תא האנדותל שיתוף תרבות מתווכת ההבשלה של עובריים אנושיים לתאי גזע לאינסולין בתאי לבלב הפקת בגישה הבחנה בימוי

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

המחקר הנוכחי מתאר גישה בידול מכוון של גרימת הבחנה הלבלב של בתאי גזע עובריים אנושיים. חשיבות רבה היא מציאת תא האנדותל שיתוף תרבות מתווכת ההבשלה של תא גזע עובריים אנושיים נגזר אבות לתאי הלבלב אינסולין המבטאים.

Cite this Article

Copy Citation | Download Citations

Jaramillo, M., Banerjee, I. Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach. J. Vis. Exp. (61), e3759, doi:10.3791/3759 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

לתאי גזע עובריים (ESC) יש שני מאפיינים עיקריים: הם יכולים להיות מופצים ללא הגבלת זמן במבחנה במצב מובחן והם pluripotent, ובכך שיש פוטנציאל להתמיין שושלות רבות. מאפיינים אלה להפוך ESCs אטרקטיבי ביותר עבור טיפול בתאי מבוסס, במהלך טיפולים משובי 1. עם זאת עבור מלוא הפוטנציאל שלו להתממש התאים צריך להיות מובחן לתוך פנוטיפים בוגרים ופונקציונלי, שהוא משימה מרתיעה. גישה מבטיחה בגרימת התמיינות הוא לעקוב מקרוב לחקות את דרך organogenesis בסביבה חוץ גופית ב. התפתחות הלבלב ידוע להתרחש בשלבים מסוימים 2, החל האנדודרם, אשר יכול להתפתח לאיברים שונים, לרבות הכבד והלבלב. אינדוקציה האנדודרם ניתן להשיג על ידי אפנון של מסלול קטרי באמצעות תוספת של Activin 3 בשילוב עם גורמי גידול מספר 4-7 במבחנה על ידי תוספת של cyclopamine 8. התבגרות הלבלב מתווך על ידי אירועים מקבילים מספר כולל עיכוב של חריץ איתות, מצטבר של אבות הלבלב לתוך 3-dimentional אשכולות: אינדוקציה של כלי הדם, עד כמה שם. ללא ספק המצליחה ביותר הבשלה חוץ גופית של חברתיות ותרבותיות ובתאים הנגזרות הלבלב הושגו באמצעות עיכוב ברמה הגבוהה מאותתת על ידי תוספת DAPT 9. אמנם מוצלח, הדבר גורם התשואה הנמוכה של הפנוטיפ בוגרת עם פונקציונליות מופחתת. אזור למד פחות היא ההשפעה של תא האנדותל איתות ההתבגרות הלבלב, אשר יותר ויותר מוערך כגורם תורם חשוב ההתבגרות in-vivo הלבלב איון 10,11.

המחקר הנוכחי בוחן אפקט כזה של endothelתא ial איתות ההבשלה של האדם חברתיות ותרבותיות ובתאים הנגזרות הלבלב לייצר אינסולין תוך איון דמויי תאים. אנו מדווחים על פרוטוקול רב שלבית בידול מכוון שבו ESCs האדם הנגרמת על ידי 1 Activin יחד עם עיכוב של מסלול PI3K כלפי האנדודרם. מפרט הלבלב של תאים האנדודרם מושגת על ידי עיכוב של סוניק הקיפוד איתות ידי Cyclopamine יחד עם אינדוקציה retinoid על ידי תוספת של החומצה הרטינואית. השלב האחרון של ההתבגרות הוא המושרה על ידי איתות תא האנדותל מושגת על ידי תצורת שיתוף תרבות. בעוד בתאי האנדותל כמה נבדקו בתרבות משותפת, כאן אנו מציגים הנתונים שלנו בלב החולדה תאים אנדותל כלי הדם (RHMVEC), בעיקר על מנת להקל על ניתוח.

Protocol

1. תא תחזוקה

  1. HESC H1 (WiCell) נשמרו על בארות hESC מוסמכים מצופה matrigel mTeSR1 עם התקשורת, עם התקשורת לשנות כל יום. וולס היו מכוסות על ידי הפתרון matrigel לדלל, שהוכן על ידי הוספת 300 μl של matrigel hESC ב 25 מ"ל של DMEM: F12. 1 מ"ל של פתרון זה matrigel נוספה גם כל צלחת גם 6, או 400 μl להוסיף גם כל צלחת 12 באר מותר המעיל 1 שעה בטמפרטורת החדר. התאים היו passaged מכנית על ידי גירוד מושבות כשהגיעו בין 1 ל 1.5mm בקוטר ביחס פיצול של 1:04.
  2. RHMVEC (VEC טכנולוגיות) נשמר ב-MCDB 131 התקשורת עם התקשורת לשנות כל שני וחמישי. תאים חולקו על ידי trypsinization פעם מפגש 80% הושג ביחס פיצול של 1:03. לתאי אנדותל בין קטעים 3 ו -7 שימשו במחקר זה.

2. הכנת מאגר פתרונות

  1. Activin היה מחדש ב 50 מיקרוגרם / מ"ל ​​P סטריליתBS המכיל 0.1% אלבומין בסרום שור. הפתרון היה aliquoted ומאוחסנים ב -20 ° C.
  2. EGF היה מחדש על 500 מיקרוגרם / מ"ל ​​חומצה אצטית 10 סטרילית מ"מ. הפתרון היה aliquoted ומאוחסנים ב -20 ° C.
  3. אינסולין היה מחדש ב 10 מ"ג / מ"ל על ידי הוספת acidified H 2 O (pH ≤ 2), שהוכן על ידי תוספת של חומצה אצטית קרחונית 0.1 מ"ל ל 10 מ"ל מים.
  4. DAPT היה מחדש ב DMSO ב 18 מ"ג / מ"ל. זה היה עוד יותר מדולל לריכוז 300 מיקרומטר DMEM: F12, aliquoted ומאוחסנים ב -20 ° C.
  5. KAAD-Cyclopamine היה מחדש ב DMSO על 5mg/ml. זה היה עוד יותר מדולל לריכוז 2 מיקרומטר DMEM: F12, aliquoted ומאוחסנים ב -20 ° C.
  6. All-טרנס החומצה הרטינואית היה מחדש ב 2.7 מ"ג / מ"ל ​​אתנול 95%. זה היה עוד יותר מדולל לריכוז 2 מ"מ ב DMEM: F12, aliquoted ומאוחסנים ב -80 ° C.

3. האנדודרם מכריע (DE) ו אבי הלבלב (PP) אינדוקציה

  1. לאחר שמושבות חברתיות ותרבותיות שהושג בין 1 ל 1.5mm קוטר, אינדוקציה DE נערך על ידי הוספת DMEM: F12 השלימו עם B27, BSA 0.2%, 100 ng / mL Activin ו 1 מיקרומטר Wortmannin במשך 4 ימים (יום 0-Day 4) עם התקשורת לשנות בכל יום.
  2. לאחר הגיוס DE היה שלם, אבי אינדוקציה הלבלב הושרה על ידי שינוי התקשורת DMEM: F12 השלימו עם B27, BSA 0.2% ו-KAAD Cyclopamine בריכוז 0.2 מיקרומטר ל -24 שעות (יום 4 יום 5).
  3. לאחר 24 שעות מדיה שונה DMEM: F12 השלימו עם B27, 0.2% BSA, KAAD-Cyclopamine בריכוז 0.2 מיקרומטר ו-All-טרנס החומצה הרטינואית בריכוז 2 מיקרומטר במשך 3 ימים עם התקשורת לשנות כל יום (יום יום 5-8) .

4. הלבלב ההבשלה

  1. לאחר הגיוס PP, הקבוצות שונו למדיה התבגרות מורכב DMEM: F12 השלימו עם B27, 0.2% BSA, Nicotinamide 10 מ"מ, 25 מיקרוגרם / מ"ל אינסולין, 30 ננומטר מיקרוגרם Na SEO 3 ו -50 / 2 מ"ל transferrin עבור 2 דays עם התקשורת לשנות כל יום (יום 8 הימים 10).
  2. אחרי 2 ימים בתקשורת ההתבגרות, שלב ההבשלה הסופית נעשית במקביל באמצעות תנאים שונים להשוואה. בידול הושרה בתנאים הבאים: (i) באמצעות חריץ מעכב DAPT (ii) באמצעות שיתוף תרבות מדיה בלבד, ללא בתאי האנדותל כמו מלאה (iii) באמצעות יצירת קשר ושיתוף עם התרבות תאים RHMVEC. תאים נשמרו בתקשורת DAPT או שיתוף תרבות במשך שבוע (יום 10 הימים 17) עם התקשורת לשנות כל יום.
    1. התקשורת DAPT הוכן על ידי השלמת אמצעי התקשורת ההתבגרות עם DAPT 30 מיקרומטר. תאים בקבוצות אלה נחשפו לראשונה להשלים MCDB131 למשך 24 שעות ולאחר מכן נחשף למדיה DAPT במשך 6 ימים (יום 11 יום 17).
    2. שיתוף תרבות התקשורת הוכן על ידי השלמת MCDB-131 לתקשורת עם B27, 0.2% BSA, Nicotinamide 10 מ"מ, 10 ng / ml EGF, 1 מיקרוגרם / הידרוקורטיזון מ"ל, 10 מ"ג EndoGro, 90 מיקרוגרם / מ"ל ​​הפרין. למצב בקרת מדיה התאים המבדילים נחשפועד בינוני 131 MCDB המלא ל 24 שעות (יום 10 יום 11) לאחר מכן בתקשורת שונה שיתוף תרבות התקשורת במשך 6 ימים (יום 11 יום 17) (אין לתאי אנדותל).
    3. למצב קשר שיתוף תרבות, 1000000 RHMVEC נוספה התאים המבדילים ב שלמים MCDB-131 המדיה (VEC טכנולוגיות) למשך 24 שעות (יום 10 יום 11) כדי לאפשר המצורף. לאחר 24 שעות מדיה שונה שיתוף תרבות התקשורת במשך 6 ימים (יום 11 הימים 17) עם התקשורת לשנות כל יום.

5. qRT-PCR ניתוח

  1. בסוף כל שלב התמיינות (האנדודרם, אבי הלבלב, איון בוגרת) היו lysed ו-RNA הופק באמצעות NucleoSpin RNA ערכת החילוץ השנייה על פי הוראות היצרן.
  2. RNA איכות נותח על ידי בדיקת ספיגת RNA ב 260 ננומטר ו -280 ננומטר, ואחריו כימות RNA באמצעות SmartSpec פלוס ספקטרופוטומטר.
  3. שעתוק לאחור בוצעה באמצעות ImProm K II שעתוק לאחורזאת על פי הוראות היצרן. כל התגובות בוצעו עם ng 100 של RNA.
  4. qRT-PCR בוצעה באמצעות QPCR Mx3005P המערכת (Agilent) ומבריק II SYBR ירוק תערובת QPCR מאסטר פי הוראות היצרן. פריימרים המשמשים מפורטים על השולחן 1. צעד האתחול בוצע על 50 מעלות צלזיוס במשך 2 דקות ואחריה 95 מעלות צלזיוס במשך 10 דקות. 50 מחזורים הגברה בוצעו באופן הבא: 95 מעלות צלזיוס למשך 30 שניות, 54 ° C למשך 30 שניות ו 72 מעלות צלזיוס למשך דקה 1.
  5. שינוי פולד ביטוי mRNA היעד על תאים שלא עברו התמיינות חושב מערכי ה-CT בעזרת הנוסחאות הבאות:
    ΔCT (דה מרקר i) = CT (דה מרקר אני) - CT (GAPDH)
    Δ ΔCT (סמן i) = ΔCT (דה מרקר אני) (לדוגמה) - ΔCT (דה מרקר אני) (תאים שלא עברו התמיינות)
    הביטוי יחסית (דה מרקר i) = 2-ΔΔCT(סמן ט)

6. Immunocytochemistry

  1. בסוף כל שלב התמיינות (האנדודרם, אבי הלבלב, איון בוגרת) התאים תוקנו בפורמלין 4% למשך 15 דקות בטמפרטורת החדר.
  2. תאים קבוע היו permeabilized באמצעות 0.25% טריטון X-100 (TX) במשך 15 דקות.
  3. הלא ספציפית מכתים נחסמה על ידי הדגירה בסרום חמור של 10% .05% TX במשך 30 דקות.
  4. הדגירה הנוגדן העיקרי בוצע במשך הלילה על 4 מעלות צלזיוס חסימת חיץ בדילול נוגדנים המומלצת (ראה טבלה 1).
  5. תאים נשטפו עם 0.05% טקסס שלוש פעמים במשך 5 דקות.
  6. הדגירה נוגדנים משני בוצעה שעה אחת בטמפרטורת החדר בחושך עם נוגדנים מתאימים בדילול בחסימת המאגר.
  7. תאים נשטפו עם 0.05% טקסס שלוש פעמים במשך 5 דקות.
  8. מכתים גרעינית נערך על ידי הדגירה Hoescht עם כתם על דילול 1:1000 ב PBSבמשך 5 דקות ואחריו 3 שוטף עם PBS.
  9. תאים קבוע ומוכתמת היו צילמו באמצעות מיקרוסקופ אולימפוס IX81 הפוך ותוכנה Metamorph הדמיה.

7. נציג תוצאות

תוספת של Activin ו Wortmannin כדי hESC מובחן במשך 4 ימים גורם האנדודרם סופי כמו אושר על ידי ניתוח qRT-PCR עבור סמנים דה Sox17, CXCR4 ו Foxa2 ו immunostaining עבור Sox17 כפי שמודגם באיור 2. התמיינות לתאי אבות הלבלב לאחר תוספת של חומצה cyclopamine ו retinoic אושרה על ידי qRT-PCR של אב סמנים הלבלב ו Immunostaining עבור Pdx1 כפי שמודגם באיור 3.

בשלב הסופי של בידול, פנה שיתוף תרבות עם תאים RHMVEC המושרה מאוד upregulation הביטוי אינסולין hESC את התאים שמקורם בלבלב אב. היעילות של בידול שיתוף תרבות בתיווך נותח על ידי שיתוףmparing עם מצב שליטה באמצעות DAPT. DAPT שימש פקד חיובי שכן הוא נמצא כעת באחת השיטות בשימוש נרחב ביותר להשגת ההתבגרות הלבלב. מאז שיתוף תרבות בוצעה מדיה שונה בתוספת גורמים תומכים בתאי אנדותל, שליטה נוספת בוצעה עם התקשורת על העדר בתאי האנדותל כדי לאמת את ההשפעה של התקשורת על בידול. פרטים של ניתוח זה מוצגים באיור 4.

באיור 1.
באיור 1. רב שלבית פרוטוקול התמיינות לתאים hESC אינסולין המבטאים.

איור 2.
איור 2. אינדוקציה האנדודרם מכריע של בתאי גזע עובריים אנושיים. א) qRT-PCR ניתוח של סמנים נציג דה hESC תאים שנחשפו Activin ו Wortmannin למשך 4 ימים. תוצאות ar דואר מנורמל ביחס hESC מובחן. ב) Sox17 מכתים (ירוק) ו DAPI (כחול) הצג ביטוי הגרעין של Sox17. סרגל קנה מידה: 50 מיקרומטר.

איור 3.
3. איור הלבלב אבי אינדוקציה של תא גזע עוברי נגזר תאים האנדודרם. א) qRT-PCR ניתוח של סמנים מוקדמים הלבלב שמקורם בתאי hESC האנדודרם שנחשפו חומצה cyclopamine ו retinoic במשך 4 ימים לאחר הגיוס DE. תוצאות מנורמל ביחס hESC מובחן. ב) Pdx1 מכתים (סגול) ו DAPI (כחול) מראים ביטוי של Pdx1 גרעינית. סרגל קנה מידה: 50 מיקרומטר.

">

באיור 4.
איור 4. התבגרות בשלב הלבלב) qRT-PCR ניתוח של הורמוני הלבלב ב hESC לאחר ההבשלה הלבלב באמצעות DAPT, פנה לתקשורת ושיתוף תרבות או תרבות משותפת (שליטה). תוצאות מנורמל ביחס hESC מובחן. עמ 'ערכים מתקבל על ידי התלמיד מבחן t. ב) משותף עם התרבות דיל-AC-LDL RHMVEC שכותרתו (האדום) הצג באזורים בהם ECS לצרף צלחת אם יש חללים ריקים (למעלה), RHMVEC השני ניתן למצוא קשר ישיר עם ESC הבחנה (למטה). ג) C-peptide (ירוק) מכתים עבור תאים המבדילות באמצעות שיתוף תרבות השיטה. סרגל קנה מידה: 12.5 מיקרומטר (למעלה) ו -50 מיקרומטר (למטה) D) Immunostaining של RHMVEC מדגים שום ביטוי אינסולין RHMVEC.

סמן Primer1 (5 'ל 3') </ Td> Primer2 (5 'ל 3') Ref
SOX17 CTCTGCCTCCTCCACGAA CAGAATCCAGACCTGCACAA 12
CXCR4 CACCGCATCTGGAGAACCA GCCCATTTCCTCGGTGTAGTT 4
FOXA2 GGAGCGGTGAAGATGGAA TACGTGTTCATGCCGTTCAT 12
PDX1 AAGTCTACCAAAGCTCACGCG GTAGGCGCCGCCTGC 4
PTF1 CATAGAGAACGAAACCACCCTTTGAG GCACGGAGTTTCCTGGACAGAGTTC 12
HLXB9 CACCGCGGGCATGATC ACTTCCCCAGGAGGTTCGA 4
HNF6 TGTGGAAGTGGCTGCAGGA TGTGAAGACCAACCTGGGCT 5
PAX6 CGAATTCTGCAGGTGTCCAA ACAGACCCCCTCGGACAGTAAT 5
NKX6.1 AGACCCACTTTTTCCGGACA CCAACGAATAGGCCAAACGA 5
ISL1 GATCTATGTCACCTCGCAAGG TACAACCACCATTTCACTG 12
גלוקגון AGGCAGACCCACTCAGTGA AACAATGGCGACCTCTTCTG 4
אינסולין AAGAGGCCATCAAGCAGATCA CAGGAGGCGCATCCACA 12

Primers לוח 1. המשמש תגובות QPCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

במהלך התפתחות הלבלב, תאים בלבלב המבדילים נמצאים בסמיכות עם לתאי אנדותל של אבי העורקים, יתר על כן, איים הלבלב הם בצפיפות vascularized לקדם חילופי מהירה של רמת הסוכר בדם והורמונים איון. לאור עובדות אלה, אין זה מפתיע כי תאי אנדותל למלא תפקיד חשוב בתהליך של organogenesis הלבלב. למרות החשיבות של בתאי האנדותל במהלך פיתוח לבלב היא יותר ויותר להיות מוערך, תפקידה של התמיינות של תאים עובריים במבחנה נחקר פחות. בדו"ח הקודמת שלנו הקמנו את התפקיד החיובי של בתאי האנדותל על התבגרות לבלב של עכבר לתאי גזע עובריים 13. במחקר הנוכחי אנו חוקרים את השפעת איתות תא האנדותל על הבחנה בתאי גזע עובריים אנושיים.

לתאי אנדותל מרובים נעשה שימוש בפרוטוקול זה, כל אלה הביאו althou דומה ההשפעה הכוללתGH, ויש שוני מבחינת היעילות של בידול. בדו"ח הנוכחי אנו מציגים את ההשפעה של שיתוף culturing הנגזרות hESC הלבלב ובתאים עם לב חולדה כלי הדם לתאי האנדותל (RHMVEC). לתאי אנדותל ניתן דמיינו בנוחות על ידי צביעה AC-LDL, שהוא ספציפי רק לתאי אנדותל. שיתוף התרבות של ESCs המבדילים עם מראש מוכתמים לתאי אנדותל הראה כי בעוד רוב לתאי אנדותל היו קיימא בתרבות למשך זמן ארוך, RHMEV נעלמים בהדרגה לאחר 4 ימים כבר לא יכול להתגלות לאחר 6 ימים של התבגרות. העדר RHMVEC מפשט ניתוח על ידי ביטול הצורך מיון, ולכן נבחר ואופטימיזציה של פרוטוקול שיתוף תרבות.

בעוד המחקר הנוכחי מצביע בבירור על השפעה חיובית של בתאי האנדותל של התבגרות הלבלב התרמה, המנגנון המדויק של גיוס כזה עדיין לא ידוע והוא נחקר כעת במעבדה שלנו. פה* פרנסות מנגנונים אפשריים יכול להיות (אני) את ההשפעה של תאים המופרשים מולקולות (ב) תא האנדותל בתיווך עיכוב בדרגה איתות (iii) את התפקיד של תאי מטריקס מופרש על ידי תאים אנדותל. בעוד הקטגוריה הראשונה אינה דורשת תאים תאים קשר, קשר כזה הוא חובה עבור הקטגוריה השנייה והשלישית. לכן ביצענו כמה ניתוח ראשוני באמצעות שונות משותפת תרבות תצורות: (א) שותף לתרבות קשר (ii) transwell שיתוף תרבות (iii) מותנה בתרבות התקשורת. היה נראה כי קשר שיתוף התרבות הביא בידול מקסימלי, נשפט על ידי ביטוי אינסולין, ואחריו transwell שיתוף התרבות, תוך מיזוג התרבות התקשורת הביאה השפעה מינימלית על הביטוי אינסולין (מידע לא מוצג). ניתוחים אלו מצביעים על כך תוך תאים תאים קשר חשוב, אולי יש כמה מולקולות קצרות המופרשים חיים אשר חשובים גם כן.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

אין לנו מה למסור.

Acknowledgements

אנו מכירים תמיכה פרס חדש ממציא NIH DP2 116520 ו ORAU ראלף powe שיפור Junior פרס הפקולטה.

Materials

Name Company Catalog Number Comments
mTeSR1 (with supplement) Stem Cell Technologies 5850
hESC qualified matrigel BD Biosciences 354277
DMEM:F12 Invitrogen 11330-032
MCDB-131 Invitrogen 10372019
MCDB-131 (Complete) VEC Technologies MCDB-131
B27 Supplement Invitrogen 17504044
Activin A R&D Systems 338-AC 100ng/ml
Wortmannin Invitrogen W3144 1μM
KAAD-Cyclopamie Sigma-Aldrich C4116 0.2μM
All-Trans Retinoic Acid Sigma-Aldrich R2625 2μM
DAPT Sigma-Aldrich D5942 30μM
Nicotinamide Sigma-Aldrich N0636 10 mM
Sodium Selenite Sigma-Aldrich S5261 30 nM
Insulin Sigma-Aldrich I1882 25 μg/ml
Transferrin Sigma-Aldrich T8158 50 μg/ml
EGF R&D Systems 236-EG 10ng/ml
EndoGro VEC Technologies ENDOGRO 10mg
Heparin Sigma-Aldrich H3149 90μg/ml
Hydrocortisone Sigma-Aldrich H0888 1μg/ml
NucleoSpin RNA II Macherey-Nagel 740955
ImProm II reverse transcription System Promega Corp. A3800
Brilliant II SYBR Green QPCR master mix Stratagene, Agilent Technologies 600548
Sox17 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-17355 1/500
PDX1 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-14662 1/500
C-Peptide Rabbit polyclonal Cell Signaling Technology 4593 1/500
Alexa Fluor 488 donkey anti-rabbit IgG Invitrogen A-21206 1/1000
Alexa Fluor 647 donkey anti-goat IgG Invitrogen A-21447 1/1000
Table 2. Reagents and Kits

DOWNLOAD MATERIALS LIST

References

  1. De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain á la médecine régénératrice de demain. Gynécologie Obstétrique & Fertilité. 37, 620-626 (2009).
  2. Murtaugh, L. C., Melton, D. A. Genes, Signals, and Lineages in Pancreas Development. Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).
  3. Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. Development of definitive endoderm from embryonic stem cells in culture. Development. 131, 1651-1662 (2004).
  4. D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat. Biotech. 24, 1392-1401 (2006).
  5. Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells. Cell Res. 19, 429-438 (2009).
  6. Basma, H., Soto-Gutiérrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes. Gastroenterology. 136, 990-999 (2009).
  7. Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -P., Chipperfield, H., Tan, E. -K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage. Stem Cells and Development. 16, 561-578 (2007).
  8. Kim, S. K., Melton, D. A. Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor. Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).
  9. Docherty, K. Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus. Current Opinion in Pharmacology. 1, 641-649 (2001).
  10. Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., Fässler, R., Gu, G., Gerber, H. -P., Ferrara, N., Melton, D. A. The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]> Cell Proliferation. Developmental Cell. 10, 397-405 (2006).
  11. Yoshitomi, H., Zaret, K. S. Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a. Development. 131, 807-817 (2004).
  12. Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. Marked differences in differentiation propensity among human embryonic stem cell lines. Nat. Biotech. 26, 313-315 (2008).
  13. Banerjee, I., Sharma, N., Yarmush, M. Impact of co-culture on pancreatic differentiation of embryonic stem cells. J. Tissue Eng. Regen. Med. 5, 313-323 (2010).

Comments

2 Comments

  1. good

    Reply
    Posted by: Zhongchun S.
    July 20, 2012 - 2:15 AM
  2. Dear Maria Jaramillo

    I am a student of the licencientura in biotechnology in the Universidad Argentina de la Empresa.
    I am currently studying the cell cultures, researching on the internet I find interesting the abstract, I would like to know if it is possible for me to send the paper by email please.
    thanks and greetings


    Ana Clara López Novo
    Matter cell cultures
    Department of biotechnology and food technology
    Faculty of engineering and Sciences
    Universidad Argentina de la Empresa
    Lima 717 (C1073AAO)
    Ciudad Autónoma de Buenos Aires
    Email: anaclaralopeznovo@gmail.com

    Reply
    Posted by: Ana L.
    May 6, 2013 - 10:24 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics