Определение генетических профилей выражения в С. Элеганс Использование Microarray и ПЦР в реальном времени

Biology
 

Summary

Microarray анализ был проведен для определения генетических профилей выражение в

Cite this Article

Copy Citation | Download Citations

Guthmueller, K. L., Yoder, M. L., Holgado, A. M. Determining Genetic Expression Profiles in C. elegans Using Microarray and Real-time PCR. J. Vis. Exp. (53), e2777, doi:10.3791/2777 (2011).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Синапсы состоят из пресинаптических активной зоны сигнализации клетки и постсинаптической терминала в клетки-мишени. В случае химических синапсов, сообщения переносятся нейротрансмиттеров освобождены из пресинаптических окончаний и полученные рецепторами на постсинаптической клетки. Наши предыдущие исследования в Caenorhabditis Элеганс показал, что VSM-1 негативно регулирует экзоцитоза. Кроме того, анализ синапсов в VSM-1 мутантов показал, что животные не хватает полнофункциональную VSM-1 увеличилась синаптические связи. Основываясь на этих предварительных результатах, мы предположили, что С. Элеганс ВСМ-1, могут играть решающую роль в синаптогенез. Чтобы проверить эту гипотезу, дважды меченных микрочипов анализ был проведен, а также профили экспрессии генов были определены. Во-первых, общая РНК выделяли, обратно транскрибируется в кДНК и гибридизации с ДНК-микрочипов. Затем, в кремний-анализа флуоресцентной гибридизации зонд выявил значительные индукции многих генов, кодирующих членов семьи основных белков спермы (MSP) в мутантов с повышенной синаптогенез. ПСМ являются основным компонентом спермы на языке C. Элеганс и, похоже, сигнал нематоды созревание ооцитов и овуляции. В плодовых мушек, чай и его коллеги показали, что один MSP-подобных молекул регулировать пресинаптические количество и размер Bouton в нервно-мышечном соединении. Более того, анализ, проведенный Цуда и сотрудниками 2 предполагает, что ПСМ могут выступать в качестве лигандов рецепторов Еф и вызвать рецепторов тирозинкиназы сигнальные каскады. Наконец, ПЦР в реальном времени анализ подтвердил, что ген, кодирующий MSP-32 индуцируется в VSM-1 (ok1468) мутантов. Взятые вместе, исследования, проведенные в нашей лаборатории показали, что VSM-1 мутанты значительное увеличение синаптической плотности, которые могут быть опосредованы MSP-32 сигнализации.

Protocol

1. Выделение Всего РНК

  1. Здоровый синхронизированы нематод собирали стиральной пластин с комнатной температуре среды М9, используя 2-3 мл на чашку. Ресуспендировали нематод были переведены в 15 мл конические пробирки и осаждали вниз с помощью центрифугирования, 3200 г при 4 ° С в течение 4 минут. Собранные нематод были очищены от плавали бактерий ресуспендированием гранул с 7 мл 0,1 М NaCl и 7 мл ледяной 60% вес / объем сахарозы. Ресуспендировали смесь инкубировали на льду в течение 15 минут, а чистая нематод, которые всплытия через раствор сахарозы, были собраны после центрифугирования смеси на 3200 г при 4 ° С в течение 4 минут. Бактерии без червей были переведены в новую коническую трубку стерильные пипетки и промывают два раза до 15 мл РНКазы без воды с последующим центрифугированием 3200 г при 4 ° С в течение 2 минут. Чистой слабо уплотненный осадок передано 1,5 трубки микроцентрифужных мл и центрифугируют при максимальной скорости (около 10 000 г) в течение 30 секунд. Наконец, большинство РНКазы без воды был удален и 10 томов RNAlater был добавлен в гранулах, и хранили при 4 ° С до готовности продолжить.
  2. Для подготовки общего образцов РНК, собранных нематод центрифугировали при максимальной скорости (около 10 000 г) в течение 4 минут и RNAlater была отброшена. Затем, щепотка молекулярной шлифовальные смолы (G биологических наук) был добавлен в гранулах и смесь замороженной с использованием жидкого азота. Замороженные подвески червь измельченного в мелкий порошок с пестиком и жидкий азот был добавлен по мере необходимости держать порошок холода. После шлифовки, экстракт находился на льду в течение 5 минут, а затем смешивают с 700 мкл RLT / BME (отношение объема 100 RLT: 1 объем BME) (Qiagen) и 472 мкл 100% этанола.
  3. Общую РНК выделяли с использованием RNeasy Kit Mini (Qiagen), а после производителем рекомендуется протокол. Конечного объема изолированной РНК был 60 мкл на биологические пробы.

2. Пищеварение ДНК и РНК Очистка

  1. 50 мкг тотальной РНК потенциально загрязненных геномной ДНК переваривали ДНКазы I (Qiagen). Дайджест реакции, содержащих 0,1 U ДНКазы / 1 мкг РНК и 1X буфера RDP инкубировали при комнатной температуре в течение 10 минут.
  2. РНК образцах, обработанных с ДНКазы я очищенный от использования RNeasy MinElute Clean-Up Kit (Qiagen). Протоколы, рекомендованные производителем последовали и 60 мкл окончательного элюировали объема было получено.

3. Качественный и количественный анализ РНК

  1. РНК концентрацию определяли с помощью УФ-спектрофотометр Nanodrop (Thermo Scientific).
  2. Целостность образцов РНК оценивали с помощью электрофореза в агарозном. Короче говоря, 1% РНКазы без агарозе были приготовлены с использованием 1X Северной Макс Gly Гель Prep / бег Buffer (Амбион), 1% РНКазы без агарозном LE (Амбион) и 0,5 мкг / мл бромистого этидия. В то время как гель полимеризации, РНК образцы glyoxylated добавлением 5 мкл Glyoxyl Пример Загрузка Dye / пробы и образцы инкубации при температуре 50 ° С в течение 30 минут. РНК лестница была также glyoxylated и загружены на размер сравнения.

4. Синтез кДНК

  1. Для каждой реакции синтеза, 8,4 мкг РНК образца смешивали с 1 мкл праймера РТ (1 пмоль / мкл). Один образец (WT или мутанты) получил Cy5 захвата РТ грунтовки, другой образец получил Cy3 захвата РТ грунтовкой (поставляется с массива 350 Маркировка-Detection Kit, Genisphere). Пример смеси нагревают при 75-80 ° С в течение 10 минут и переданы в лед в течение 2-3 минут.
  2. Хотя образцы РНК инкубировать, Mastermix (Genisphere) была подготовлена ​​следующим образом: для каждой реакции РТ, мы объединили 4 мкл 5X буфера для реакции РТ, 1 мкл дНТФ (10 мМ каждого дАТФ, дЦТФ, дГТФ, dTTP), 1 мкл Superase В-ингибитор РНКазы (поставляется с массива 350 Маркировка-Detection Kit, Genisphere), 1 мкл фермента РТ (200 ед / мкл). Последний, 7 мкл Mastermix был добавлен в каждой пробе РНК, осторожно перемешивают (не используйте вихря) и инкубировали 2 часа при 42 ° C.

5. Деградация РНК и очистка кДНК Образцы

  1. синтеза кДНК останавливали добавлением 3,5 мкл 0,5 М NaOH/50mM ЭДТА (конечная концентрация) и инкубировали при 65 ° С в течение 15 минут. Затем, реакции были нейтрализованы использованием 1М Трис-HCl, рН 8,0, для достижения конечной концентрации 850 мМ Трис-HCl. Наконец, WT и мутантных кДНК были объединены в один микроцентрифужных трубки. Пустые трубки промывают 73 мкл буфера ТЕ 1X и добавляется к кДНК, содержащие трубки; конечный объем комбинированной трубки кДНК было 130 мкл.
  2. Смешанные кДНК очищали протокол следующие производителя и очистки QIAquick PCR Kit (Qiagen). Результирующая элюировали объем очищенной кДНК 60 мкл.

6. Первый Гибридизация Microarray

  1. C. Элеганс микрочипов слайды получены через GCAT (Геном консорциума для активного обучения) были заблокированы накомнатной температуре в течение 1 часа с помощью 0,1 мг / мл ультразвуком ДНК спермы лосося в 3Х SSC, 0,1% SDS. Заблокированные слайды были промыты путем погружения в ddH2O и спин-высушенный путем центрифугирования в течение 1 минуты на 2000 г в 50 мл конических пробирок с KimWipe в дно.
  2. Затем, 2X формамида основе гибридизации буфер (Genisphere) инкубировали при 55 ° С в течение 10 минут, тщательно перемешивают для растворения кристаллов и центрифугировали в течение 1 минуты при 10000 g. Следующая, 25 мкл кДНК образец осторожно перемешивают, щелкая с 25 мкл 2X формамида основе гибридизации буфера. Разводненная кДНК образец был собран спина вспышки в течение 15 секунд и инкубировали при 80 ° С в течение 10 минут.
  3. Последнее, кДНК гибридизации с микрочипов слайд, тщательно пипетирования всей подогревом кДНК образца, не касаясь слайда. Образец был равномерно распределить на микрочипов, мягко снижения покровным стеклом, используя шприц иглой. Перед покровным стеклом была полностью опущена, покровное стекло вытащили резервные копии, а потом опустил с иглой снова, и падать аккуратно на место, сводя к минимуму образование воздушных пузырьков. Первый гибридизации создана была завершились, поставив слайд горизонтально в 50 мл коническую трубку с 50 мкл DDH 2 O ниже слайдов и инкубировали в течение ночи при температуре 37 ° C.

7. Второй Гибридизация

  1. Гибридизированных микрочипы промывали 2X SSC при различных температурах. Во-первых, микрочипов слайды были переданы в конической трубки, содержащие комнатной температуре 2X SSC и 0,2% SDS и пьяный осторожно, чтобы снять крышку скользит. Затем, микрочипов слайды были переданы в конической трубки, содержащие 55 ° C 2X SSC и 0,2% SDS и инкубировали при 55 ° С в течение 15 минут. Далее, слайды были переданы в 2X SSC и инкубируют при комнатной температуре в течение 15 минут, встряхивая осторожно периодически. Последнее, слайды были переданы 0,2 x SSC и инкубировали в течение 15 минут при комнатной температуре, встряхивая осторожно периодически. Вымытые стекла были спин-сушеный, вводя этикеткой вниз слайды в 50 мл конических пробирок с KimWipe в нижнем и центрифугировали в течение 1 минуты в 2000 г.
  2. Далее, второй смеси гибридизации был получен с использованием 2X формамида основе гибридизации буфер (Genisphere). Гибридизация буфера инкубировали при 55 ° С в течение 10 минут и центрифугировали в течение 1 минуты при 10000 g. Захват флуоресцентных реагентов (Cy3 и Cy5) и анти-Fade реагент разморозить при комнатной температуре и покрыты фольгой для защиты от реагентов фотообесцвечивания. Следующие шаги гибридизацию проводили в темноте, чтобы минимизировать воздействие света. 150 мкл 2X формамида основе гибридизации буфер в сочетании с 1,5 мкл анти-Fade реагента, чтобы анти-Fade обработанных гибридизации смеси.
  3. Захват реагентов Cy3 и Cy5 были перемешивали в течение 3 секунд и центрифугировали в течение 15 секунд, 10000 г. Вторая смесь гибридизации был подготовлен объединения 75 мкл анти-Fade обработанных гибридизации смеси, 60 мкл нуклеазы без воды, 7,5 мкл Cy3 захвата реагентом, и 7,5 мкл Cy5 захвата реагентом. Вторая смесь гибридизации инкубировали в течение 10 минут при 75 ° C и 50 мкл нагревают смесь пипеткой очень внимательно на мыть / сушеных микрочипов слайда. Чтобы равномерно распределить образца на микрочипов, покровное стекло было плавно опускается, используя шприц иглой. Перед покровным стеклом была полностью опущена, покровное стекло вытащили резервные копии, а потом опустил с иглой снова, и падать аккуратно на место, сводя к минимуму образование воздушных пузырьков. Гибридизации микрочипов слайд был помещен горизонтально в 50 мл коническую трубку покрытые фольгой и 50 мкл DDH 2 O был добавлен под слайд, чтобы создать влажной камере. Второй гибридизации инкубировали при 37 ° С в течение 2-5 часов.
  4. Второй гибридизации микрочипов промывали в темном помещении на температуру 2Х SSC, 0,2% SDS, 1 мМ DTT и пьяный осторожно, чтобы снять крышку скольжения. Затем, микрочипов был переведен в покрытые конической трубки, содержащей 55 ° C 2X SSC, 0,2% SDS, 1 мМ DTT и инкубировали в течение 15 минут при 55 ° C. Далее, слайд был переведен в покрытые конической трубки, содержащей 2Х SSC, 1 мМ DTT и инкубировали в течение 15 минут при комнатной температуре, встряхивая осторожно периодически. Последнее, слайд был переведен в 0,2 x SSC, 1 мМ DTT и инкубируют при комнатной температуре в течение 15 минут, встряхивая осторожно периодически. Microarray слайд сушили путем центрифугирования в течение 1 минуты, 2000 г, слайд-этикеткой вниз в крытых 50 мл коническую трубку с KimWipe в нижней части. Сухой слайды микрочипов были отсканированы использованием GenePix Личные 4100A модель сканера на Davidson College.

8. Анализ Microarray

  1. Изображения, полученные в результате проверки были проанализированы с использованием MAGICTool Программное обеспечение, разработанное в колледже Дэвидсон Лори Хейер и ее студентов. Короче говоря, под "Проект" на вкладке, "Новый Проект" была создана и сохранена. Под "Build Выражение профиля" на вкладке, "Пара Load Image" была выбрана, и красные файл-образ (_635.TIF) был загружен как "Красный" и зеленый файл-образ (_532.tif) был загружен в качестве "зеленого". Затем, используя "Build Выражение профиля" на вкладке и "Load Гена списка", С. Элеганс ген список файлов полученных из GCAT сайт был загружен.
  2. Microarray изображение было адресовано и сетке использовании "Build Выражение профиля" на вкладке и "Создать / Редактировать Сетка" вариант. "Grid Setup" диалоговое окно было редактировать с помощью "48" для числа сеток ", 22 строк" и "22 колонн" для каждой сетки, пятна номером "Слева направо" и "сверху вниз". "Процент Контрастность Смена" была увеличена и увеличено на сетке, пока отдельные пятна были легко различимы. Сетки были созданы первые выбрав "Set Top Левый пятно" на левой панели. Затем, в центре верхнего левого месте, топ нужном месте и нижнем ряду были нажал на "Сетка 1". Это гриддинга процедура повторяется для каждой из 48 сетей, исходя слева направо и сверху вниз. Когда гриддинга была завершена, текущий сетки был спасен в разделе "Файл" "Сохранить текущий сетки как". Когда сетка была успешно сохранена "Готово" вкладка была выбрана.
  3. Для устранения любых несвязанных пятен от анализа, "Build Выражение Профиль" вкладка была открыта. Под «Решение гриддинга" вариант "Пятно Отметка" был выбран. Мелированные пятна или фоновой флуоресценции были помечены и сохранить, выбрав «Сохранить действующие флаги" под "File Tab".
  4. Помеченные файлы были сегментированы использовании "Build Выражение профиля" на вкладке и выбрав пункт "Фиксированный Радиус", как сегментация методом выбора. Радиус был установлен на нужный размер, а "Обновление данных" была нажата. Чтобы убедиться, что круг остается в сетке область (желтый квадрат), мы прокручивается сверху вниз и слева направо, и один раз проверили "Создать Выражение Профиль" был выбран.
  5. Во время сегментации, программное обеспечение рассчитаны Красный: Зеленый флуоресценции отношений для каждого из мест, которые остались после мигания. Использование "Экспрессия" на вкладке, "Манипулирование данными" "Transform" был выбран. "Преобразование данных" диалоговое окно, где появились "logb (х)" вариант, и б = 2 был введен. "Работа Выражение Файл" была рассмотрена с "Экспрессия" на вкладке. Для эксперимента, в котором дикого типа, полученный Cy3 (зеленый) захвата последовательности и мутант получили Cy5 (красный) захвата последовательности, значение журнал преобразован отношения были положительными для генов, которые были вызваны и негативные для репрессированных генов.
  6. Последнее, гены или индуцированных репрессированных указанных факторов были проанализированы выбрав пункт "Проводник" под "Экспрессия" на вкладке. В "Исследование" диалогового окна "Найти Гены соответствия критериям" была установлена ​​на гены с "Макс. Значение> X (положительное число для индуцированных генов)" или "Мин. Значение <Х (отрицательное число генов, репрессированных)" в Эксперименты, как это описано в # 5. Fold-выражение было равно 2x, где 'х' является значением число, введенное в критерии отбора.

9. кДНК Синтез и ПЦР в реальном времени

  1. Общую РНК выделяли как описано выше. Как только качество и количество изолированной РНК была определена, кДНК синтезировали использованием iScript кДНК Синтез Kit (BioRad), 500 нг / мкл общего РНК, выделенной из дикого типа и мутанта, и производитель рекомендовал протоколов.
  2. ПЦР в реальном времени реакции настройки использованием IQ SYBR Green Supermix (BioRad), 100-500 нмоль гена специфических праймеров (таблица 1) и 4 мкл кДНК производства на предыдущем шаге. 10 мкл реакции проводились с использованием амплификаторе CFX96 системы в реальном времени (BioRad).
  3. Амплификаторе впервые нагревается до 95 ° С в течение 3 мин. За этим последовал шаг при 95 ° С в течение 5 секунд и 58 ° С в течение 30 секунд. Этот цикл был завершен в общей сложности сорок раз, и 65-95 ° С расплав кривой с градиентом 0,5 градуса был вставлен. ΔΔCT значения были рассчитаны с использованием трех хозяйства генов (акт-1, CDC-42 и PMP-3) в качестве контроля.
GENE Прямой праймер Обратный праймер
GST-5 CTGCTCCATTCGGACAACTT TCCGTTGAGCTTGAACTCAC
GST-9 GGAAGACAACTGGCACAATC ACCGAGAGCATCAACTTGAG
kcnl-1 TACGCTCGGCATGTGTTGTATC CCAATCATCGGCTCCACTATCT
КСР-2 CGAACTGCTGCTGGAATGCT GTGCTGCGTCTCTTCTGCTT
Ит-9 CTCATCGAGTGGCTCAATCT CACCTTGCTCCATCTTCAAC
LPR-6 CAGCAGTCACTTCTGTTCAC TCTCCAATAGCGGTACTCC
MES-6 TTGTTCCGTTGGCTCACGTACAG CGACAGACGCAGATACACGATCA
MSP-32 GCCGCACAGGTATGATCCAG ATCCAATACGGCGAGCCGAG
MSP-142 GATCCACCATGTGGAGTTCT GATTCTTGCGACGGACCATA
MSP-38 GCCTTCGGACAAGAGGATACC CCATACCGTCTCCTTGGAACC
MSP-45 TCACCGTTGAGTGGACCAAT ACGAACCAACCGTCTCCTT
MSP-49 CGACGACAAGCACACCTACCACATCAA TCGAGGACTCCACATGGTGGATCAACT
MSP-56 CGAAGATCGTCTTCAATGCGCCATAC TCCACATGGTGGATCAACTCCAAGTC

Таблица 1. Прямого и обратного праймера последовательностей для ПЦР в реальном времени

10. Представитель Результаты:

РНК выделения и анализа

Fusion активной зоны предшественником пузырьков в пресинаптических сайтов является обязательным шагом в процессе синаптогенез (3). VSM-1, недавно идентифицированных V-SNARE мастер белка, была предложена для ингибирования синтеза в пузырьке дрожжей и синаптогенез у нематод (см. рисунок 1) на неопределенный механизм (4, и наши неопубликованные работы). Чтобы лучше понять молекулярный путь лежащий в основе VSM-1 регулирование в нематод и пролить свет на синаптогенез поле, мы начали генома экран и определили, что основные спермы белок генов (MSP) индуцируются при отсутствии полнофункциональную VSM-1 .

Для исследования индуцированных генов в VSM-1 (ok1468) мутантного штамма C. Элеганс, мы провели анализ микрочипов гена. Это было сделано путем тестирования стенограммы изолированы от дикого типа и VSM-1 мутантного штамма и определить их обогащения. В частности, мы впервые выделен общей РНК из синхронных L4 и L3 дикого типа и VSM-1 мутант нематод личинки. Затем, мы относились к общей РНК, полученных с ДНКазы я и изучили качество добываемого РНК с помощью электрофореза в агарозном геле. В эксперименте показано на рисунке 2, лестница была использована в первой полосе, чтобы представить число пар оснований для стандартов. Дикие образцы типа предварительно обработанных и после лечения с ДНКазы я был погружен в переулках 2 и 4, и VSM-1 мутант образцы предварительно обработанных и после лечения с ДНКазы я был погружен в полосы 3 и 5 соответственно. Анализ электрофореза РНК показали, что гель дикого типа и VSM-1 мутантов РНК образцы нетронутой и хорошего качества. Это было обусловлено, наблюдая за две команды, которые представляли две субъединицы рибосомной РНК.

Microarray гибридизации

Как только качество РНК была определена, мы исходили с кДНК синтеза. Для этого мы обратной транскрипции мРНК и добавил захвата последовательности хвост. Производится кДНК содержащие захвата последовательности для Cy3 и Cy5 гибридизовали для микрочипов слайды и отправили для сканирования. Microarray изображения были затем вводятся в компьютер с открытым исходным кодом программа, называемая MAGICTool разработанный в колледже Дэвидсон Лори Хейер и ее студентов. С помощью этой программы мы накладными Cy3 и Cy5 изображения, координатные микрочипы, и проанализированы флуоресцентные профилей (см. рисунок 3). После гриддинга была завершена, мы тогда сегментированных каждого квадратного убедившись, что все печатные олигонуклеотид рассматривался в. Затем мы проанализировали индуцированного отношения и создали генетический профиль выражения, показывающие, что гены, кодирующие MSP семьи индуцируются у нематод с повышенной синаптогенез. (Табл. 3).

Проверка и количественной оценки экспрессии генов использованием ПЦР в реальном времени.

Для дальнейшего понимания генетического профиля в VSM-1 мутант мы проанализировали количество генов, которые кодируют членов семьи MSP использованием ПЦР в реальном времени. Во-первых, общая РНК выделяли из дикого типа и VSM-1 (ok1468) мутантные штаммы. РНК образцы затем обратно транскрибируется в кДНК и используются для анализа реального времени ПЦР. Оценки реальных профилей время ПЦР выражение показали, что один из членов семьи MSP-видимому, индуцированных в VSM-1 (ok1468) мутантов. Кроме того, ПЦР в реальном времени проверяет данные выводыот микрочипы и сузили поиск одним MSP гена кандидата (рис. 4).

Рисунок 1
Рисунок 1. A. UNC-17 Иммуноокрашивание показало, что VSM-1 мутантов выставку выше синаптической плотности вдоль спинной шнур нерва. Изображения были проанализированы на 63x увеличение, задний (справа) на наружных половых органах. B. Анализ и VSM WT-1 (ok1468) мутант синапсов обозначать статистически значимое расширение синаптической плотности в VSM-1 мутант (** р <0,01). Двадцать нематод были образы для каждого генотипа.

Рисунок 2
Рисунок 2. Качеством добываемого РНК определяли с помощью электрофореза в агарозном геле. Наличие двух нетронутыми рибосомных субъединиц до и после лечения ДНКазы я была очевидной в РНК, выделенная из дикого типа и VSM-1 (ok1468) образцов.

Рисунок 3
Рисунок 3. A. Microarray изображение для эксперимента, где контроль был помечен красным (Cy5) и VSM-1 мутант был маркирован зеленым (Cy3). Б. представитель изображение показано 1 из 48 сетки проанализированы в микрочипов. Каждый маленький квадрат на сетке представитель одной печатной олигонуклеотида, и каждая сетка состоит из 22 строк и 22 столбцов.

Таблица 2
Таблица 2. Microarray анализ стенограмм изолированы от личинки 4 (А) и личинок 3 (B) C. Элеганс нематод показали, что гены, кодирующие белки основных спермы индуцируются в мутантов с повышенной синаптогенез. Выделение генов указывает индуцированных генов в обеих 3 Личинки и личинки 4.

Рисунок 4
Рисунок 4. ПЦР в реальном времени анализ показал, что один из членов семьи MSP гена, MSP -32 вызывали в VSM-1 (ok1468) мутантов. Представитель нормированный график раза выражения показывает, что ЗИС-1 (ok1468) ΔΔCT значения для MSP-32 значительно отличается по сравнению с дикого типа (WT) и тремя генами домашнего хозяйства используются для нормализации (акт-1, CDC-42 и PMP -3). Средний из трех реплик нанесены + / - стандартное отклонение.

Discussion

В этом исследовании мы разработали простой, удобный протокол, который может быть использован для определяться профили экспрессии генов основного различных биологических явлений. В этом протоколе общего количества РНК был впервые выделен и лечить с помощью ДНКазы I. Наш метод выделения РНК была значительно упрощена, опустив фенола извлечения и использования сродство смолы для очистки 5,6. Одним словом, С. Элеганс кутикулу и клеточных мембран потрескались открытым путем замораживания нематод с жидким азотом и шлифовальные с молекулярной смолы. Далее, извлеченные РНК обрабатывали ДНКазы я перед синтеза кДНК. Позднем этапе был добавлен в минимизации неспецифической гибридизации; РНК образцы загрязненной геномной ДНК может ввести помехи и производить много ложных срабатываний. Затем, дикого типа и VSM-1 (ok1468) мутант кДНК были помечены Cy3 и Cy5 последовательности захвата и гибридизированных на С. Элеганс микрочипов получены через GCAT программы. Эта система является более чувствительным, чем аналогичные продукты, а его двухцветным дизайном уменьшается число массивов, необходимых, в результате чего больше времени и экономической эффективности 7,8. Кроме того, эта система не требует специального оборудования других подобных систем, поэтому эта процедура может быть выполнена в любом стандартов лаборатории 7. В-третьих, флуоресцентные изображения гибридизированных массиве были проанализированы с использованием открытых MAGICTool исходным кодом, а также профили экспрессии генов были созданы. MAGICTool это удобная программа, которая легко использоваться физическими лицами всех уровней опыта, от бакалавра до пост-докторантуры. Тем не менее, оптимальной производительности требует больших доступность памяти. Наконец, генов-кандидатов, полученные с помощью микрочипов анализа были проверены с ПЦР в реальном времени.

Хотя геномный подход является эффективным методом изучения биологических явлений, Есть некоторые ограничения, следует принимать во внимание. Во-первых, несмотря на специфичность данного протокола микрочипов, расшифровки в семье ничем не отличаются друг от друга, если печатные олигонуклеотидных взята из сохраняется последовательностей. ПЦР в реальном времени компенсирует сходство в пределах семейства генов и даже могут различать конкретные изоформ одного и того же гена. Однако, с ПЦР в реальном времени это вызов, чтобы найти истинные элементы управления, которые выражены одинаково всей жизни организма. Из-за этого результаты будут относительными. Протеомных подход является одним альтернатива нашей техники. Индивидуальные белки могут быть выделены с использованием 2D гель-электрофореза и отождествляется с масс-спектрометрии.

Наши исследования показывают, в частности, что многие члены Основные спермы белков (MSP) семья индуцированных в VSM-1 мутант нематод с повышенной синаптической плотности. ПСМ являются уникальными для C. Элеганс и отвечают за созревание яйцеклетки и овуляции. Чай 1 показал, что регулирование числа пресинаптических Bouton и размер в нервно-мышечном соединении у плодовых мушек, скорее всего, контролируется молекулами, содержащими основные области белка спермы. Исследования Цуда и его коллеги продемонстрировали два основных областях белка спермы может служить в качестве лигандов для Ephrine рецепторы, вызывая рецепторов тирозинкиназы сигнальные каскады. Кроме того, ПЦР в реальном времени анализ проверены и сузили микрочипов результаты одного из членов семьи MSP, MSP-32. Взятые вместе, работы, представленные здесь представляет генома анализа дилеммы центральной неврологии, а также сила бакалавриата исследований в научной деятельности.

Disclosures

Нет конфликта интересов объявлены.

Acknowledgments

Эта работа была выполнена студентами в Юго-западном университете штата Оклахома, Weatherford ОК. Эта работа была поддержана NSF RUI-0963258, NIH ОК-INBRE 2P20RR016478, GCAT и OCAST HR09-137S.

Vsm1 (ok1468) мутант был изолирован Нокаут гена Консорциум Оклахоме.
Авторы благодарят Дэн Стефанович и Таннер Уилер за их неоценимую помощь во время выполнения проекта.

Materials

Name Company Catalog Number Comments
RNA Later Ambion AM7020
Molecular Grinding Resin G-Biosciences 786-138
RNeasy Mini Kit Qiagen 74104
Rnase-free Agarose LE Ambion AM9040
NorthernMax Gly 10X Gel Prep/Running Buffer Ambion 8678
RNA Millenium Marker Ambion AM7150
Glyoxal Sample Loading Dye Ambion 8551
DNase set Qiagen 79254
RNeasy MinElute Kit Qiagen 74204
RT Enzyme and 5X Reaction Buffer Genisphere RT300320
Array 350 Genisphere W300180
QIAquick PCR Purification Kit Qiagen 28104
20X SSC VWR international 82021-4846
Sheared Salmon Sperm DNA Ambion AM9680
SDS Solution Promega Corp. V6551
DTT EM VWR international 3860
iScript cDNA Synthesis Kit Bio-Rad 170-8890
iQ SYBR Green Supermix Bio-Rad 170-8880

DOWNLOAD MATERIALS LIST

References

  1. Chai, A., Withers, J., Koh, Y. H., Parry, K., Bao, H., Zhang, B., Budnik, V., Pennetta, G. hVAPB, the causative gene of a heterogeneous group of motor neuron diseases in humans, is functionally interchangeable with its Drosophila homologue DVAP-33A at the Neuromuscular Junction. Hum Mol Genet. 17, 266-280 (2008).
  2. Tsuda, H., Han, S. M., Yang, Y., Tong, C., Lin, Y. Q., Mohan, K., Haueter, C., Zoghbi, A., Harati, Y., Kwan, J., Miller, M., Bellen, H. J. The Amyotrophic Lateral Sclerosis 8 protein VAPB is cleaved, secreted, and acts as a ligand for Eph receptors. Cell. 133, 963-977 (2008).
  3. Dresbach, T., Torres, V., Wittenmayer, N., Altrock, W. D., Zamorano, P., Zuschratter, W., Nawrotzki, R., Ziv, N. E., Garner, C. C., Gundelfinger, E. D. Assembly of Active Zone Precursor Vesicles. Journal of Biological Chemistry. 281, 6038-6047 (2005).
  4. Lustgarten, V., Gerst, J. E. Yeast VSM1 Encodes a v-SNARE Binding Protein That May Act as a Negative Regulator of Constitutive Exocytosis. Molecular and Cellular Biology. 19, 4480-4494 (1999).
  5. Viñuela, A., Snoek, L., Riksen, J., Kammenga, J. Genome-Wide Gene Expression Analysis in Response to Organophosphorous Pesticide Chlorpyrifos and Diazinon in C. elegans. PloS one. 5, 1-8 (2010).
  6. Niwa, R., Hada, K., Moliyama, K., Ohniwa, R., Tan, Y., Olsson-Carter, K., Chi, W., Reinke, V., Slack, F. C. elegans sym-1 is downstream target of the hunchback-like-1 developmental timing transcription factor. Cell Cycle. 8, 4147-4154 (2009).
  7. Kershner, A., Kimble, J. Genome-wide analysis of mRNA targets for Caenorhabditis elegans FBF, a conserved stem cell regulator. PNAS. 107, 3963-3941 (2010).
  8. Hammock, E., Eagleson, K., Barlow, S., Earls, L., Miller, D., Levitt, P. Homologs of genes expressed in Caenorhabditis elegans GABAergic neurons are also found in the developing mouse forebrain. Neural Development. 5, 1-14 (2010).

Comments

2 Comments

  1. Thanks for the informative material. Could you post something about RealTime PCRs and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM
  2. Thanks for the informative material. Could you post something about http://www.fluoresentric.com/">RealTime PCTR and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics