인간 배아의 내피 세포 공동 배양 Mediates의 성숙은 감독 차별화 접근법에서 췌장 인슐린 생산 세포로 세포를 줄기

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

현재의 연구는 인간 배아 줄기 세포를 췌장 분화를 유도으로 이동 차별화 접근 방식에 대해 설명합니다. 큰 의미 중 인슐린을 표현하는 세포로 췌장 progenitors을 얻은​​ 인간 배아 줄기 세포를 찾는 것이 내피 세포 공동 배양 mediates의 성숙입니다.

Cite this Article

Copy Citation | Download Citations

Jaramillo, M., Banerjee, I. Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach. J. Vis. Exp. (61), e3759, doi:10.3791/3759 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

배아 줄기 세포 (ESC)는 두 가지 주요 특징이있다 : 그들은 무기한 따라서 여러 lineages으로 차별화하는 잠재력을 가지고, undifferentiated 상태로 체외에서 증식들이 pluripotent가 될 수 있습니다. 이러한 속성은 세포 기반 치료 및 재생 치료에 응용 1 ESCs 매우 매력적합니다. 그러나 실현하기위한 잠재력을 위해 전지 발굴 작업입니다 성숙하고 기능적인 phenotypes,로 구분해야합니다. 세포 분화를 유도에서 유망한 접근 방법은 밀접하게 관련 체외 환경에서 organogenesis의 경로를 모방하는 것입니다. 췌장 개발은 간, 췌장 등 여러 장기,로 개발할 수 endoderm,로 시작하는 구체적인 단계 2에서 발생하는 것으로 알려져 있습니다. Endoderm 유도는 여러 가지 성장 요인 4-7과 함께 3 Activin의 추가를 통해 결절 통로의 변조에 의해 달성될 수 8 이외에 의해 체외로 얻을 수있는 소닉 고슴도치 억제의 억제에 의해 췌장 약속을 받고있다. 췌장 성숙은 노치 신호 전달의 억제 등 여러 병렬 이벤트에 의해 매개되며 췌장 progenitors의 집합 3-dimentional 클러스터로, vascularization의 유도, 몇 이름을 지정합니다. 지금까지 가장 성공적인 ESC 파생 췌장 전구 세포의 체외의 성숙에 의해 DAPT의 보완 9 신호를 노치의 억제를 통해 달성되었습니다. 성공 있지만, 기능 제한이있는 성숙한 표현형의 낮은 수확량이 발생합니다. 덜 연구 영역은 점점 더 인 - 생체내 췌장 섬의 성숙 10,11에 중요한 기여 요인으로 평가되고 췌장 성숙에 신호 내피 세포의 효과입니다.

현재의 연구는 endothel 같은 효과를 탐구ial 세포는 섬 같은 세포를 생산하는 인슐린으로 인간의 Esc를 파생 췌장 전구 세포의 성숙에 신호. 우리가 인간 ESCs 처음 PI3K 경로의 억제와 함께를 Activin하여 endoderm 향해 유도되는 다단 감독 차별 프로토콜을보고합니다. endoderm 세포의 췌장 사양 Retinoic 산성의 추가에 의해 retinoid 유도와 함께 Cyclopamine에 의한 음파 고슴도치 신호의 억제에 의해 이루어진다. 성숙의 마지막 단계는 공동 문화 구성에 의해 달성될 내피 세포 신호에 의해 유도된다. 여러 내피 세포가 공동 문화에 테스트한 동안 본 우리는 주로 분석의 용이성을 위해, 쥐 심장 microvascular 내피 세포 (RHMVEC)와 함께 우리의 데이터를 제시.

Protocol

1. 세포 유지 보수

  1. 미디어가 매일 변화와 H1의 hESC (WiCell)는 mTeSR1 미디어 hESC 자격 matrigel 코팅 우물을 유지했다. F12을 : 웰스는 DMEM의 25 ML에 hESC의 matrigel 300 μl를 추가하여 준비 묽은 matrigel 솔루션에 의해 덮여 있었다. 이 matrigel 솔루션 1 ML은 여섯 잘 접시의 각 음에 추가하거나, 400 μl는 12 잘 접시의 각도에 추가하고 실온에서 1 시간 코트에 허용되었다. 전지는 기계들이 1 일, 직경 1.5mm에 도달 한 번 식민지를 위해서 힘든하여 1시 4분의 분할 비율에 passaged되었다.
  2. RHMVEC은 (VEC 기술) 미디어가 매일 변화 MCDB-131 미디어에서 유지되었다. 80 % 합류가 1시 3분의 분할 비율에 도달한 후에는 세포 trypsinization에 의해 분할되었다. 단락 3과 7 사이의 내피 세포가이 연구에 사용되었다.

2. 증권 솔루션의 작성

  1. Activin은이 무균 P에서 50 μg / ML로 재구성되었다BS는 소 혈청 알부민은 0.1 %를 포함. 솔루션은 -20 ° C.에 aliquoted 및 보관되었다
  2. EGF는 멸균 10 밀리미터 초산 500 μg / ML로 재구성되었다. 솔루션은 -20 ° C.에 aliquoted 및 보관되었다
  3. 인슐린은 물 10 ML의 0.1 ML 빙초산가 추가로 준비 acidified H 2 O (산도 ≤ 2), 추가로 10 밀리그램 / ML로 재구성되었다.
  4. DAPT 18 밀리그램 / ML에서 DMSO로 재구성되었다. F12는 aliquoted 및 -20 ° C.에 저장된 : 그것은 더욱 DMEM에 300 μm의 농도로 희석되었다
  5. KAAD-Cyclopamine는 5mg/ml에서 DMSO로 재구성되었다. F12는 aliquoted 및 -20 ° C.에 저장된 : 그것은 더욱 DMEM 2 μm의 농도로 희석되었다
  6. 모든 트랜스 retinoic 산성은 95 % 에탄올에서 2.7 밀리그램 / ML로 재구성되었다. , F12 aliquoted 및 -80 ° C.에 저장된 : 그것은 더욱 DMEM에 2mM 농도로 희석되었다

3. 최종 Endoderm (DE) 및 췌장 시조 (PP) 유도

  1. H 한 번ESC의 식민지는 1, 직경 1.5mm 사이에 도달, DE 유도는 DMEM을 추가하여 수행되었다 : F12은 B27, 0.2 % BSA, 4 일 동안 1 μm의의 Wortmannin (주 0 주 4) 미디어 100 NG / ML Activin로 보충 매일 변경합니다.
  2. DE 유도가 완료가 된 후에, 췌장 전구 유도는 DMEM으로 미디어를 변경하여 의도한 : F12는 24 시간 동안 0.2 μm의 농도 (일 4 일 5)에서 B27, 0.2 % BSA 및 KAAD-Cyclopamine으로 보충.
  3. 24 시간 이내에 미디어는 DMEM으로 변경되었습니다 : F12 같이 보충 B27, 0.2 % BSA, 미디어가 매일 변화가있는 3 일간 0.2 μm의 농도 및 2 μm의 농도에서 모든 트랜스 retinoic 산 (주 5 일 8)에서 KAAD-Cyclopamine .

4. 췌장 성숙

  1. PP 유도 후 모든 그룹은 DMEM으로 구성된 성숙 미디어로 변경되었습니다 F12 2 D를 위해 B27, 0.2 % BSA, 10 밀리미터 니코틴, 25 μg / ML 인슐린, 30 NM 나이 SEO 및 50 μg / ML 트랜스페린로 보충매체와 ays은 (주 8 주 10) 매일 변경합니다.
  2. 성숙 미디어 2 일 후에 최종 성숙 단계는 병렬 비교를 위해 여러 가지 조건을 사용하여 수행됩니다. 은 (i) 제어와 같은 내피 세포없이, 오직 공동의 문화 미디어를 사용하여 그리고 (iii) RHMVEC 세포와 접촉 공동 문화를 사용하여 노치 억제제 DAPT (2)를 사용하여 차별화는 다음 조건 하에서 유도되었다. 전지는 미디어가 매일 변화와 함께 (주 10 주 17) 주일 동안 DAPT 또는 공동의 문화 매체에 유지되었다.
    1. DAPT 미디어는 30 μm의 제품 DAPT으로 성숙 미디어를 보완하여 작성됐다. 이 그룹에있는 세포는 6 일 (주 11 주 17)에 대해 처음 24 시간 동안 MCDB131를 완료하기 위해 노출하고 DAPT 미디어에 노출되었다.
    2. 공동 문화 미디어와 MCDB-131 미디어를 보완하여 준비되었다 B27, 0.2 % BSA, 10 밀리미터 니코틴, 10 NG / ML EGF, 1 μg / ML의 하이드로코티손, 10 밀리그램 EndoGro, 90 μg / ML의 헤파린. 미디어 제어 조건의 경우 차별 세포가 노출되었다미디어 육일 (주 11 주 17) (없음 내피 세포)에 대한 공동의 문화 미디어로 변경되었습니다 그 이후 24 시간 동안 MCDB-131 완전한 매체 (일 10 일 11)에.
    3. 연락처 공동 배양 조건의 경우 백만 RHMVEC은 첨부 파일을 허용하도록 24 시간 동안 완전한 MCDB-131 미디어의 차별화 세포 (VEC 기술) (주 10 주 11)에 추가되었습니다. 24 시간 미디어 매체 6 일 (주 11 주 17)에 대해 공동의 문화 미디어로 변경되었습니다 후 매일 변경합니다.

5. qRT-PCR 분석

  1. 분화의 각 단계 (; 췌장 전구, endoderm 성숙 섬)의 끝에 lysed되었으며 RNA는 제조 업체의 지침에 따라 NucleoSpin RNA II 추출 키트를 사용하여 추출되었습니다.
  2. RNA 품질 SmartSpec 플러스 분광 광도계를 사용하여 RNA의 양을 정함 다음, 260 nm의 및 280 nm의에서 RNA의 흡광도를 선택하여 분석되었다.
  3. 역방향 전사는 ImProm II 리버스 전사 K를 사용하여 수행되었다그것은 제조 업체의 지시에 따라. 모든 반응은 RNA의 100 NG로 수행되었다.
  4. qRT-PCR은 제조 업체의 지시에 따라 Mx3005P QPCR 시스템 (애질런트)와 브릴리언트 II SYBR 녹색 QPCR 마스터 믹스를 사용하여 수행되었다. 사용된 primers는 표 1에 나열됩니다. 초기화 단계 50에서 수행된 10 분 동안 95 ° C이어서 2 분을 ° C에서. 50 증폭주기는 다음과 같이 수행되었다 : 95 ° 30 초 C 54 ° 30 초 1 분 72 ° C에 대한 C #.
  5. undifferentiated 세포 이상의 타겟 mRNA의 표현의 공간 변경 사항은 다음과 같은 수식을 사용하여 중부 표준시 값으로부터 계산되었다 :
    ΔCT (마커 I) = 중부 표준시 (마커 I) - 중부 표준시 (GAPDH)
    Δ ΔCT (마커 I) = ΔCT (마커 I) (샘플) - ΔCT (마커 I) (Undifferentiated 세포)
    상대 표현 (마커 I) = 2-ΔΔCT(마커 I)

6. Immunocytochemistry

  1. 분화의 각 단계 (; 췌장 전구, endoderm 성숙 섬)의 끝에서 전지는 상온에서 15 분 동안 4 % 포름 알데히드에서 수정되었습니다.
  2. 고정 세포는 트리톤 X-100 (TX) 15 분 동안 0.25 %를 사용 permeabilized되었다.
  3. 비 특정 염색법은 30 분 동안 TX 0.05 %에서 10 % 당나귀 혈청에서 부화에 의해 차단되었습니다.
  4. 일차 항체 배양은 4에서 하룻밤을 수행한 권장 항체 희석 (표 1 참조)에서 버퍼를 차단에서 ° C #.
  5. 셀은 5 분 동안 0.05 %, 텍사스 세 번 함께 씻겨 있었다.
  6. 차 항체 보육는 버퍼를 차단에 희석 적절한 항체와 어두운 실내 온도에 하나의 시간 동안 수행되었다.
  7. 셀은 5 분 동안 0.05 %, 텍사스 세 번 함께 씻겨 있었다.
  8. 핵 염색법은 PBS에서 1:1000 희석에 얼룩 Hoescht과 부화에 의해 수행되었다PBS로 3 세차장 뒤에는 15 분.
  9. 고정 및 스테인드 세포 올림푸스 IX81 거꾸로 현미경과 Metamorph 이미징 소프트웨어를 사용하여 몇 군데 있었다.

7. 대표 결과

드 마커 Sox17, Cxcr4 및 Foxa2위한 qRT-PCR 분석에 의해 확인 및 그림 2에 그림과 같이 Sox17 위해 immunostaining로 Activin의 추가는 4 일 동안 undifferentiated hESC에 Wortmannin 확실한 endoderm을 유도합니다. cyclopamine 및 retinoic 산성의 추가 후 췌장 전구 세포로 분화가 췌장 전구 마커와 그림 3 그림과 같이 Pdx1 위해 Immunostaining의 qRT-PCR에 의해 확인되었다.

분화의 마지막 단계에서는 강력히 hESC 파생된 췌장 전구 세포에서 인슐린 표현의 upregulation을 유도 RHMVEC 세포와 공동 문화를 문의하십시오. 공동 문화 매개 차별의 효율성을 공동으로 분석되었다DAPT를 사용하여 컨트롤 상태와 mparing. 그것이 현재 췌장 성숙을 달성하는 데 가장 널리 사용되는 방법 중 하나이기 때문에 DAPT는 긍정적인 제어로 사용되었다. 공동 문화 내피 세포의 지원 요인에 의해 보완 수정된 미디어에서 수행된 이후, 추가적인 컨트롤은 차별화에 대한 미디어의 영향을 확인하는 내피 세포의 부재에서 미디어로 수행되었다. 이 분석의 세부 내용은 그림 4에 표시됩니다.

1 그림.
그림 1. 인슐린 표현 세포로 hESC의 차별 화를위한 다단 프로토콜.

그림 2.
그림 2. 인간 배아 줄기 세포의 확실한 endoderm 유도. 그리고 Wortmannin 4 일동안 Activin에 노출 hESC 세포의 대표 드 마커) qRT-PCR 분석. 결과 AR e는 undifferentiated hESC에 대하여 정규화. B) Sox17 염색법 (녹색) 및 DAPI는 (파란색) Sox17의 핵 표현을 보여줍니다. 스케일 바 : 50 μm의.

그림 3.
endoderm 세포를 파생 배아 줄기 세포의 그림 3. 췌장 전구 유도. DE 유도 후 4 일동안 cyclopamine 및 retinoic 산성에 노출된 hESC 파생된 endoderm 세포를 초기에 췌장 마커) qRT-PCR 분석. 결과 undifferentiated hESC에 대하여 정규화. B) Pdx1 염색법 (보라색) 및 DAPI는 (파란색) Pdx1의 핵 표현을 보여줍니다. 스케일 바 : 50 μm의.

">

4 그림.
그림 4. 췌장 성숙 단계) qRT-PCR의 hESC의 췌장 호르몬 분석 DAPT을 사용하여 췌장 성숙 후, 공동 문화 또는 공동 문화 미디어 (제어)에게 문의하십시오. 결과 undifferentiated hESC에 대하여 정규화. P는 학생 T-시험에 의해 얻은 값. Dil-AC-LDL로 분류 RHMVEC (적색)와 B) 공동 문화가 빈 공간 (위)가있는 경우 내장 컴퓨터 시스템은 플레이트에 연결 영역을 보여주고, 다른 RHMVEC은 차별 ESC (아래)와 직접 접촉에서 찾을 수 있습니다. 공동 배양 방법을 사용하여 차별화된 세포를위한 C) C-펩타이드 (녹색) 염색법. 스케일 바 : 12.5 μm의 (위)와 50 μm의 (아래) D) RHMVEC의 Immunostaining은 RHMVEC에는 인슐린 표현을 보여줍니다 않습니다.

마커 Primer1 (5 '3') </ TD> Primer2 (5 '3') 심판
SOX17 CTCTGCCTCCTCCACGAA CAGAATCCAGACCTGCACAA 12
CXCR4 CACCGCATCTGGAGAACCA GCCCATTTCCTCGGTGTAGTT 4
FOXA2 GGAGCGGTGAAGATGGAA TACGTGTTCATGCCGTTCAT 12
PDX1 AAGTCTACCAAAGCTCACGCG GTAGGCGCCGCCTGC 4
PTF1 CATAGAGAACGAAACCACCCTTTGAG GCACGGAGTTTCCTGGACAGAGTTC 12
HLXB9 CACCGCGGGCATGATC ACTTCCCCAGGAGGTTCGA 4
HNF6 TGTGGAAGTGGCTGCAGGA TGTGAAGACCAACCTGGGCT 5
PAX6 CGAATTCTGCAGGTGTCCAA ACAGACCCCCTCGGACAGTAAT 5
NKX6.1 AGACCCACTTTTTCCGGACA CCAACGAATAGGCCAAACGA 5
ISL1 GATCTATGTCACCTCGCAAGG TACAACCACCATTTCACTG 12
글루카곤 AGGCAGACCCACTCAGTGA AACAATGGCGACCTCTTCTG 4
인슐린 AAGAGGCCATCAAGCAGATCA CAGGAGGCGCATCCACA 12

표 1. Primers는 qPCR 반응을 위해 사용됩니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

췌장 개발 과정, 차별 췌장 세포는 대동맥의 내피 세포와 근접 거리에 있습니다, 또한, 췌장 islets은 혈당과 섬 호르몬의 신속한 교환을 촉진하기 위해 밀도가 높은 vascularized 있습니다. 이러한 사실을 감안할 때, 그것은 내피 세포가 췌장 organogenesis의 과정에서 중요한 역할을하는 놀라운 일이 아닙니다. 췌장 개발하는 동안 내피 세포의 중요성이 점점 더 높이 평가되는 반면 배아 세포의 시험 관내 분화의에서의 역할은 덜 조사하고 있습니다. 우리의 이전 보고서에서 우리는 마우스 배아의 줄기 세포 13 췌장 성숙에 대한 내피 세포의 긍정적인 역할을 설립했습니다. 현재의 연구에서 우리는 인간 배아 줄기 세포를 차별에 내피 세포 신호 전달의 효과를 조사.

다수의 내피 세포가이 프로토콜에 사용했다고하는 모든 유사한 전반적인 효과 althou 결과분화의 효율성 변화와 GH. 현재 보고서에서는 쥐의 심장 microvascular 내피 세포 (RHMVEC)와 공동 culturing의 hESC 파생된 췌장 전구 세포의 효과를 제시한다. 내피 세포는 내피 세포에만 ac-LDL의 염색법에 의해 편리하게 시각이 될 수 있습니다. 사전 얼룩진 내피 세포와 차별 ESCs의 공동 문화가 내피 세포의 대부분은 오랜 기간 동안 문화에 가능한 동안, RHMEV 점차 사일 후에 사라지고 더 이상 성숙 6 일 후에 발견되지 수 있다고했다. RHMVEC 부재는 따라서 공동 문화 프로토콜의 최적화를 위해 선택되었다 정렬에 대한 필요성을 제거하여 분석을 단순화합니다.

현재 연구는 명확하게 유도 췌장 성숙의 내피 세포의 긍정적인 효과를 나타내는 반면, 같은 유도의 정확한 메커니즘은 아직 모르지만 현재 저희 연구실에서 조사를 받고. FEw 그럴듯한 메커니즘은 (i) 될 수도 셀 - 분비 분자 수준의 시그널링 (3) 내피 세포에 의해 분비 세포외 기질의 역할 (2) 내피 세포 매개 억제의 효과. 첫 번째 카테고리 세포 세포 접촉을 필요로하지 않지만, 이러한 접촉은 두 번째 및 세 번째 범주에 대한 의무이다. 따라서 우리는 다양한 공동 문화 구성을 사용하는 일부 예비 분석을 수행 : (I) 연락처 공동의 문화 (2) transwell 공동 문화 (3) 에어컨 미디어 문화. transwell 공동 문화 뒤에는; 이것은 같은 인슐린 표현으로 판단 접촉 공동 문화, 최대 차별화으로 이어진 관찰되었다 에어컨 미디어 문화 인슐린 표현 (데이터가 표시되지 않음)에 최소한의 영향을 초래하는 동안. 이러한 분석은 세포 - 세포 접촉이 중요 동안뿐만 아니라 중요한 몇 가지 짧은 수명 분비 분자있을 수 있음을 나타냅니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

우리는 공개 할게 없다.

Acknowledgements

우리는 116,520 DP2와 ORAU 랄프 포웨 주니어 학부 향상 수상 NIH 새로운 혁신 상을로부터 지원을 인정합니다.

Materials

Name Company Catalog Number Comments
mTeSR1 (with supplement) Stem Cell Technologies 5850
hESC qualified matrigel BD Biosciences 354277
DMEM:F12 Invitrogen 11330-032
MCDB-131 Invitrogen 10372019
MCDB-131 (Complete) VEC Technologies MCDB-131
B27 Supplement Invitrogen 17504044
Activin A R&D Systems 338-AC 100ng/ml
Wortmannin Invitrogen W3144 1μM
KAAD-Cyclopamie Sigma-Aldrich C4116 0.2μM
All-Trans Retinoic Acid Sigma-Aldrich R2625 2μM
DAPT Sigma-Aldrich D5942 30μM
Nicotinamide Sigma-Aldrich N0636 10 mM
Sodium Selenite Sigma-Aldrich S5261 30 nM
Insulin Sigma-Aldrich I1882 25 μg/ml
Transferrin Sigma-Aldrich T8158 50 μg/ml
EGF R&D Systems 236-EG 10ng/ml
EndoGro VEC Technologies ENDOGRO 10mg
Heparin Sigma-Aldrich H3149 90μg/ml
Hydrocortisone Sigma-Aldrich H0888 1μg/ml
NucleoSpin RNA II Macherey-Nagel 740955
ImProm II reverse transcription System Promega Corp. A3800
Brilliant II SYBR Green QPCR master mix Stratagene, Agilent Technologies 600548
Sox17 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-17355 1/500
PDX1 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-14662 1/500
C-Peptide Rabbit polyclonal Cell Signaling Technology 4593 1/500
Alexa Fluor 488 donkey anti-rabbit IgG Invitrogen A-21206 1/1000
Alexa Fluor 647 donkey anti-goat IgG Invitrogen A-21447 1/1000
Table 2. Reagents and Kits

DOWNLOAD MATERIALS LIST

References

  1. De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain á la médecine régénératrice de demain. Gynécologie Obstétrique & Fertilité. 37, 620-626 (2009).
  2. Murtaugh, L. C., Melton, D. A. Genes, Signals, and Lineages in Pancreas Development. Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).
  3. Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. Development of definitive endoderm from embryonic stem cells in culture. Development. 131, 1651-1662 (2004).
  4. D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat. Biotech. 24, 1392-1401 (2006).
  5. Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells. Cell Res. 19, 429-438 (2009).
  6. Basma, H., Soto-Gutiérrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes. Gastroenterology. 136, 990-999 (2009).
  7. Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -P., Chipperfield, H., Tan, E. -K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage. Stem Cells and Development. 16, 561-578 (2007).
  8. Kim, S. K., Melton, D. A. Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor. Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).
  9. Docherty, K. Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus. Current Opinion in Pharmacology. 1, 641-649 (2001).
  10. Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., Fässler, R., Gu, G., Gerber, H. -P., Ferrara, N., Melton, D. A. The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]> Cell Proliferation. Developmental Cell. 10, 397-405 (2006).
  11. Yoshitomi, H., Zaret, K. S. Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a. Development. 131, 807-817 (2004).
  12. Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. Marked differences in differentiation propensity among human embryonic stem cell lines. Nat. Biotech. 26, 313-315 (2008).
  13. Banerjee, I., Sharma, N., Yarmush, M. Impact of co-culture on pancreatic differentiation of embryonic stem cells. J. Tissue Eng. Regen. Med. 5, 313-323 (2010).

Comments

2 Comments

  1. good

    Reply
    Posted by: Zhongchun S.
    July 20, 2012 - 2:15 AM
  2. Dear Maria Jaramillo

    I am a student of the licencientura in biotechnology in the Universidad Argentina de la Empresa.
    I am currently studying the cell cultures, researching on the internet I find interesting the abstract, I would like to know if it is possible for me to send the paper by email please.
    thanks and greetings


    Ana Clara López Novo
    Matter cell cultures
    Department of biotechnology and food technology
    Faculty of engineering and Sciences
    Universidad Argentina de la Empresa
    Lima 717 (C1073AAO)
    Ciudad Autónoma de Buenos Aires
    Email: anaclaralopeznovo@gmail.com

    Reply
    Posted by: Ana L.
    May 6, 2013 - 10:24 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics