض النووي. ثم ، كشف في والسيليكو تحليل التهجين التحقيق الفلورسنت تحريض كبير من العديد من الجينات الترميز لأفراد من عائلة الحيوانات المنوية البروتين الرئيسية (حركة مجتمع السلم) في المسوخ مع synaptogenesis المحسنة. المشروعات المتوسطة الحجم هي مكون رئيسي من الحيوانات المنوية في C. ايليجانس ويبدو أن الإشارة نضوج البويضة والديدان الخيطية الإباضة. في ذباب الفاكهة ، تظاهر تشاي وزملاؤه MSP (1) التي تشبه جزيئات قبل المشبكي تنظيم عدد وحجم حبة عند تقاطع العصبية والعضلية. وعلاوة على ذلك ، اقترح تحليل أجراه تسودا وزملاء العمل 2 المشاريع متوسطة الحجم التي قد تكون بمثابة يغاندس لمستقبلات أفسس والتيروزين كيناز الزناد شلالات مستقبلات الإشارة. وأخيرا ، أكد تحليل PCR الحقيقي الوقت الذي يتم بفعل الجين الترميز لMSP - 32 - 1 في VSM (ok1468) المسوخ. أخذت معا ، وقد أظهرت الأبحاث التي يقوم بها المختبر في أن VSM - 1 المسوخ وزيادة كبيرة في كثافة متشابك ، والتي يمكن بوساطة إشارات MSP - 32.

Protocol

1. عزل الحمض النووي الريبي المجموع

  1. كانت تحصد صحية الديدان الخيطية متزامنة مع لوحات عن طريق الغسيل المتوسطة M9 درجة حرارة الغرفة ، وذلك باستخدام 2-3 مل لكل لوحة. تم نقل النيماتودا معلق لأنابيب مخروطية 15 مل وهبوطا مكعبات بواسطة الطرد المركزي ، 3200 غرام عند 4 درجة مئوية لمدة 4 دقائق. وتم تنظيف الديدان الخيطية التي تحصد الخروج من البكتيريا التي طرحتها إعادة التعليق على بيليه مع 7 مل من كلوريد الصوديوم 0.1M و 7 مل من الجليد الباردة السكروز ث / ت 60 ٪. وقد حضنت الخليط معلق على الجليد لمدة 15 دقيقة والديدان الخيطية النظيفة ، والتي تسبح المتابعة من خلال حل السكروز ، وجمعت بعد الطرد المركزي في الخليط ز 3200 في 4 درجة مئوية لمدة 4 دقائق. تم نقل البكتيريا خالية من الديدان إلى أنبوب مخروطي الشكل الجديد باستخدام ماصات معقمة وغسلها مرتين مع ما يصل الى 15 ريبونوكلياز المياه خالية مل تليها الطرد المركزي ز 3200 عند 4 درجة مئوية لمدة 2 دقيقة. تم نقل بيليه نظيفة ضغط فضفاضة إلى 1.5 مل أنبوب microcentrifuge وطرد في السرعة القصوى (حوالي 10000 ز) لمدة 30 ثانية. أخيرا ، تمت إزالة معظم ريبونوكلياز خالية من المياه ، وتمت إضافة 10 مجلدات من RNAlater لبيليه ، وتخزينها في 4 درجات مئوية حتى على استعداد للمضي قدما.
  2. لتحضير عينات الحمض النووي الريبي مجموع ، وطرد الديدان الخيطية التي تحصد في السرعة القصوى (حوالي 10000 ز) لمدة 4 دقائق ، وكان تجاهل RNAlater. ثم ، تم إضافة قليل من الطحن الراتنج الجزيئية (G العلوم الحيوية) إلى بيليه وجمد الخليط باستخدام النيتروجين السائل. وكان تعليق دودة مطحون المجمدة الى مسحوق ناعم مع النيتروجين السائل ومدقة وأضيف ما يلزم للحفاظ على مسحوق الباردة. بعد طحن ، وأبقت على الجليد استخراج لمدة 5 دقائق ثم يخلط مع 700 RLT ميكرولتر / BME (نسبة 100 حجم RLT : 1 حجم BME) (Qiagen) و 472 ميكرولتر الإيثانول بنسبة 100 ٪.
  3. تم عزل الحمض النووي الريبي مجموع باستخدام مجموعة صغيرة RNeasy (Qiagen) ، وبعد بروتوكول الصانع الموصى بها. وكان الحجم النهائي من الحمض النووي الريبي معزولة 60 ميكرولتر لكل عينة بيولوجية.

2. هضم الحمض النووي الريبي وتنظيف

  1. وكان يهضم 50 ميكروغرام من الحمض النووي الريبي مجموع يحتمل أن تكون ملوثة مع الحمض النووي الجيني مع أنني الدناز (Qiagen). وكانت ردود الفعل المحتضنة هضم تحتوي على 0.1 الدناز U / 1 ميكروغرام RNA و1X RDP العازلة في درجة حرارة الغرفة لمدة 10 دقيقة.
  2. عينات من الحمض النووي الريبي تعامل مع الدناز كنت نيراتوفيتشي باستخدام RNeasy MinElute تنظيف كيت (Qiagen). وأعقب البروتوكولات التي أوصى بها الشركة المصنعة وحصلت 60 ميكرولتر حجم eluted النهائي.

3. النوعي والكمي تحليل الحمض النووي الريبي

  1. وقد تقرر تركيز الحمض النووي الريبي باستخدام Nanodrop معمل الأشعة فوق البنفسجية (الحرارية العلمية).
  2. تم تقييم سلامة عينات الحمض النووي الريبي باستخدام agarose الكهربائي. لفترة وجيزة ، تم إعداد 1 ٪ خالية من المواد الهلامية ريبونوكلياز agarose باستخدام 1X الشمالية ماكس الغليسين جل الإعدادية / العازلة العدو (Ambion) ، 1 ٪ ريبونوكلياز خالية Agarose جنيه (Ambion) و 0.5 ميكروغرام / مل بروميد إيثيديوم. بينما كان جل البلمرة ، وعينات من الحمض النووي الريبي glyoxylated بإضافة 5 ميكروليتر من عينة Glyoxyl تحميل صبغ / العينات وعينات يحتضنها عند 50 درجة مئوية لمدة 30 دقيقة. وكان أيضا glyoxylated RNA سلم وتحميلها للمقارنة الحجم.

4. [كدنا] التجميعي

  1. لكل فعل التوليف ، كانت مختلطة 8.4 ميكروغرام عينة الحمض النووي الريبي مع 1 ميكرولتر RT التمهيدي (1 pmole / ميكرولتر). تلقت عينة واحدة (WT أو متحولة) وCy5 التمهيدي RT التقاط ؛ العينة الأخرى التي وردت في Cy3 التمهيدي RT التقاط (المتوفرة مع مجموعة صفيف العلامات كشف 350 ، Genisphere). وكانت ساخنة خليط العينة في 75-80 درجة مئوية لمدة 10 دقائق ونقلها إلى الجليد لمدة 2-3 دقائق.
  2. في حين تم إعداد عينات من الحمض النووي الريبي احتضان ، وMasterMix (Genisphere) على النحو التالي : لكل فعل RT ، ونحن معا 4 ميكرولتر الاحتياطي للرد 5X RT ، 1 dNTP ميكرولتر (10 ملي كل dATP ، dCTP ، dGTP ، dTTP) ، 1 Superase ميكرولتر وفي ريبونوكلياز - المانع (المتوفرة مع مجموعة صفيف العلامات كشف 350 ، Genisphere) ، 1 ميكرولتر RT انزيم (200 ش / ميكرولتر). الماضي ، تمت إضافة 7 ميكرولتر من MasterMix لكل عينة الحمض النووي الريبي ، مختلطة بلطف (لا تستخدم الدوامة) وحضنت 2 ساعة على 42 درجة مئوية.

5. RNA تدهور وتنقية للعينات [كدنا]

  1. أوقف التوليف [كدنا] بإضافة 3.5 ميكرولتر 0.5M NaOH/50mM EDTA (تركيز النهائي) وحضنت في 65 درجة مئوية لمدة 15 دقيقة. ثم ، تم تحييد ردود فعل به 1M تريس ، حمض الهيدروكلوريك ، ودرجة الحموضة 8.0 للوصول إلى التركيز النهائي من 850 ملي تريس ، حمض الهيدروكلوريك. أخيرا ، تم الجمع بين وزن وcDNAs متحولة إلى أنبوب microcentrifuge واحد. وتشطف أنبوب فارغ مع 73 ميكرولتر العازلة TE 1X ويضاف إلى الأنبوب تتضمن [كدنا] ، والحجم النهائي من الأنبوب cDNAs مجتمعة هو 130 ميكرولتر.
  2. والمنقى [كدنا] مختلطة بروتوكول المصنعة التالية وتنقية PCR QIAquick كيت (Qiagen). بلغ حجم الناتج eluted تنقيته من [كدنا] 60 ميكرولتر.

6. أول ميكروأري التهجين

  1. سدت جيم ايليجانس ميكروأري الشرائح التي تم الحصول عليها من خلال GCAT (الجينوم كونسورتيوم لتدريس أحدث) فيدرجة حرارة الغرفة لمدة 1 ساعة باستخدام 0.1 ملغ / مل الحيوانات المنوية السلمون sonicated الحمض النووي في SSC 3X ، 0.1 ٪ SDS. وتشطف الشرائح حظره بواسطة غمس في ddH2O وتدور المجفف بواسطة الطرد المركزي لمدة 1 دقيقة في 2000 غرام في أنابيب مخروطية 50 مل مع KimWipe في القاع.
  2. ثم ، كان المحتضنة 2X العازلة التهجين formamide المستندة (Genisphere) عند درجة حرارة 55 مئوية لمدة 10 دقيقة ، تمتزج جيدا لإذابة البلورات وطرد لمدة 1 دقيقة عند 10000 ز المقبل ، كانت مختلطة بلطف 25 عينة [كدنا] ميكرولتر بواسطة عبها مع 25 ميكرولتر من المنطقة العازلة 2X التهجين formamide مقرا لها. وجمعت عينة [كدنا] المخففة التي تدور فلاش لمدة 15 ثانية والمحتضنة في 80 درجة مئوية لمدة 10 دقيقة.
  3. الماضي ، كان لتهجين [كدنا] [ميكروأري الشريحة بواسطة بعناية pipetting كامل عينة [كدنا] ساخن دون لمس الشريحة. انتشر بشكل موحد على عينة من ميكروأري بلطف عن طريق خفض زلة تغطية باستخدام إبرة المحقنة. قبل أن خفضت تماما انزلاق الغطاء ، وكان انسحب زلة تغطية الظهر ، ثم خفضت مع الإبرة مرة أخرى ، والسماح لها بأن تقع برفق في مكانه ، والتقليل من تشكيل فقاعات الهواء. وقد توجت التهجين الاولى التي شكلتها وضع الشريحة أفقيا في أنبوب مخروطي 50 مل مع 50 ميكرولتر من DDH 2 O أدناه الشريحة والمحتضنة ليلا 37 درجة مئوية.

7. الثانية التهجين

  1. وجرفت المياه ميكروأرس المهجنة مع SSC 2X في درجات حرارة مختلفة. أولا ، تم نقل الشرائح ميكروأري لأنابيب مخروطية تحتوي على درجة حرارة الغرفة و2X SSC SDS 0.2 ٪ ومخاض بلطف لإزالة انزلاق الغطاء. ثم تم نقل الشرائح ميكروأري لأنابيب مخروطية الشكل تحتوي على 55 درجة مئوية و2X SSC SDS 0.2 ٪ وحضنت في درجة حرارة 55 مئوية لمدة 15 دقيقة. المقبل ، ونقل الشرائح إلى 2X SSC وحضنت في درجة حرارة الغرفة لمدة 15 دقيقة ، والهز برفق بشكل دوري. الماضي ، تم نقل الشرائح إلى محكمة أمن الدولة 0.2X والمحتضنة لمدة 15 دقيقة في درجة حرارة الغرفة ، والهز برفق بشكل دوري. وكانت تغسل الشرائح تدور المجفف عن طريق إدخال جانب العلامة لأسفل الشرائح في أنابيب مخروطية 50 مل مع KimWipe في القاع ، وطرد لمدة 1 دقيقة على 2000 غرام.
  2. وقد أعد المقبل ، خليط التهجين الثاني باستخدام التهجين formamide 2X العازلة على أساس (Genisphere). وقد حضنت العازلة التهجين في 55 درجة مئوية لمدة 10 دقائق ، وطرد لمدة 1 دقيقة عند 10000 ز القبض على الكواشف فلوري (Cy3 وCy5) وتم إذابة الكاشف مكافحة تتلاشى في درجة حرارة الغرفة ومغطاة احباط لحماية الكواشف من photobleaching. تم تنفيذ الخطوات التالية التهجين في الظلام إلى التقليل من التعرض للضوء. وقد تم جمع 150 ميكرولتر من 2X العازلة التهجين formamide المستندة مع 1.5 كاشف مكافحة تتلاشى ميكرولتر لجعل الخليط التهجين مكافحة تتلاشى المعاملة.
  3. القبض على الكواشف وvortexed Cy3 وCy5 لمدة 3 ثوان ، وطرد لمدة 15 ثانية ، 10000 غرام. أعد الثانية خليط يجمع بين التهجين 75 ميكرولتر مزيج التهجين مكافحة تتلاشى المعاملة ، و 60 ميكرولتر nuclease المياه خالية ، 7.5 ميكرولتر كاشف التقاط Cy3 ، و 7.5 ميكرولتر كاشف التقاط Cy5. وكان مزيج المحتضنة الثانية التهجين لمدة 10 دقائق عند 75 درجة مئوية وكان pipetted و 50 ميكرولتر من خليط ساخنة بحرص شديد على الشريحة ميكروأري غسلها / المجفف. لنشر نموذج موحد وعلى ميكروأري ، تم تخفيض بلطف زلة تغطية باستخدام إبرة المحقنة. قبل أن خفضت تماما انزلاق الغطاء ، وكان انسحب زلة تغطية الظهر ، ثم خفضت مع الإبرة مرة أخرى ، والسماح لها بأن تقع برفق في مكانه ، والتقليل من تشكيل فقاعات الهواء. التهجين ميكروأري الشريحة أفقيا وضعت في أنبوب مخروطي 50 مل مغطاة برقائق و 50 ميكرولتر من DDH 2 O أضيف تحت الشريحة لإنشاء غرفة رطبة. وقد حضنت التهجين الثانية في 37 درجة مئوية لمدة 2-5 ساعات.
  4. وجرفت الثانية ميكروأري التهجين في الظلام باستخدام درجة حرارة الغرفة 2X SSC ، 0.2 ٪ SDS ، 1 ملم وDTT مخاض برفق لإزالة انزلاق الغطاء. ثم ، نقلت إلى أنبوب ميكروأري المخروطية مغطاة تحتوي على 55 درجة مئوية 2X SSC ، 0.2 ٪ SDS ، DTT 1 مم والمحتضنة لمدة 15 دقيقة في 55 درجة مئوية. ونقلت المقبل ، انتقل إلى أنبوب مخروطي يحتوي على تغطية 2X SSC ، 1 DTT ملم والمحتضنة لمدة 15 دقيقة في درجة حرارة الغرفة ، والهز برفق بشكل دوري. ونقلت الماضي ، انتقل إلى محكمة أمن الدولة 0.2X ، 1 ملم وDTT المحتضنة في درجة حرارة الغرفة لمدة 15 دقيقة ، والهز بشكل دوري بلطف. وكان المجففة ميكروأري الشريحة بواسطة الطرد المركزي لمدة 1 دقيقة ، ز 2000 ، الشريحة جانب العلامة لأسفل في أنبوب غطت مخروطية 50 مل مع KimWipe في القاع. وكان مسح شرائح ميكروأري الجافة باستخدام نموذج GenePix ماسح 4100A الشخصية في كلية ديفيدسون.

8. تحليل ميكروأري

  1. وقد تم تحليل الصور التي تم الحصول عليها بعد المسح باستخدام برمجيات MAGICTool المتقدمة في كلية ديفيدسون بواسطة هاير لوري وطلابها في المرحلة الجامعية. لفترة وجيزة ، تحت علامة التبويب "المشروع" ، تم إنشاء "مشروع جديد" وحفظها. تحت علامة التبويب "إنشاء التعبير الشخصي" ، "تحميل صورة زوج" تم اختيار ملف الصورة والحمراء (_635.وكان تم الرفع TIF) ، باعتباره "الاحمر" ، وكان إيداع ملف صورة خضراء (_532.tif) بأنها "خضراء". ثم ، وذلك باستخدام "التعبير الشخصي بناء" والتبويب "قائمة الجينات تحميل" ، وجيم تم تحميل ملف قائمة ايليجانس الجينات التي تم الحصول عليها من موقع GCAT.
  2. وقد وجهت ميكروأري الصورة والموزعة باستخدام "إنشاء التعبير الشخصي" والتبويب "إنشاء / تحرير شبكة" الخيار. تم تحريرها "إعداد الشبكة" باستخدام مربع الحوار "48" لعدد من الشبكات "، 22 الصفوف" و "أعمدة 22" لكل شبكة ، بلغ عدد البقع "اليسار إلى اليمين" و "من أعلى إلى أسفل". وزادت "تغيير نسبة التباين" والتكبير على الشبكة حتى بقع الفردية ويمكن تمييزها بسهولة. تم إنشاء شبكات من خلال تحديد أول "مجموعة سبوت بقي من الأعلى" على اللوحة اليسرى. ثم ، في وسط بقعة أعلى اليسار ، وكان المكان الصحيح بالنقر العلوي والصف السفلي في "الشبكة 1". وقد تكرر هذا الإجراء gridding لكل من شبكات 48 ، انطلاقا من اليسار إلى اليمين ومن أعلى إلى أسفل. وعندما اكتمل gridding ، أنقذ الشبكة الحالية في إطار "ملف" "حفظ الشبكة الحالية بأنها". عندما تم حفظ بنجاح الشبكة تم اختيار "انتهى" التبويب.
  3. للقضاء على أي نقاط لا علاقة لها من التحليل ، تم فتح "الملف التعبير البناء" التبويب. في إطار "التصدي Gridding" الخيار "سبوت وضع علامة" تم اختيار. وكانت بقع أو يشوبه مضان الخلفية التي ترفع علم وحفظها عن طريق اختيار "حفظ أعلام الحالية بأنها" تحت عنوان "ملف تبويب".
  4. وكانت توضع ملفات مجزأة باستخدام "إنشاء التعبير الشخصي" علامة التبويب واختيار "الشعاع الثابتة" كأسلوب التجزئة في الاختيار. تم تعيين نصف قطرها إلى الحجم المطلوب ، وكان فوقه "تحديث البيانات". للتأكد من أن يبقى ضمن دائرة منطقة الشبكية (المربع الأصفر) تمريره ونحن من أعلى إلى أسفل ومن اليسار إلى اليمين وفحصها مرة واحدة "إنشاء التعبير الشخصي" المختار.
  5. خلال تجزئة ، وبرنامج حساب الأحمر : الأخضر مضان النسب لكل من البقع التي بقيت بعد المتعثر. باستخدام "التعبير" علامة التبويب ، "التعامل مع البيانات" "تحويل" تم اختيار. ويبدو ان "تحويل البيانات" مربع الحوار حيث "logb (خ)" الخيار ، وكان دخل ب = 2. وكان استطلاع "ملف التعبير العامل" من علامة التبويب "التعبير". للتجربة التي النوع البري تلقى القبض على تسلسل Cy3 (الخضراء) ومتحولة تلقى Cy5 التقاط تسلسل (الحمراء) ، كانت قيمة سجل نسب تحول ايجابية للجينات التي يسببها والسلبية لقمع الجينات.
  6. الماضي ، وجرى تحليل الجينات التي يسببها أو قمع من قبل عامل المحدد اختيار "اكتشف" تحت علامة التبويب "التعبير". في "استكشاف" مربع الحوار "البحث عن الجينات مطابقة المعايير" كان من المقرر أن الجينات مع "القيمة. ماكس> X (رقم موجب للجينات المستحثة)" أو "الحد قيمة <X (رقم سالب لقمع الجينات)" في التجارب كما هو موضح في # 5. وكان أضعاف التعبير يساوي 2X ، حيث 'س' هي قيمة الرقم الذي تم إدخاله في معايير الاختيار.

9. [كدنا] تجميع وPCR الوقت الحقيقي

  1. تم عزل الحمض النووي الريبي مجموع كما هو موضح سابقا. مرة واحدة تم تحديد نوعية وكمية من الحمض النووي الريبي معزولة ، تم تصنيعه باستخدام [كدنا] iScript كيت التجميعي [كدنا] (BioRad) ، 500 مجموع RNA نغ / ميكرولتر معزولة من النوع البري ومتحولة ، والبروتوكولات ، وأوصت الشركة المصنعة.
  2. وكان انشاء تفاعلات PCR في الوقت الحقيقي باستخدام SYBR قريش الخضراء Supermix (BioRad) ، 100-500 الاشعال الجين nmoles محددة (الجدول 1) و 4 cDNAs ميكرولتر التي تنتجها الخطوة السابقة. وكانت ردود الفعل تشغيل 10 ميكرولتر باستخدام CFX96 thermocycler في الوقت الحقيقي النظام (BioRad).
  3. كانت ساخنة لأول مرة thermocycler إلى 95 درجة مئوية لمدة 3 دقائق. وأعقب هذه الخطوة من قبل في 95 درجة مئوية لمدة 5 ثوان و 58 درجة مئوية لمدة 30 ثانية. تم الانتهاء من هذه الحلقة ما مجموعه أربعين مرة ، وأدرجت أيضا منحنى 65-95 درجة مئوية تذوب مع التدرج من 0.5 درجة. وحسبت قيم ΔΔCT باستخدام الجينات التدبير المنزلي الثلاثة (الفعل - 1 ، CDC - 42 ، وPMP - 3) كما الضوابط.
GENE FORWARD برايمر REVERSE برايمر
GST - 5 CTGCTCCATTCGGACAACTT TCCGTTGAGCTTGAACTCAC
GST - 9 GGAAGACAACTGGCACAATC ACCGAGAGCATCAACTTGAG
kcnl - 1 TACGCTCGGCATGTGTTGTATC CCAATCATCGGCTCCACTATCT
KSR - 2 CGAACTGCTGCTGGAATGCT GTGCTGCGTCTCTTCTGCTT
ليم - 9 CTCATCGAGTGGCTCAATCT CACCTTGCTCCATCTTCAAC
LPR - 6 CAGCAGTCACTTCTGTTCAC TCTCCAATAGCGGTACTCC
MES - 6 TTGTTCCGTTGGCTCACGTACAG CGACAGACGCAGATACACGATCA
MSP - 32 GCCGCACAGGTATGATCCAG ATCCAATACGGCGAGCCGAG
MSP - 142 GATCCACCATGTGGAGTTCT GATTCTTGCGACGGACCATA
MSP - 38 GCCTTCGGACAAGAGGATACC CCATACCGTCTCCTTGGAACC
MSP - 45 TCACCGTTGAGTGGACCAAT ACGAACCAACCGTCTCCTT
MSP - 49 CGACGACAAGCACACCTACCACATCAA TCGAGGACTCCACATGGTGGATCAACT
MSP - 56 CGAAGATCGTCTTCAATGCGCCATAC TCCACATGGTGGATCAACTCCAAGTC

الجدول 1. إلى الأمام وعكس متواليات التمهيدي في الوقت الحقيقي PCR

10. ممثل النتائج :

العزلة وتحليل الحمض النووي الريبي

التحام حويصلات السلائف منطقة نشطة في مواقع قبل المشبكي خطوة إلزامية خلال synaptogenesis (3). واقترح VSM - 1 ، وهو البروتين الرئيسي في الآونة الأخيرة حددت الخامس الفخ ، لمنع الانصهار الحويصلة في الخميرة وsynaptogenesis في الديدان الخيطية (انظر الشكل 1) بواسطة آلية غير محددة (4 ، وعملنا غير منشورة). من أجل فهم أفضل مسار الجزيئية الكامنة وراء VSM - 1 التنظيم في الديدان الخيطية وجلب بعض الضوء في الحقل synaptogenesis ، بدأنا شاشة الجينوم على نطاق وقرر أن تكون ناتجة الرئيسية جينات بروتين الحيوانات المنوية (MSP) في ظل غياب كامل الوظائف 1 - VSM .

التحقيق في الجينات يتسبب في سلالة VSM - 1 (ok1468) متحولة من C. ايليجانس ، أجرينا تحليلا ميكروأري الجينات. وقد تم ذلك عن طريق اختبار النصوص معزولة من نوع البرية وVSM - 1 سلالة متحولة وتحديد إثرائها. على وجه التحديد ، ونحن لأول مرة عزل الحمض النووي الريبي من مجموع L4 L3 متزامن والبرية واكتب VSM - 1 يرقات الديدان الخيطية متحولة. ثم ، نعامل الحمض النووي الريبي مجموع حصلت لي مع الدناز وفحص جودة استخراج الحمض النووي الريبي باستخدام agarose هلام الكهربائي. في التجربة هو مبين في الشكل 2 ، كانت تستخدم سلما في المسار الأول لتمثيل عدد من أزواج قاعدة لهذه المعايير. عينات من النوع البري قبل المعالجة وبعدها تعامل مع الدناز وأنا حملت في 2 و 4 حارات ، وVSM - 1 متحولة عينات ما قبل المعالجة وبعدها تعامل مع الدناز تم تحميلها كنت في الحارات 3 و 5 على التوالي. وأظهر تحليل الحمض النووي الريبي هلام إستشراد هذا النوع البرية وVSM - 1 عينات الحمض النووي الريبي متحولة كانت سليمة وذات نوعية جيدة. وتم تحديد هذا من خلال مراقبة شريطين التي تمثل مفارز اثنين من الحمض النووي الريبي الريباسي.

ميكروأري التهجين

مرة واحدة تم تحديد نوعية الحمض النووي الريبي ، وشرع لنا مع التوليف [كدنا]. للقيام بذلك ، ونحن على عكس كتب مرنا وأضاف تسلسل القبض على الذيل. والمهجنة والتي تحتوي على تسلسل cDNAs المنتجة لالتقاط Cy3 وCy5 لميكروأري الشرائح وطرد للمسح الضوئي. ثم أدخلت ميكروأري الصور في برنامج المصدر المفتوح برامج الكمبيوتر ودعا MAGICTool المتقدمة في كلية ديفيدسون بواسطة هاير لوري وطلابها في المرحلة الجامعية. باستخدام هذا البرنامج مضافين نحن Cy3 Cy5 والصور ، وميكروأرس الموزعة ، وملامح الفلورسنت تحليلها (انظر الشكل 3). كان مرة واحدة كاملة gridding نحن مجزأة ثم كل فرد التأكد من مربع ويجري فحص كامل قليل النوكليوتيد المطبوعة. ثم حلل لنا النسب التي يسببها وخلق تعابير الصورة الجينية التي تبين أن الجينات هي التي يسببها الترميز للأسرة MSP في الديدان الخيطية مع synaptogenesis المحسنة. (الجدول 3).

التحقق والقياس الكمي للالتعبير الجيني الحقيقي باستخدام PCR الوقت.

لمزيد من فهم الصورة الجينية الطافرة في VSM 1 - حللنا عددا من الجينات التي رمز لأعضاء الأسرة MSP الحقيقي باستخدام PCR الوقت. أولا ، تم عزل الحمض النووي الريبي مجموع من نوع البرية وVSM - 1 (ok1468) سلالات متحولة. وكانت عينات من الحمض النووي الريبي ثم كتب إلى reversely cDNAs واستخدامها في الوقت الحقيقي PCR التحليل. التقييمات ملامح التعبير في الوقت الحقيقي PCR أظهرت أن أحد أفراد العائلة MSP يبدو أن يتسبب في VSM - 1 (ok1468) المسوخ. علاوة على ذلك ، في الوقت الحقيقي PCR بالتحقق من صحة البيانات نتائجمن ميكروأرس ويضيق الخناق البحث على مرشح واحد الجينات MSP (الشكل 4).

الشكل 1
الشكل 1 ألف. كشفت UNC - 17 Immunostaining أن VSM - 1 المسوخ المعرض كثافة أعلى متشابك على طول الحبل العصبي الظهري. وقد تم تحليل الصور في التكبير ، 63x الخلفي (يمين) إلى الفرج. باء تحليل وVSM WT - 1 (ok1468) يرمز المشابك متحولة ذات دلالة إحصائية كثافة متشابك المعزز في متحولة VSM - 1 (** P <0.01). عشرون النيماتودا الصور لكل الوراثي.

الشكل 2
الشكل 2. تم تحديد نوعية استخراج الحمض النووي الريبي باستخدام agarose هلام الكهربائي. وكان وجود مفارز two الريباسي سليمة قبل وبعد العلاج أنا الدناز الظاهر في الحمض النووي الريبي المستخرج من نوع البرية وعينات VSM - 1 (ok1468).

الشكل 3
الشكل 3 ألف. وكان المسمى ميكروأري الصورة لتجربة حيث وصفت السيطرة الحمراء (Cy5) ومتحولة VSM - 1 الخضراء (Cy3). باء صورة الممثل تظهر في 1 من أصل 48 في تحليل الشبكات ميكروأري. كل مربع صغير على الشبكة هو ممثل واحد قليل النوكليوتيد المطبوعة ، وتتكون كل شبكة من 22 الصفوف والأعمدة 22.

الجدول 2
تحليل الجدول ميكروأري 2. النصوص معزولة عن اليرقات 4 (A) واليرقات 3 (ب) جيم وأظهرت الديدان الخيطية التي يسببها ايليجانس الجينات الترميز لبروتينات السائل المنوي رئيسيا في المسوخ مع synaptogenesis المحسنة. وأبرزت جينات تشير جينات المستحثة في 3 و 4 كل من اليرقات اليرقات.

الشكل 4
الشكل 4. PCR الوقت الحقيقي التحليل أظهرت أن يسببها أحد أعضاء أسرة جين MSP ، MSP -32 في VSM - 1 (ok1468) المسوخ. ممثل تطبيع التعبير أضعاف الرسم البياني يظهر ان VMS - 1 تستخدم (ok1468) عن القيم ΔΔCT MSP - 32 تختلف بشكل ملحوظ بالمقارنة مع الانواع البرية (WT) ، والتدبير المنزلي الجينات الثلاثة لتطبيع (ACT - 1 ، CDC - 42 ، وPMP -3). يتم رسم المتوسط ​​من ثلاث نسخ طبق الأصل + / -- الانحراف المعياري.

Discussion

في هذه الدراسة قمنا بتطوير وسيلة سهلة بروتوكول المستخدم ، الصديقة التي يمكن استخدامها لتحديد ملامح التعبير الجيني الكامن الظواهر البيولوجية المختلفة. في هذا البروتوكول ، وعزله للمرة الأولى RNA الكلي والمعالجة باستخدام الدناز أولا تم لدينا طريقة العزل RNA مبسطة بشكل كبير عن طريق حذف الاستخراج باستخدام راتنجات الفينول وتقارب 5،6 لتنظيف. لفترة وجيزة ، C. وكانت ايليجانس cuticule الخلية أغشية تصدع فتح بواسطة النيماتودا تجميد مع النيتروجين السائل وطحن مع الراتنج الجزيئية. كان يعامل المقبل ، مع استخراج الحمض النووي الريبي أنا الدناز قبل توليف [كدنا]. تم إضافة خطوة لاحقة للحد من التهجين غير محددة ؛ عينات الحمض النووي الريبي ملوثة الجيني يمكن أن أعرض التدخل وتنتج العديد من ايجابيات كاذبة. ثم اكتب البرية وVSM - 1 (ok1468) والموسومة cDNAs متحولة مع Cy3 والتقاط تسلسل Cy5 والمهجنة على C. ميكروأرس ايليجانس الحصول عليها من خلال برنامج GCAT. هذا النظام هو أكثر حساسية من المنتجات المماثلة ، وعلى اللونين تصميم يقلل من عدد من الالواح اللازمة ، مما أدى إلى مزيد من الوقت والتكلفة 7،8 الكفاءة. بالإضافة إلى ذلك ، فإن هذا النظام لا يتطلب معدات متخصصة لأنظمة أخرى مماثلة ، وبالتالي ، يمكن أن يتحقق هذا الإجراء في أي مكان المختبر القياسية 7. وحللت ، فلوري مجموعة صور المهجنة الثالثة باستخدام برمجيات المصدر المفتوح MAGICTool ، وخلقت ملامح التعبير الجيني. MAGICTool هو برنامج سهل الاستعمال التي يتم استخدامها بسهولة من قبل أفراد من جميع مستويات الخبرة ، من الجامعيين في مرحلة ما بعد الدكتوراه. ومع ذلك ، يتطلب الأداء الأمثل كبيرة توافر الذاكرة. أخيرا ، حصل مرشح الجينات باستخدام التحليل ميكروأري تم التحقق من صحتها مع PCR الوقت الحقيقي.

على الرغم من أن نهج الجينومية وسيلة فعالة لدراسة الظواهر البيولوجية ، وهناك بعض القيود ينبغي لأحد أن يأخذ بعين الاعتبار. أولا ، على الرغم من خصوصية هذا البروتوكول ميكروأري ومخطوطات داخل الأسرة لا يمكن تمييزها عن بعضها البعض إذا ما أخذ قليل النوكليوتيد طبعت من متواليات الحفظ. PCR الوقت الحقيقي يعوض عن أوجه التشابه الجيني داخل الأسرة ، ويمكن التمييز بين الأشكال الإسوية حتى محددة من الجين نفسه. ومع ذلك ، مع PCR الوقت الحقيقي وهو التحدي الحقيقي للعثور على الضوابط التي يتم التعبير عنها على قدم المساواة في جميع أنحاء عمر الكائن الحي. وبسبب هذا ، وسوف تكون النتائج النسبية. نهج البروتين هي واحدة بديلة لأسلوبنا. قد تكون معزولة البروتينات الفردية باستخدام 2D الكهربي الهلامي وتحديدها مع مطياف الكتلة.

دراستنا تظهر على وجه التحديد هي التي يسببها العديد من أعضاء الأسرة الحيوانات المنوية الرائد (MSP) البروتين في الديدان الخيطية VSM 1 - متحولة ذات الكثافة متشابك المحسنة. المشروعات المتوسطة الحجم هي فريدة من نوعها لجيم ايليجانس ، وهي المسؤولة عن نضج البويضة والإباضة. وقد أثبتت تشاي (1) التي تسيطر على الأرجح تنظيم عدد وحجم حبة قبل المشبكي عند تقاطع العصبية والعضلية في ذبابة الفاكهة التي تحتوي على جزيئات البروتين المجالات الرئيسية الحيوانات المنوية. وقد أثبتت الدراسات التي أجراها وزملاؤه تسودا 2 المجالات الرئيسية بروتين الحيوانات المنوية قد تكون بمثابة يغاندس لمستقبلات Ephrine مما اثار شلالات مستقبلات التيروزين كيناز الإشارة. علاوة على ذلك ، تحليل PCR الوقت الحقيقي والتحقق من صحة النتائج ميكروأري يضيق الخناق على عضو واحد من عائلة MSP ، MSP - 32. أخذت معا ، والعمل المقدم هنا يمثل تحليل الجينوم واسعة من معضلة الأعصاب المركزية وكذلك السلطة البحوث الجامعية في المسعى العلمي.

Disclosures

الإعلان عن أي تضارب في المصالح.

Acknowledgments

تم تنفيذ هذا العمل من قبل الطلاب الجامعيين في جامعة ولاية ساوث جامعة أوكلاهوما ، ويذرفورد موافق. وأيد هذا العمل من قبل جبهة الخلاص الوطني RUI - 0963258 ، NIH OK - INBRE 2P20RR016478 ، وGCAT OCAST HR09 - 137S.

تم عزل (ok1468) vsm1 طافرة من قبل الضربة القاضية جين اتحاد أوكلاهوما.
المؤلفان بالشكر دان Stefanovic ويلر تانر للمساعدة القيمة التي قدموها أثناء تنفيذ المشروع.

Materials

Name Company Catalog Number Comments
RNA Later Ambion AM7020
Molecular Grinding Resin G-Biosciences 786-138
RNeasy Mini Kit Qiagen 74104
Rnase-free Agarose LE Ambion AM9040
NorthernMax Gly 10X Gel Prep/Running Buffer Ambion 8678
RNA Millenium Marker Ambion AM7150
Glyoxal Sample Loading Dye Ambion 8551
DNase set Qiagen 79254
RNeasy MinElute Kit Qiagen 74204
RT Enzyme and 5X Reaction Buffer Genisphere RT300320
Array 350 Genisphere W300180
QIAquick PCR Purification Kit Qiagen 28104
20X SSC VWR international 82021-4846
Sheared Salmon Sperm DNA Ambion AM9680
SDS Solution Promega Corp. V6551
DTT EM VWR international 3860
iScript cDNA Synthesis Kit Bio-Rad 170-8890
iQ SYBR Green Supermix Bio-Rad 170-8880

DOWNLOAD MATERIALS LIST

References

  1. Chai, A., Withers, J., Koh, Y. H., Parry, K., Bao, H., Zhang, B., Budnik, V., Pennetta, G. hVAPB, the causative gene of a heterogeneous group of motor neuron diseases in humans, is functionally interchangeable with its Drosophila homologue DVAP-33A at the Neuromuscular Junction. Hum Mol Genet. 17, 266-280 (2008).
  2. Tsuda, H., Han, S. M., Yang, Y., Tong, C., Lin, Y. Q., Mohan, K., Haueter, C., Zoghbi, A., Harati, Y., Kwan, J., Miller, M., Bellen, H. J. The Amyotrophic Lateral Sclerosis 8 protein VAPB is cleaved, secreted, and acts as a ligand for Eph receptors. Cell. 133, 963-977 (2008).
  3. Dresbach, T., Torres, V., Wittenmayer, N., Altrock, W. D., Zamorano, P., Zuschratter, W., Nawrotzki, R., Ziv, N. E., Garner, C. C., Gundelfinger, E. D. Assembly of Active Zone Precursor Vesicles. Journal of Biological Chemistry. 281, 6038-6047 (2005).
  4. Lustgarten, V., Gerst, J. E. Yeast VSM1 Encodes a v-SNARE Binding Protein That May Act as a Negative Regulator of Constitutive Exocytosis. Molecular and Cellular Biology. 19, 4480-4494 (1999).
  5. Viñuela, A., Snoek, L., Riksen, J., Kammenga, J. Genome-Wide Gene Expression Analysis in Response to Organophosphorous Pesticide Chlorpyrifos and Diazinon in C. elegans. PloS one. 5, 1-8 (2010).
  6. Niwa, R., Hada, K., Moliyama, K., Ohniwa, R., Tan, Y., Olsson-Carter, K., Chi, W., Reinke, V., Slack, F. C. elegans sym-1 is downstream target of the hunchback-like-1 developmental timing transcription factor. Cell Cycle. 8, 4147-4154 (2009).
  7. Kershner, A., Kimble, J. Genome-wide analysis of mRNA targets for Caenorhabditis elegans FBF, a conserved stem cell regulator. PNAS. 107, 3963-3941 (2010).
  8. Hammock, E., Eagleson, K., Barlow, S., Earls, L., Miller, D., Levitt, P. Homologs of genes expressed in Caenorhabditis elegans GABAergic neurons are also found in the developing mouse forebrain. Neural Development. 5, 1-14 (2010).

Comments

2 Comments

  1. Thanks for the informative material. Could you post something about RealTime PCRs and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM
  2. Thanks for the informative material. Could you post something about http://www.fluoresentric.com/">RealTime PCTR and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics