Het bepalen van genetische expressie profielen in C. elegans Met behulp van microarray en real-time PCR

Biology
 

Summary

Microarray analyse werd uitgevoerd om genetische expressie profielen bepalen

Cite this Article

Copy Citation | Download Citations

Guthmueller, K. L., Yoder, M. L., Holgado, A. M. Determining Genetic Expression Profiles in C. elegans Using Microarray and Real-time PCR. J. Vis. Exp. (53), e2777, doi:10.3791/2777 (2011).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Synapsen zijn samengesteld uit een presynaptische actieve zone in de signalering cel en een postsynaptische terminal in de doelcel. In het geval van chemische synapsen, worden berichten gedragen door neurotransmitters vrijgelaten uit presynaptische terminals en ontvangen door postsynaptische receptoren op cellen. Onze vorige onderzoek in Caenorhabditis elegans heeft aangetoond dat VSM-1 negatief exocytose regelt. Bovendien, de analyse van synapsen in de VSM-1 mutanten toonde aan dat dieren die bij gebrek aan een volledig functionele VSM-1 zijn gestegen synaptische connectiviteit. Op basis van deze voorlopige bevindingen hebben we de hypothese dat C. elegans VSM-1 kan spelen een cruciale rol in synaptogenese. Om deze hypothese te testen, werd dubbel-gelabeld microarray analyse uitgevoerd, en gen expressie profielen werden bepaald. De eerste, totaal RNA werd geïsoleerd, omgekeerd getranscribeerd in cDNA, en gehybridiseerd met het DNA microarrays. Dan, in silico-analyse van de fluorescente probe hybridisatie bleek significante inductie van vele genen die coderen voor de leden van de grote sperma eiwitfamilie (MSP) in mutanten met verbeterde synaptogenese. MSP's zijn de belangrijkste component van het sperma in C. elegans en blijken nematoden eicel rijping en ovulatie signaal. In fruitvliegen, Chai en zijn collega's toonden aan dat een MSP-achtige moleculen presynaptische Bouton aantal en de grootte te regelen bij de neuromusculaire junctie. Bovendien, de analyse uitgevoerd door Tsuda en collega's twee gesuggereerd dat MSP's kunnen optreden als liganden voor Eph receptoren en activeren receptor tyrosine kinase signalering cascades. Ten slotte, real-time PCR-analyse bevestigd dat het gen dat codeert voor het MSP-32 is geïnduceerd in VSM-1 (ok1468) mutanten. Bij elkaar genomen, blijkt uit onderzoek uitgevoerd door ons laboratorium aangetoond dat de VSM-1 mutanten een aanzienlijke stijging van de synaptische densiteit, die kunnen worden gemedieerd door MSP-32 signaalfunctie.

Protocol

1. Isolatie van Totaal RNA

  1. Gezonde gesynchroniseerd nematoden werden geoogst door wassen platen met ruimte-temperatuur M9 medium, met behulp van 2-3 ml per plaat. Geresuspendeerd nematoden werden overgebracht naar 15 ml conische buizen en gepelleteerd door centrifugeren, 3200 g bij 4 ° C gedurende 4 minuten. Geoogst nematoden werden schoongemaakt uit zweefde bacteriën door resuspenderen de pellet met 7 ml 0,1 M NaCl en 7 ml ijskoude 60% w / v sucrose. De geresuspendeerde mengsel werd geïncubeerd op ijs gedurende 15 minuten en schone nematoden, die swim-up door middel van de sucrose-oplossing, werden verzameld na centrifugeren van het mengsel bij 3200 g bij 4 ° C gedurende 4 minuten. Vrij van bacteriën wormen werden overgebracht naar een nieuwe conische buis met steriele pipetten en twee keer gewassen met maximaal 15 ml RNase-vrij water, gevolgd door een 3200 g centrifugeren bij 4 ° C gedurende 2 minuten. De schone losjes verdicht pellet werd overgebracht naar 1,5 ml microcentrifugebuis en gecentrifugeerd op maximale snelheid (ongeveer 10.000 g) gedurende 30 seconden. Ten slotte was het meest RNase-vrij water verwijderd en 10 volumes van RNAlater werd toegevoegd aan de pellet, en opgeslagen bij 4 ° C tot klaar om verder te gaan.
  2. Voor te bereiden totaal RNA monsters werden geoogst nematoden gecentrifugeerd op maximale snelheid (ongeveer 10.000 g) voor 4 minuten en RNAlater was weggegooid. Vervolgens werd een snuifje Molecular Slijpen Resin (G bioscience) toegevoegd aan de pellet en mengsel werd bevroren met behulp van vloeibare stikstof. Bevroren worm suspensie werd gemalen tot een fijn poeder met stamper en vloeibare stikstof werd toegevoegd als nodig is om te houden het poeder koud. Na het slijpen, was het extract bewaard op ijs gedurende 5 minuten en vervolgens gemengd met 700 ul RLT / BME (verhouding 100 volume van RLT: een volume van BME) (Qiagen) en 472 ul 100% ethanol.
  3. Totaal RNA werd geïsoleerd met behulp van de RNeasy Mini Kit (Qiagen) en volgens de fabrikant aanbevolen protocol. Eindvolume van geïsoleerde RNA werd 60 ul per biologisch monster.

2. DNA en RNA Spijsvertering Cleanup

  1. 50 ug totaal RNA mogelijk besmet is met genomisch DNA werd gedigereerd met DNase I (Qiagen). Digest reacties die 0,1 U DNase / 1 ug RNA en 1X buffer RDP werden geïncubeerd bij kamertemperatuur gedurende 10 minuten.
  2. RNA-monsters behandeld met DNase I werden schoongemaakt met behulp van de RNeasy MinElute Clean-Up Kit (Qiagen). Protocollen die zijn aanbevolen door de fabrikant werden gevolgd en 60 ul laatste geëlueerd volume werd verkregen.

3. Kwalitatieve en kwantitatieve analyse van RNA

  1. RNA concentratie werd bepaald met behulp van de UV-spectrofotometer Nanodrop (Thermo Scientific).
  2. Integriteit van RNA monsters werd geëvalueerd met behulp van agarose elektroforese. In het kort werden 1% RNase-vrij agarose gels bereid met behulp van 1X Noord-Max Gly Gel Prep / Lopen Buffer (Ambion), 1% RNase-vrij Agarose LE (Ambion) en 0,5 ug / ml ethidiumbromide. Terwijl de gel was polymeriseren, werden RNA-monsters glyoxylated door het toevoegen van 5 pi van Glyoxyl Sample Loading Dye / monster en monsters te incuberen bij 50 ° C gedurende 30 minuten. RNA ladder was ook glyoxylated en geladen voor maat vergelijking.

4. cDNA synthese

  1. Voor elke synthesereactie, was 8,4 ug RNA monster, gemengd met 1 pi RT primer (1 pmol / pl). Een monster (WT of mutant) ontving de Cy5 vangen RT-primer; het andere monster ontvangen Cy3 capture RT-primer (meegeleverd met de Array 350 Labeling-Detection Kit, Genisphere). Voorbeeld mengsels werden verwarmd op 75-80 ° C gedurende 10 minuten en overgebracht naar ijs voor 2-3 minuten.
  2. Terwijl de RNA-monsters incubeer de mastermix (Genisphere) werd als volgt bereid: voor elke RT-reactie, combineerden we 4 pl 5X Reactie buffer voor RT, 1 ui dNTP (10 mM elk dATP, dCTP, dGTP, dTTP), 1 ui Superase -In RNase-remmer (meegeleverd met de Array 350 Labeling-Detection Kit, Genisphere), 1 ui RT Enzyme (200 u / ul). Last, was zeven pi mastermix toegevoegd aan elk RNA-monster, voorzichtig gemengd (gebruik geen vortex) en 2 uur geïncubeerd bij 42 ° C.

5. RNA degradatie en zuivering van cDNA monsters

  1. cDNA-synthese werd gestopt door het toevoegen van 3,5 ul 0.5M NaOH/50mM EDTA (eindconcentratie) en geïncubeerd bij 65 ° C gedurende 15 minuten. Daarna werden geneutraliseerd met behulp van reacties 1M Tris-HCl, pH 8,0 tot een eindconcentratie van 850 mM Tris-HCl te bereiken. Ten slotte werden WT en mutant cDNA's gecombineerd in een microcentrifugebuis. De lege buis werd gespoeld met 73 ul 1X TE-buffer en toegevoegd aan het cDNA met buis, het uiteindelijke volume van de gecombineerde cDNA buis werd 130 ul.
  2. Mixed cDNA werd gezuiverd volgende fabrikant protocol en de QIAquick PCR Purification Kit (Qiagen). De resulterende geëlueerd volume van de gezuiverde cDNA werd 60 ul.

6. Eerste Microarray hybridisatie

  1. C. elegans microarray dia's verkregen via GCAT (Genome Consortium voor Active Teaching) werden geblokkeerd opkamertemperatuur gedurende 1 uur gebruik van 0,1 mg / ml gesoniceerd zalmsperma DNA in 3x SSC, 0,1% SDS. Geblokkeerde dia's werden gespoeld door dompelen in ddH2O en spin-gedroogd door centrifugeren gedurende 1 minuut bij 2000 g in 50 ml conische buizen met KimWipe in bodem.
  2. Daarna werd 2X formamide-based hybridisatiebuffer (Genisphere) geïncubeerd bij 55 ° C gedurende 10 minuten, goed gemengd met kristallen op te lossen en gecentrifugeerd gedurende 1 minuut bij 10000 g. Vervolgens werd 25 pi cDNA monster voorzichtig gemengd door de knop met 25 ul van de 2X formamide-based hybridisatiebuffer. Verdund cDNA monster werd verzameld door flash draaien voor 15 seconden en geïncubeerd bij 80 ° C gedurende 10 minuten.
  3. Last, werd cDNA gehybridiseerd te glijden microarray door zorgvuldig pipetteren de hele verwarmde cDNA monster zonder het aanraken van de dia. Het monster werd gelijkmatig verdeeld op de microarray door voorzichtig het verlagen van een dekglas met behulp van een injectienaald. Voordat het dekglas was helemaal onderaan, was het dekglas een back-up getrokken, vervolgens verlaagd met de naald weer, en liet zachtjes op hun plaats vallen, het minimaliseren van de vorming van luchtbellen. Eerste hybridisatie opgericht werd culmineerde door de invoering van de glijbaan horizontaal in een 50 ml conische buis met 50 ul van DDH 2 O onder de glijbaan en 's nachts geïncubeerd bij 37 ° C.

7. Tweede hybridisatie

  1. Gehybridiseerd microarrays werden gewassen met 2X SSC bij verschillende temperaturen. Eerst werden microarray dia's overgebracht naar conische buisjes met kamertemperatuur 2X SSC en 0,2% SDS en klotste zachtjes dekglaasjes te verwijderen. Daarna werden microarray dia's overgebracht naar conische buisjes met 55 ° C 2X SSC en 0,2% SDS en geïncubeerd bij 55 ° C gedurende 15 minuten. Vervolgens werden dia's overgebracht naar SSC 2X en geïncubeerd bij kamertemperatuur gedurende 15 minuten, schudden zachtjes periodiek. Laatste, werden overgebracht naar dia's van 0,2 x SSC en geïncubeerd gedurende 15 minuten bij kamertemperatuur, schudden zachtjes periodiek. Gewassen dia's waren spin-gedroogd door de invoering van het label naar beneden slides in 50 ml conische buizen met een KimWipe in de bodem en gecentrifugeerd gedurende 1 minuut bij 2000 g.
  2. Vervolgens seconden hybridisatie mengsel werd bereid met behulp van 2X formamide op basis van hybridisatie buffer (Genisphere). Hybridisatiebuffer werd geïncubeerd bij 55 ° C gedurende 10 minuten en gecentrifugeerd gedurende 1 minuut bij 10000 g. Capture fluorescerende reagentia (Cy3 en Cy5) en de anti-fade reagens werden ontdooid bij kamertemperatuur en bedekt met een folie van reagentia te beschermen tegen fotobleken. Na hybridisatie stappen werden uitgevoerd in het donker naar geminimaliseerd blootstelling aan licht. 150 ul van 2X formamide-based hybridisatiebuffer werd gecombineerd met 1,5 ul anti-fade reagens om de anti-fade-behandelde hybridisatie mix te maken.
  3. Capture reagentia Cy3 en Cy5 waren gevortext gedurende 3 seconden en gecentrifugeerd gedurende 15 seconden, 10.000 g. Tweede hybridisatie mengsel werd bereid het combineren van 75 ul anti-fade-behandelde hybridisatie mix, 60 ul nuclease-vrij water, 7,5 ul Cy3 vangen reagens, en 7,5 pl Cy5 vast te leggen reagens. Tweede hybridisatie mix werd geïncubeerd gedurende 10 minuten bij 75 ° C en 50 pl van verhitte mengsel werd zeer zorgvuldig gepipetteerd op de gewassen / gedroogde microarray dia. Gelijkmatig verdeeld op het monster van de microarray, was een dekglas voorzichtig zakken met behulp van een injectienaald. Voordat het dekglas was helemaal onderaan, was het dekglas een back-up getrokken, vervolgens verlaagd met de naald weer, en liet zachtjes op hun plaats vallen, het minimaliseren van de vorming van luchtbellen. Hybridiserende microarray slide werd horizontaal geplaatst in 50 ml conische buis bedekt met een folie en 50 ul van DDH 2 O werd toegevoegd onder de dia op een vochtige kamer te creëren. Tweede hybridisatie werd geïncubeerd bij 37 ° C gedurende 2-5 uur.
  4. Tweede hybridiserende microarray werd gewassen in het donker met behulp van kamertemperatuur 2X SSC, 0,2% SDS, 1 mM DTT en klotste zachtjes dekglas te verwijderen. Toen werd microarray overgebracht naar overdekte conische buis met 55 ° C 2X SSC, 0,2% SDS, 1 mM DTT en geïncubeerd gedurende 15 minuten bij 55 ° C. Schuif vervolgens werd overgebracht naar bedekt conische buis met 2X SSC, 1 mM DTT en geïncubeerd gedurende 15 minuten bij kamertemperatuur, schudden zachtjes periodiek. Last, schuif werd overgebracht naar 0,2 x SSC, 1 mM DTT en geïncubeerd bij kamertemperatuur gedurende 15 minuten, schudden zachtjes periodiek. Microarray slide werd gedroogd door centrifugeren gedurende 1 minuut, 2.000 g, slide-label naar beneden in overdekte 50 ml conische buis met KimWipe in de bodem. Droge microarray dia's werden gescand met behulp van GenePix Personal Scanner model 4100A op Davidson College.

8. Microarray analyse

  1. Beelden verkregen na het scannen werden geanalyseerd met behulp van de MAGICTool Software ontwikkeld Davidson College van Laurie Heyer en haar studenten. Kortom, onder het "Project" tab, was een "New Project" gemaakt en opgeslagen. Onder de "Build Expression Profile" tab, "Load Image Pair" is geselecteerd en de rode image-bestand (_635.tif) is geüpload als 'Rood' en het groene imago-bestand (_532.tif) is geüpload als "Groen". Dan, met behulp van de "Build Expression Profile" tab en "Load Gene List", een C. elegans gen lijst bestand verkregen van de GCAT website is geüpload.
  2. Microarray beeld werd aangepakt en gridded behulp van de "Build Expression Profile" tab en "Create / Edit Grid"-optie. Het "Grid Setup" dialoogvenster was bewerkt met behulp van "48" voor het aantal grids ", 22 rijen" en "22 kolommen" voor elke grid, plekken genummerd "Links naar rechts" en "boven naar onder". "Percentage Contrast Change" werd verhoogd en zoomde in op het rooster totdat de individuele plaatsen waren gemakkelijk te onderscheiden. Rasters werden gemaakt door eerst te kiezen voor "Set Top Left Spot" aan de linker paneel. Dan, het centrum van de linkerbovenhoek plek, waren top juiste plek en onderste rij klikte op "Grid 1". Deze gridding procedure werd herhaald voor elk van de 48 grids, uitgaande van links naar rechts en van boven naar beneden. Toen gridding was voltooid, werd het huidige rooster opgeslagen onder "File" "Huidige Grid Opslaan als". Als het raster met succes werd gered van de "Finished" tab is geselecteerd.
  3. Het elimineren van enige ongerelateerde punten uit de analyse, was het "Build Expression Profile" tab geopend. Onder de "Aanpak Planbord" optie "Spot markeren" is geselecteerd. Vlekken of strepen achtergrond fluorescentie werden gemarkeerd en gered door te kiezen voor "Save Current Flags als" onder het "Bestand Tab".
  4. Gemarkeerde bestanden zijn gesegmenteerd met behulp van de "Build Expression Profile" tab en kiezen voor "Fixed Radius" als de segmentatie methode van keuze. De straal is ingesteld op de gewenste grootte, en "Update Data" werd geklikt. Om ervoor te zorgen dat de cirkel blijft binnen de gerasterde gebied (geel vierkant) hebben we verschoven boven naar beneden en van links naar rechts en een keer gecontroleerd "Create Expression Profile" werd geselecteerd.
  5. Tijdens segmentatie, de software berekende de Rood: Groen fluorescentie ratio's voor elk van de plekken die overbleven na het markeren. Met behulp van de "Expression" tab, "manipuleren Data" "Transform" is geselecteerd. Een "Transform Data" dialoogvenster verscheen waar "logb (x)" optie, en b = 2 werd ingevoerd. "Werken Expression File" werd verkend van de "Expression" tabblad. Voor een experiment waarin het wild type ontving de Cy3 (groen) vast te leggen volgorde en de mutant ontving de Cy5 (rood) vast te leggen volgorde, de waarde van de log-getransformeerde ratio's waren positief voor genen die werden geïnduceerd en negatief voor onderdrukte genen.
  6. Laatste, werden genen geïnduceerd of onderdrukt door een bepaalde factor geanalyseerd te kiezen voor "Verkennen" onder de "Expression" tabblad. In het "Exploring" dialoogvenster, "Zoek Genes Matching Criteria" was ingesteld om genen met een "Max. Value> X (positief getal voor geïnduceerde genen)" of "Min. Value <X (negatief getal voor de onderdrukte genen)" in experimenten zoals die beschreven in # 5. Fold-expressie was gelijk aan 2x, waarbij 'x' is de waarde van het getal dat in de selectiecriteria.

9. cDNA Synthese en Real-Time PCR

  1. Totaal RNA werd geïsoleerd zoals eerder beschreven. Zodra de kwaliteit en kwantiteit van geïsoleerde RNA werd bepaald, werd cDNA gesynthetiseerd met behulp van de iScript cDNA synthese kit (BioRad), 500 ng / ul totaal RNA geïsoleerd van de wild-type en mutant en door de fabrikant aanbevolen protocollen.
  2. Real-time PCR-reacties werden set-up met behulp van de iQ SYBR Green Supermix (BioRad), 100-500 nmol gen-specifieke primers (tabel 1) en 4 ui cDNA's die door de vorige stap. 10 pi reacties werden uitgevoerd met behulp van de thermocycler CFX96 Real-Time System (Bio-Rad).
  3. De thermocycler werd voor het eerst verwarmd tot 95 ° C gedurende 3 minuten. Dit werd gevolgd door een stap bij 95 ° C gedurende 5 seconden en 58 ° C gedurende 30 seconden. Deze lus werd voltooid in totaal veertig keer, en een 65-95 ° C smelten bocht met een helling van 0,5 graden was ook geplaatst. ΔΔCT waarden werden berekend met behulp van drie housekeeping genen (act-1, CDC-42, en PMP-3) als controlegroep.
GENE Voorwaartse primer Reverse primer
gst-5 CTGCTCCATTCGGACAACTT TCCGTTGAGCTTGAACTCAC
gst-9 GGAAGACAACTGGCACAATC ACCGAGAGCATCAACTTGAG
kcnl-1 TACGCTCGGCATGTGTTGTATC CCAATCATCGGCTCCACTATCT
KSR-2 CGAACTGCTGCTGGAATGCT GTGCTGCGTCTCTTCTGCTT
lim-9 CTCATCGAGTGGCTCAATCT CACCTTGCTCCATCTTCAAC
lpr-6 CAGCAGTCACTTCTGTTCAC TCTCCAATAGCGGTACTCC
MES-6 TTGTTCCGTTGGCTCACGTACAG CGACAGACGCAGATACACGATCA
msp-32 GCCGCACAGGTATGATCCAG ATCCAATACGGCGAGCCGAG
msp-142 GATCCACCATGTGGAGTTCT GATTCTTGCGACGGACCATA
msp-38 GCCTTCGGACAAGAGGATACC CCATACCGTCTCCTTGGAACC
msp-45 TCACCGTTGAGTGGACCAAT ACGAACCAACCGTCTCCTT
msp-49 CGACGACAAGCACACCTACCACATCAA TCGAGGACTCCACATGGTGGATCAACT
msp-56 CGAAGATCGTCTTCAATGCGCCATAC TCCACATGGTGGATCAACTCCAAGTC

Tabel 1. Forward en Reverse primer sequenties voor Real-Time PCR

10. Representatieve resultaten:

RNA-isolatie en analyse

Fusie van actieve zone voorloper blaasjes aan de presynaptische locaties is een verplichte stap tijdens synaptogenese (3). VSM-1, een onlangs geïdentificeerd v-SNARE meester eiwit, werd voorgesteld om blaasjes fusie in gist en synaptogenese in nematoden (zie figuur 1) remmen door een onbepaald mechanisme (4, en ons onuitgegeven werk). Om beter inzicht in de moleculaire route die ten grondslag liggen VSM-een regelgeving in nematoden en breng wat licht in de synaptogenese veld, begonnen we een genoom-brede scherm en vastgesteld dat de belangrijkste sperma eiwit genen (MSP) worden geïnduceerd in het ontbreken van volledig functionele VSM-1 .

Om de geïnduceerde genen te onderzoeken in de VSM-1 (ok1468) mutante stam van C. elegans, voerden we een microarray gen analyse. Dit werd gedaan door het testen van transcripts geïsoleerd van wild-type en de VSM-1 mutante stam en het bepalen van hun verrijking. In het bijzonder, hebben we eerst geïsoleerd totaal RNA van synchrone L4 en L3 wild-type en de VSM-1 mutant larven aaltjes. Dan hebben we behandeld de totale RNA verkregen met DNase I en onderzocht de kwaliteit van het geëxtraheerde RNA met behulp van agarose gelelektroforese. In het experiment weergegeven in figuur 2, werd een ladder gebruikt in de eerste baan om het aantal basenparen vormen voor de normen. Wild-type monsters voorbehandeld en post-behandeld met DNase I werden geladen in de lanen 2 en 4, en de VSM-1 mutant monsters voorbehandeld en post-behandeld met DNase I werden geladen in lanen 3 en 5 respectievelijk. Analyse van de RNA-gelelektroforese bleek dat wild-type en de VSM-1 mutant RNA monsters waren intact en van goede kwaliteit. Dit werd bepaald door het observeren van twee banden die de twee subeenheden van ribosomaal RNA vertegenwoordigd.

Microarray hybridisatie

Zodra de kwaliteit van het RNA was bepaald, we gingen met de cDNA synthese. Om dit te doen, we reverse getranscribeerd het mRNA en voegde een capture volgorde om de staart. De geproduceerde cDNA's met vast te leggen sequenties voor Cy3 en Cy5 werden gehybridiseerd om dia's te microarray en verzonden voor het scannen. Microarray-beelden werden vervolgens ingevoerd in een open-source software programma genaamd MAGICTool ontwikkeld Davidson College van Laurie Heyer en haar studenten. Met behulp van deze software hebben we bedekt Cy3 en Cy5 afbeeldingen, gridded microarrays, en geanalyseerd fluorescerende profielen (zie figuur 3). Zodra gridding was compleet we dan gesegmenteerde elk vierkantje ervoor te zorgen dat de hele gedrukte oligonucleotide werd onderzocht. Vervolgens analyseerden we de geïnduceerde ratio's en creëerde genetische profiel van uitingen waaruit blijkt dat genen die coderen voor de MSP gezin worden geïnduceerd in nematoden met een verbeterde synaptogenese. (Tabel 3).

Validatie en kwantificering van genexpressie met behulp van real-time PCR.

Om verder het genetische profiel te begrijpen in het VSM-1 mutant analyseerden we een aantal genen die coderen voor de leden van de MSP-familie met behulp van real-time PCR. Eerst werd totaal RNA geïsoleerd van wild-type en de VSM-1 (ok1468) mutante stammen. RNA monsters werden vervolgens omgekeerd getranscribeerd in cDNA en wordt gebruikt voor real-time PCR-analyse. Evaluaties van real-time PCR-expressie profielen blijkt dat een lid van de MSP familie lijkt te worden opgewekt in de VSM-1 (ok1468) mutanten. Bovendien, real-time PCR data valideert bevindingenvan microarrays en versmald de zoektocht naar een MSP-gen kandidaat (figuur 4).

Figuur 1
Figuur 1. A. UNC-17 Immunokleuring bleek dat VSM-1 mutanten hoger synaptische densiteit vertonen langs de dorsale zenuw snoer. Beelden werden geanalyseerd 63x vergroting, posterior (rechts) aan de vulva. B. Analyse van de WT en VSM-1 (ok1468) mutant synapsen aangeduid statistisch significant verbeterde synaptische densiteit in de VSM-1 mutant (** p <0,01). Twintig nematoden waren beelden voor elk genotype.

Figuur 2
Figuur 2. De kwaliteit van de geëxtraheerde RNA werd bepaald met behulp van agarose gelelektroforese. De aanwezigheid van twee intacte ribosomale subunits voor en na de DNase I behandeling was duidelijk in RNA geëxtraheerd uit wild-type en de VSM-1 (ok1468) monsters.

Figuur 3
Figuur 3. A. Microarray afbeelding voor een experiment, waar de controle was gelabelde rode (Cy5) en de VSM-1 mutant was gelabeld groen (Cy3). B. Representatieve afbeelding met 1 op de 48 grids geanalyseerd per microarray. Elk klein vierkant op een raster is vertegenwoordiger van een enkele gedrukte oligonucleotide, en elk rooster bestaat uit 22 rijen en 22 kolommen.

Tabel 2
Tabel 2. Microarray-analyse van transcripten geïsoleerd uit Larven 4 (A) en larven 3 (B) C. elegans nematoden toonden aan dat genen die coderen voor de grote sperma eiwitten worden geïnduceerd in mutanten met een verbeterde synaptogenese. Gemarkeerde genen geeft geïnduceerde genen in zowel larven 3 en 4 Larven.

Figuur 4
Figuur 4. Real-time PCR analyse toonde aan dat een lid van het MSP-gen familie, MSP -32 werd geïnduceerd in VSM-1 (ok1468) mutanten. Vertegenwoordiger van de genormaliseerde vouwen uitdrukking grafiek blijkt dat het VMS-1 (ok1468) ΔΔCT waarden voor MSP-32 zijn significant verschillend in vergelijking met wild type (WT) en drie housekeeping genen worden gebruikt voor de normalisatie (act-1, CDC-42, en PMP -3). Gemiddeld drie replica's zijn uitgezet + / - standaarddeviatie.

Discussion

In dit onderzoek ontwikkelden we een eenvoudig, gebruiksvriendelijk protocol dat gebruikt kan worden om bepaald genexpressieprofielen ten grondslag liggen aan verschillende biologische fenomenen. In dit protocol werd totaal RNA voor het eerst geïsoleerd en behandeld worden met behulp van DNase I. Onze manier van RNA-isolatie is sterk vereenvoudigd door het weglaten van fenol extractie en het gebruik van harsen affiniteit voor het opruimen 5,6. Kortom, C. elegans cuticule en celmembranen waren gebarsten te openen door ze te bevriezen met vloeibare stikstof nematoden en slijpen met moleculaire hars. Vervolgens geëxtraheerde RNA werd behandeld met DNase ik al eerder cDNA synthese. De volgende stap werd toegevoegd aan niet-specifieke hybridisaties minimum te beperken; RNA-monsters besmet met genomisch DNA kunnen introduceren interferentie en produceren veel vals-positieven. Dan, wild type en VSM-1 (ok1468) mutant cDNA's werden getagd met Cy3 en Cy5 vastleggen sequenties en gehybridiseerd op C. elegans microarrays verkregen via de GCAT programma. Dit systeem is gevoeliger dan soortgelijke producten, en zijn twee kleuren ontwerp vermindert het aantal benodigde arrays, wat resulteert in meer tijd en kosten efficiency 7,8. Bovendien wordt dit systeem niet vereist dat de gespecialiseerde apparatuur van andere soortgelijke systemen; dan ook, deze procedure zou worden gebracht in elke standaard laboratorium setting 7. Ten derde, TL-gehybridiseerd reeks beelden werden geanalyseerd met behulp van de open source software MAGICTool, en genexpressie profielen werden gemaakt. MAGICTool is een gebruiksvriendelijk programma dat gemakkelijk wordt gebruikt door mensen van alle niveaus, van de undergraduate tot de post-doctoraat. Echter, optimale prestaties vereist grote geheugen beschikbaarheid. Ten slotte kandidaat-genen verkregen met behulp van microarray analyse werden gevalideerd met real time PCR.

Hoewel de genomische benadering is een efficiënte methode voor het bestuderen van biologische verschijnselen, zijn er een aantal beperkingen een rekening moet worden gehouden. De eerste, ondanks de specificiteit van deze microarray protocol, afschriften binnen een familie zijn niet te onderscheiden van elkaar als de gedrukte oligonucleotide wordt genomen uit geconserveerde sequenties. Real time PCR compenseert overeenkomsten binnen een gen familie en kan zelfs onderscheid maken tussen specifieke isovormen van hetzelfde gen. Echter, met real time PCR is het een uitdaging om echte controles die worden uitgedrukt even het hele levensduur van een organisme te vinden. Vanwege dit, zullen de resultaten worden de relatieve. Een proteomics benadering is een alternatief voor onze techniek. Individuele eiwitten kunnen worden geïsoleerd met behulp van 2D-gelelektroforese en geïdentificeerd met massa-spectrometrie.

Onze studies tonen aan dat met name veel leden van de Major Sperma Protein (MSP) familie worden geïnduceerd in VSM-1 mutant nematoden met verbeterde synaptische densiteit. MSP's zijn uniek voor C. elegans en zijn verantwoordelijk voor eicel rijping en ovulatie. Chai 1 heeft aangetoond dat de regulering van presynaptische Bouton aantal en grootte op de neuromusculaire junctie in fruitvliegen waarschijnlijk wordt gecontroleerd door moleculen die bestaan ​​uit Major Sperma Protein domeinen. Studies van Tsuda en zijn collega's hebben aangetoond dat twee Major Sperma eiwitdomeinen kunnen dienen als liganden voor Ephrine receptoren, triggering receptor tyrosine kinase signalering cascades. Bovendien, real-time PCR analyse gevalideerd en versmald microarray resultaten op een lid van het MSP-familie, MSP-32. Bij elkaar genomen, het werk dat hier wordt gepresenteerd is een genoom-brede analyse van een centrale neurowetenschap dilemma evenals de macht van de undergraduate onderzoek in het wetenschappelijke streven.

Disclosures

Geen belangenconflicten verklaard.

Acknowledgments

Dit werk werd uitgevoerd door studenten van Southwestern Oklahoma State University, Weatherford OK. Dit werk werd ondersteund door NSF RUI-0963258, NIH OK-INBRE 2P20RR016478, GCAT en OCAST HR09-137S.

De vsm1 (ok1468) mutant werd geïsoleerd door de Oklahoma Gene Knockout Consortium.
De auteurs danken Dan Stefanovic en Tanner Wheeler voor hun waardevolle hulp tijdens de uitvoering van het project.

Materials

Name Company Catalog Number Comments
RNA Later Ambion AM7020
Molecular Grinding Resin G-Biosciences 786-138
RNeasy Mini Kit Qiagen 74104
Rnase-free Agarose LE Ambion AM9040
NorthernMax Gly 10X Gel Prep/Running Buffer Ambion 8678
RNA Millenium Marker Ambion AM7150
Glyoxal Sample Loading Dye Ambion 8551
DNase set Qiagen 79254
RNeasy MinElute Kit Qiagen 74204
RT Enzyme and 5X Reaction Buffer Genisphere RT300320
Array 350 Genisphere W300180
QIAquick PCR Purification Kit Qiagen 28104
20X SSC VWR international 82021-4846
Sheared Salmon Sperm DNA Ambion AM9680
SDS Solution Promega Corp. V6551
DTT EM VWR international 3860
iScript cDNA Synthesis Kit Bio-Rad 170-8890
iQ SYBR Green Supermix Bio-Rad 170-8880

DOWNLOAD MATERIALS LIST

References

  1. Chai, A., Withers, J., Koh, Y. H., Parry, K., Bao, H., Zhang, B., Budnik, V., Pennetta, G. hVAPB, the causative gene of a heterogeneous group of motor neuron diseases in humans, is functionally interchangeable with its Drosophila homologue DVAP-33A at the Neuromuscular Junction. Hum Mol Genet. 17, 266-280 (2008).
  2. Tsuda, H., Han, S. M., Yang, Y., Tong, C., Lin, Y. Q., Mohan, K., Haueter, C., Zoghbi, A., Harati, Y., Kwan, J., Miller, M., Bellen, H. J. The Amyotrophic Lateral Sclerosis 8 protein VAPB is cleaved, secreted, and acts as a ligand for Eph receptors. Cell. 133, 963-977 (2008).
  3. Dresbach, T., Torres, V., Wittenmayer, N., Altrock, W. D., Zamorano, P., Zuschratter, W., Nawrotzki, R., Ziv, N. E., Garner, C. C., Gundelfinger, E. D. Assembly of Active Zone Precursor Vesicles. Journal of Biological Chemistry. 281, 6038-6047 (2005).
  4. Lustgarten, V., Gerst, J. E. Yeast VSM1 Encodes a v-SNARE Binding Protein That May Act as a Negative Regulator of Constitutive Exocytosis. Molecular and Cellular Biology. 19, 4480-4494 (1999).
  5. Viñuela, A., Snoek, L., Riksen, J., Kammenga, J. Genome-Wide Gene Expression Analysis in Response to Organophosphorous Pesticide Chlorpyrifos and Diazinon in C. elegans. PloS one. 5, 1-8 (2010).
  6. Niwa, R., Hada, K., Moliyama, K., Ohniwa, R., Tan, Y., Olsson-Carter, K., Chi, W., Reinke, V., Slack, F. C. elegans sym-1 is downstream target of the hunchback-like-1 developmental timing transcription factor. Cell Cycle. 8, 4147-4154 (2009).
  7. Kershner, A., Kimble, J. Genome-wide analysis of mRNA targets for Caenorhabditis elegans FBF, a conserved stem cell regulator. PNAS. 107, 3963-3941 (2010).
  8. Hammock, E., Eagleson, K., Barlow, S., Earls, L., Miller, D., Levitt, P. Homologs of genes expressed in Caenorhabditis elegans GABAergic neurons are also found in the developing mouse forebrain. Neural Development. 5, 1-14 (2010).

Comments

2 Comments

  1. Thanks for the informative material. Could you post something about RealTime PCRs and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM
  2. Thanks for the informative material. Could you post something about http://www.fluoresentric.com/">RealTime PCTR and Traditional PCRs.

    Reply
    Posted by: Anonymous
    February 29, 2012 - 7:20 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics