Author Produced

تسلسل الدقيقة البكتيرية في الدم المحيطي : لدينا تجربة مع المرضى المصابين بفيروس الإيدز

Medicine

Your institution must subscribe to JoVE's Medicine section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

وتجربتنا تبين كيفية إجراء تحليل تسلسل الأنواع البكتيرية translocating في الدم المحيطي من المرضى بفيروس نقص المناعة البشرية.

Cite this Article

Copy Citation | Download Citations

Merlini, E., Bellistri, G. M., Tincati, C., d'Arminio Monforte, A., Marchetti, G. Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients. J. Vis. Exp. (52), e2830, doi:10.3791/2830 (2011).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

وفيزيولوجيا الجهاز الهضمي صحي مستعمرة من قبل مجموعة كبيرة ومتنوعة من الجراثيم المتعايشة التي تؤثر على تطور الخلطية والخلوية المخاطية 1،2 الجهاز المناعي.

محمية مجهريات البقعة من الجهاز المناعي عن طريق حاجز الغشاء المخاطي قوية. ومن المعروف الالتهابات والمضادات الحيوية لتغيير كل من الحاجز الطبيعي القناة الهضمية وتكوين البكتيريا المقيمين ، والتي قد تؤدي إلى تشوهات المناعي ممكن 3.

فيروس يسبب ثغرة في جدار المعدة والأمعاء مع الفشل التدريجي للحصانة والتسرب إلى الدورة الدموية الجهازية من المنتجات الحيوية البكتيرية ، مثل lipopolysaccharide وشظايا من الحمض النووي البكتيري ، والتي تساهم في تنشيط جهاز المناعة النظامية 4-7. متورط إزفاء الميكروبية في فيروس نقص المناعة البشرية / الإيدز إمراض مناعي واستجابة للعلاج 4،8.

نحن تهدف إلى تميز تكوين البكتيريا في الدم المحيطي translocating من المرضى المصابين بفيروس الإيدز. لمتابعة هدفنا أنشأنا تفاعل PCR لجين 16S panbacteric ribosomial تليها تحليل التسلسل.

باختصار ، يتم استخدام الدم الكامل من كلا الموضوعين المصابين بفيروس الإيدز وصحية. نظرا إلى أن الأفراد الأصحاء الحاضر توازن الأمعاء الطبيعي أنه لا يتوقع من إزفاء الدقيقة في هؤلاء المرضى. التالية كلها جمع الدم عن طريق بزل الوريد وفصل البلازما ، ويتم استخراج الحمض النووي من البلازما وتستخدم لتنفيذ عملية واسعة النطاق تفاعل PCR ل16S panbacteric ribosomial الجين 9. تتم تنقية المنتجات التالية PCR ، والاستنساخ وتسلسل التحليلات.

Protocol

التعامل مع عينات الدم الملوث بفيروس نقص المناعة البشرية يتطلب بعض التوصيات الهامة.
يجب نقل جميع عينات من الدم في أوعية مانعة للتسرب قوي. يجب توخي الحذر عند جمع العينات لتجنب تلوث الخارجي للحاوية وأي الأوراق المصاحبة للعينة.
يجب على جميع الأشخاص المصابين تجهيز الدم ارتداء القفازات. يجب تغيير القفازات وغسل اليدين بعد الانتهاء من تجهيز العينات.
ويجب أن يتم تجهيز عينات دم المصابين بفيروس الإيدز في قلنسوة من الدرجة الثانية لمجلس الوزراء بيولوجية.
وينبغي استخدام الوسائل الميكانيكية pipetting.
يجب أن يقتصر استخدام الإبر أو الأدوات الحادة الأخرى (بما في ذلك ماصات مثل الزجاج أو الأنابيب الشعرية) على الحالات التي لا يوجد بديل.
يجب تطهير الأسطح المختبر مع مطهر الكيميائية المناسبة بعد انسكاب الدم ، وعندما يتم الانتهاء من أنشطة العمل.
يجب تطهير المواد الملوثة قبل إعادة استخدامها أو يجب التخلص منها بشكل صحيح من طريق النفايات السريرية.
وينبغي أن يعامل كل حادثة التعرض المهني للدم أو سوائل قد تكون معدية (أي تلك التي تتطلب احتياطات عالمية) كما في حالات الطوارئ الطبية كما يجب أن تبدأ فورا تدخلات أن تكون فعالة.
البروتوكول يتطلب 5 أيام لإنجازه. الإطار الزمني هو مفصل في الشكل 1.
ويتم تحديد الأنواع البكتيرية باستخدام الأساليب المذكورة في الشكل 2.

1. جمع العينات

  1. ويوجه 9 مل من الدم الكامل في أنابيب تحتوي على EDTA.
  2. وطرد أنابيب في 2000 دورة في الدقيقة لمدة 10 دقائق للحصول على RT البلازما.
  3. ويتم جمع البلازما في أنبوب عقيم إيبندورف 2 مل.

2. استخراج الحمض النووي من عينات البلازما

  1. تطهير كاف هود ، وماصات والمواد اللازمة لهذه التجربة من أجل ضمان العقم.
  2. موقف جميع المواد تحت الأضواء فوق البنفسجية لمدة لا تقل عن 30 دقيقة.
  3. يمسح القفازات مع مطهر.
  4. بلل المناشف الورقية القليلة في الإيثانول ووضعها تحت غطاء محرك السيارة. في كل مرة يتم تجاهل نصيحة مسح ماصة على مناشف ورقية مبللة.

يتم استخراج الحمض النووي باستخدام طقم التجارية باتباع إرشادات الشركة المصنعة (DNA مجموعة سهلة ، Invitrogen ، كارلسباد كاليفورنيا ، الولايات المتحدة).

  1. يتم وضع 350 ميكرولتر من البلازما في أنبوب إيبندورف 2ml العقيمة.
  2. وتستخدم 350 ميكرولتر من الماء عالى النقاء وتصفيتها السيطرة السلبية.
  3. أضف 10 ميكرولتر من الليزوزيم (1mg/ml) للعينات.
  4. احتضان لمدة 30 دقيقة عند 37 درجة مئوية.
  5. إضافة 500 ميكرولتر من محلول تحلل والمزيج بلطف على العينات.
  6. احتضان لمدة 7 دقائق عند 65 درجة مئوية.
  7. إضافة 900 ميكرولتر من كلوروفورم للعينات.
  8. دوامة بقوة حتى العينات لزج موحد.
  9. إضافة 200 ميكرولتر من محلول الأمطار ودوامة بقوة.
  10. أجهزة الطرد المركزي في 10500 دورة في الدقيقة العينات لمدة 10 دقيقة على RT لفصل مراحل وتشكل واجهة.
  11. نقل مائي المرحلة العليا لأنبوب microcentrifuge الطازجة التي تحتوي على 1 مل من الإيثانول بنسبة 100 ٪.
  12. أجهزة الطرد المركزي في 10500 دورة في الدقيقة العينات لمدة 10 دقيقة على 4 درجات مئوية.
  13. إزالة الايثانول.
  14. إضافة 1ml من الايثانول 70 ٪.
  15. الطرد المركزي عينات بأقصى سرعة لمدة 10 دقيقة على 4 درجات مئوية.
  16. إزالة الايثانول. وينبغي إزالة بقايا الايثانول مع pipettator.
  17. Resuspend وبيليه في 50 ميكرولتر من الماء عالى النقاء.
  18. قراءة تركيز الحمض النووي مع معمل.

3. 16S الرنا الريباسي جين PCR

يتم تنفيذ PCR التضخيم كما هو موضح سابقا 9.

  1. تضخيم الحمض النووي في خليط التفاعل ميكرولتر 100 يتألف من 10 ميكرولتر من العازلة 10X PCR ، 5 ميكرولتر من 25 ملم MgCl2 ، 5 ميكرولتر من dNTPs إجمالي 2 ملم ، 1 ميكرولتر من 50 ميكرومتر التمهيدي RW01 (AACTGGAGGAAGGTGGGGAT) ، 1 ميكرولتر من 50 ميكرومتر التمهيدي DG74 (AGGAGGTGATCCAACCGCA) ، و 34 ميكرولتر من H20 و 0.5 ميكرولتر من بوليميريز طق (AmpliTaq الذهب ، Biosystem التطبيقية ، فوستر سيتي ، كاليفورنيا ، الولايات المتحدة).
  2. نقل المزيج PCR في المرشحات من أجل تجنب احتمال التلوث الجرثومي بوليميريز طق.
  3. مرشحات أجهزة الطرد المركزي (Microcon ، ميليبور ، فالجهاز يبث اشعة تماثل ، MA ، الولايات المتحدة الأمريكية) لمدة 30 دقيقة في 500 RCF في 4 درجات مئوية.
  4. قسامة المزيج PCR وفقا لعدد من العينات التي تحتاج إلى تضخيم (الإيجابية والسلبية تسيطر PCR ، وعينات المياه المستخرجة).
  5. استخدام الشروط التالية cycler الحرارية : 94 درجة مئوية لمدة 10 دقيقة و 40 مرة لمدة 1 دقيقة في كل مرة على 94 درجة مئوية و 55 درجة مئوية و 72 درجة مئوية و 10 درجة مئوية في دقيقة 72
  6. تصور للمنتج PCR على agarose هلام 2 ٪. استخدام 100 سلم غليان الحمض النووي. PCR حجم المنتج هو حوالي 360 سنة مضت (الشكل 3).

4. PCR تنقية المنتج

وينبغي أن يطهر العينات الإيجابية الوحيدة PCR. تتم تنقية بهأتباع مجموعة تجارية تعليمات الشركة الصانعة (PCR PureLink microkit ، Invitrogen ، كارلسباد كاليفورنيا ، الولايات المتحدة).

  1. إضافة 4 مجلدات تحتوي على الاحتياطي ملزم لكل 1 الأيزوبروبانول حجم المنتج PCR.
  2. PCR نقل المنتجات العازلة مع ربط إلى عمود.
  3. أجهزة الطرد المركزي لمدة 1 دقيقة في إطار التعاون الإقليمي في RT 10000.
  4. اغسل اغسل العمود مع العازلة التي تحتوي على الإيثانول.
  5. أجهزة الطرد المركزي لمدة 1 دقيقة في إطار التعاون الإقليمي في RT 10000.
  6. أجهزة الطرد المركزي في أقصى سرعة لمدة 1 دقيقة في لتجف RT الغشاء السيليكا العازلة وإزالة أي اغسل المتبقية مع الايثانول.
  7. أضف 10 ميكرولتر من الماء عالى النقاء.
  8. احتضان لمدة 1 دقيقة في RT.
  9. أجهزة الطرد المركزي في أقصى سرعة لمدة 2 دقيقة على RT لجمع الحمض النووي المنقى.

5. استنساخ

Lysogeny مرق (LB) إعداد اللوحة

  1. حل 25 غرام من مزيج LB في حوالي 800 مل من الماء.
  2. جلب الحجم النهائي إلى 1 L.
  3. إضافة 15 غرام من Bactoagar.
  4. الأوتوكلاف لمدة 20 دقيقة.
  5. بعد التعقيم ، بقوة دوامة الحل في قارورة لخلط آغار المنصهر.
  6. حل تبريد إلى 50 درجة مئوية.
  7. إضافة أمبيسيلين (50 ميكروغرام / مل) ، ودوامة حتى يذوب.
  8. صب لوحات لعمق 3mm تقريبا.
  9. ترك لوحات في درجة حرارة الغرفة.
  10. انتشار X - غال (40mg/ml) وIPTG (100 ملم) على كل صفيحة ، واحتضان LB عند 37 درجة مئوية لتصبح جاهزة للاستخدام.

تحويل خلايا المختصة

يتم تنفيذ التحويل باستخدام تعليمات أتباع عدة التجارية المصنعة (TA توبو استنساخ عدة ، Invitrogen ، كارلسباد كاليفورنيا ، الولايات المتحدة).

  1. تحضير مزيج رد فعل الاستنساخ (1-4 ميكرولتر من الناتج PCR الطازجة ، 1 ميكرولتر من محلول الملح ، 1 ميكرولتر من ناقلات المياه ، وإذا لزم الأمر).
  2. رد الفعل مزيج بلطف واحتضان لمدة 5-10 دقائق على RT.
  3. ضع رد فعل الجليد.
  4. إضافة 2 ميكرولتر من رد فعل الاستنساخ إلى قارورة من الخلايا المختصة والمزيج بلطف.
  5. احتضان على الجليد لمدة 30 دقيقة.
  6. حرارة صدمة الخلايا لمدة 30 ثانية في 42 درجة مئوية.
  7. نقل على الفور إلى أنبوب الجليد.
  8. إضافة 250 ميكرولتر من المتوسط.
  9. غطاء الأنبوب tighly ويهز الأنبوب أفقيا في 37 ساعة : 1 درجة مئوية.
  10. انتشار 50 ميكرولتر من كل تحول على لوحة prewarmed انتقائي.
  11. يحضن بين عشية وضحاها في 37 درجة مئوية.

الحضانة التالية ، مستعمرات بيضاء وزرقاء على وضع لوحات. مستعمرات بيضاء هي إيجابية للمنتج PCR الإدراج والمستعمرات الزرقاء هي سلبية على المنتج الإدراج PCR.

6. تحليل التسلسل

تسلسل ردود الفعل

  1. يتكون مزيج استخدام هذه الكواشف : 2،5 ميكروليتر DNA ، 1 ميكرولتر التمهيدي (5pmol / ميكرولتر) 1،1 BigDye ميكرولتر (Biosystem التطبيقية ، فوستر سيتي ، كاليفورنيا ، الولايات المتحدة).
  2. شروط cycler الحرارية : 96 درجة مئوية لمدة 1 دقيقة و 25 مرات عن 96 درجة مئوية لمدة 10 ثانية و 55 درجة مئوية لمدة 15 ثانية و 60 درجة مئوية لمدة 4 دقائق.

العمود تنقية

  1. لكل رد فعل ، وإعداد عمود واحد MicroSpin (Qiagen ، ميلانو ، ايطاليا).
  2. عكس الأعمدة ودوامة لخلط الراتنج.
  3. المفاجئة قبالة الجزء السفلي من العمود ، وتخفيف الغطاء ربع بدوره ، والعمود مكان في أنبوب microcentrifuge.
  4. الطرد المركزي 3200 دورة في الدقيقة لمدة 1 دقيقة.
  5. نقل عمود إلى أنبوب microcentrifuge نظيفة.
  6. الماصة بعناية تسلسل تفاعل PCR كامل في مركز العمود.
  7. الطرد المركزي 3200 دورة في الدقيقة لمدة 1 دقيقة.
  8. وسوف يطهر eluite الحمض النووي في أنبوب (20 ميكرولتر من الماء عالى النقاء).

تحليل التسلسل

  1. تحميل العينة المنقى (20 ميكرولتر) في 96 - multiwell وحة.
  2. تحميل لوحة في التسلسل. المعقبات الحمض النووي الآلي chromatogram إنشاء أربعة ألوان تظهر نتائج تشغيل التسلسل.
  3. مدخلات تسلسل النوكليوتيدات كاستعلام ضد قواعد البيانات تسلسل العامة. يتم البحث في قواعد البيانات NCBI والخوادم ، مع محاذاة الأساسية المحلية أداة البحث (الانفجار).
  4. تنظر البكتيريا فقط مع homologies 98-100 ٪.

7. ممثل النتائج

الشكل 1
الشكل 1. الجدول الزمني لهذا الإجراء.

الشكل 2
الشكل 2. المخططات تدفق الإجراء تحديد الجرثومي بأكمله.

الشكل 3
الشكل 3. 2 ٪ agarose هلام عرض مجموعة واسعة من المنتجات الجينات 16S الرنا الريباسي PCR. حارة 1 يحتوي على الحمض النووي سلما 100bp ، 2 لين يحتوي على عنصر التحكم PCR إيجابية ، لين 3 يبين سيطرة PCR سلبية. حارة 4 يبين عينات من المرضى المصابين بالفيروس ، ويحتوي على مياه حارة 5. حارة 6 شows عينات من شخص سليم وردة فعل سلبية PCR ؛ حارة 7 يحتوي على الماء. فقط المرضى بفيروس نقص المناعة البشرية يعرض PCR التضخيم إيجابية. الماء عالى النقاء تستخدم كعنصر تحكم سلبية خلال خطوة الاستخراج ، ويشير إلى أن عدم وجود تلوث وقعت.

الشكل 4
الشكل 4. agarose هلام 0.7 ٪ تبين البلازميد مع استخراج miniprep الداخلي. حارة 1 يحتوي على الحمض النووي سلما Kilobase 1 ، 2 لين يحتوي على مستعمرة السيطرة الزرقاء ، من 3 إلى 12 مسارب تحتوي على مستعمرات بيضاء. والبلازميد من مستعمرة زرقاء لا يحتوي على إدراج منتج PCR. جميع المستعمرات 10 بيضاء تحتوي على البلازميد مع إدراج الصحيح.

الشكل 5
الشكل 5. يبين مثال للتحليل الجرثومي في تسلسل البلازما من الفرد بفيروس نقص المناعة البشرية واحدة. نتائجنا تظهر ان إزفاء الميكروبية في مرض فيروس نقص المناعة البشرية يتضمن النباتات polimicrobic ، الذي لا ينظر في يحملونه الموضوعات ، مما يشير إلى فشل كبير من الحصانة في السيطرة على بكتيريا الأمعاء إزفاء.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الإعلان عن أي تضارب في المصالح.

Acknowledgements

ونحن ممتنون للمساعدة Scimone جياني ممتازة مع صناعة الفيديو.

Materials

Name Company Catalog Number Comments
Easty-DNA Kit Invitrogen K 180001
Chloroform Sigma-Aldrich C2432
Ethanol Sigma-Aldrich E7203
UltraPure Waer Invitrogen 10977049
Lysozyme Fluka 62970 10 μg/mL in Distillated Water
AmpliTaq Gold Applied Biosystems 26478701
Microcon 100 EMD Millipore 42413
PCR primers Invitrogen
Agarose Eppendorf C1343
DNA ladder Invitrogen 15628019
Purelink PCR micro kit Invitrogen K310050
LB Agar, powder Invitrogen 22700025
Bactoagar Invitrogen
Ampicillin Invitrogen 11593027 10 mg/mL in Distillated Water
X-gal Invitrogen 15520034 40mg/mL in DMF
IPTG Invitrogen 15529019 100mM in Distillated water
Topo TA cloning kit Invitrogen K450002
Purelink Quick Plasmid Miniprep kit Invitrogen K210010
Big dye Applied Biosystems 4337455
DyeEx 2.0 spin kit Qiagen 63204

DOWNLOAD MATERIALS LIST

References

  1. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  2. Macpherson, A. J., Harris, N. L. Interactions between commensal intestinal bacteria and the immune system. Nat Rev Immunol. 4, 478-485 (2004).
  3. Kanauchi, O., Mitsuyama, K., Araki, Y., Andoh, A. Modification of intestinal flora in the treatment of inflammatory bowel disease. Curr Pharm Des. 9, 333-346 (2003).
  4. Brenchley, J. M. Microbial translocation is a cause of systemic immune activation in chronic HIV infection. Nat Med. 12, 1365-1371 (2006).
  5. Brenchley, J. M., Price, D. A., Douek, D. C. HIV disease: fallout from a mucosal catastrophe. Nat Immunol. 7, 235-239 (2006).
  6. Jiang, W. Plasma levels of bacterial DNA correlate with immune activation and the magnitude of immune restoration in persons with antiretroviral-treated HIV infection. J Infect Dis. 199, 1177-1185 (2009).
  7. Marchetti, G. Microbial translocation is associated with sustained failure in CD4+ T-cell reconstitution in HIV-infected patients on long-term highly active antiretroviral therapy. AIDS. 22, 2035-2038 (2008).
  8. Marchetti, G. Role of Microbial Translocation and Immune Hyperactivation in Disease Progression of HIV+ Patients with Preserved CD4 Count in the Absence of ART. The 17th Conference on Reteroviruses and Opportunistic Infections (CROI), San Francisco, CA, USA, (2010).
  9. Greisen, K., Loeffelholz, M., Purohit, A., Leong, D. PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid. J Clin Microbiol. 32, 335-351 (1994).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics