Delle cellule endoteliali Co-cultura Maturazione media di Cellule Staminali embrionali umane a cellule pancreas che producono insulina in un approccio di differenziazione Regia

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Il presente studio descrive un approccio diretto differenziazione nell'indurre la differenziazione pancreatica di cellule staminali embrionali umane. Di grande importanza è la scoperta che cellule endoteliali co-coltura maturazione media di cellule staminali umane embrionali derivano in cellule progenitrici del pancreas di insulina che esprimono.

Cite this Article

Copy Citation | Download Citations

Jaramillo, M., Banerjee, I. Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach. J. Vis. Exp. (61), e3759, doi:10.3791/3759 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Le cellule staminali embrionali (ESC) hanno due caratteristiche principali: possono essere a tempo indeterminato propagate in vitro in uno stato indifferenziato e sono pluripotenti, avendo così la potenzialità di differenziarsi in diversi lignaggi. Tali proprietà rendono CES estremamente attraente per la terapia cellulare a base e le applicazioni di trattamento di rigenerazione 1. Tuttavia, per il suo pieno potenziale da realizzare le cellule devono essere differenziate in fenotipi maturi e funzionale, che è un compito scoraggiante. Un approccio promettente per indurre la differenziazione cellulare è imitare al cammino dell'organogenesi nell'impostazione in vitro. Sviluppo del pancreas si verifica in 2 fasi specifiche, a cominciare da endoderma, che può svilupparsi in diversi organi, compreso fegato e pancreas. Endoderma induzione può essere ottenuto mediante la modulazione del percorso nodale aggiunta di Activin A 3 in combinazione con diversi fattori di crescita 4-7 in vitro mediante l'aggiunta di cyclopamine 8. La maturazione del pancreas è mediata da numerosi eventi collaterali tra cui l'inibizione del segnale di Notch, l'aggregazione di cellule progenitrici del pancreas in 3-dimensionali cluster; induzione di vascolarizzazione, solo per citarne alcuni. Di gran lunga il maggior successo nella maturazione in vitro delle cellule pancreatiche progenitrici derivate CES sono stati raggiunti attraverso l'inibizione del segnale di Notch dal completamento DAPT 9. Malgrado il successo, questo si traduce in bassa resa del fenotipo maturo con funzionalità ridotte. Una zona meno studiato è l'effetto di segnalazione delle cellule endoteliali nella maturazione del pancreas, che è sempre più apprezzato come un fattore importante che contribuisce in in-vivo maturazione di isole pancreatiche 10,11.

Il presente studio esamina tale effetto di endothelIAL di segnalazione delle cellule nella maturazione di cellule pancreatiche progenitrici derivate dal Comitato in isole pancreatiche produttrici di insulina come le cellule. Riportiamo un multi-stadio protocollo di differenziazione diretta dove i CES umani vengono prima indotti verso endoderma da Activin A insieme con l'inibizione della via PI3K. Specifica delle cellule del pancreas endoderma si ottiene l'inibizione di sonic hedgehog segnalazione da Cyclopamine insieme con l'induzione dei retinoidi mediante aggiunta di acido retinoico. La fase finale di maturazione viene indotta da segnalazione cellulare endoteliale raggiunti da una co-coltura configurazione. Mentre diverse cellule endoteliali sono stati testati in co-coltura, qui vi presentiamo i nostri dati con le cellule del cuore di ratto endoteliali microvascolari (RHMVEC), principalmente per la facilità di analisi.

Protocol

1. Cella di manutenzione

  1. HESC H1 (WiCell) sono stati mantenuti hESC qualificati Matrigel pozzi rivestiti con mTeSR1 media, con i media cambiano ogni giorno. I pozzetti sono stati rivestiti con una soluzione diluita matrigel, preparata aggiungendo 300 pl di Matrigel hESC in 25 ml di DMEM: F12. 1 ml di questa soluzione Matrigel è stato aggiunto a ciascun pozzetto di una piastra ben sei, o 400 microlitri aggiunti a ciascun pozzetto di una piastra da 12 pozzetti e lasciate rivestimento per 1 ora a temperatura ambiente. Le cellule sono state meccanicamente diversi passaggi in un rapporto di divisione di 1:4 raschiando colonie, una volta raggiunto tra 1 e 1,5 millimetri di diametro.
  2. RHMVEC (tecnologie VEC) è stata mantenuta in MCDB 131-supporto con mezzi modificare ogni altro giorno. Le cellule sono state suddivise per tripsinizzazione volta 80% di confluenza è stato raggiunto in un rapporto di divisione di 1:3. Le cellule endoteliali tra i passaggi 3 e 7 sono stati usati per questo studio.

2. Preparazione delle soluzioni madre

  1. Activin A è stato ricostituito a 50 ug / ml in P sterileBS contenente 0,1% di siero albumina bovina. La soluzione è stata aliquotati e conservati a -20 ° C.
  2. FEG è stato ricostituito a 500 ug / ml sterile in 10 mM di acido acetico. La soluzione è stata aliquotati e conservati a -20 ° C.
  3. L'insulina è stato ricostituito a 10 mg / ml aggiungendo acidificata H 2 O (pH ≤ 2), preparato tramite aggiunta di 0,1 ml di acido acetico glaciale a 10 ml di acqua.
  4. DAPT è stato ricostituito in DMSO a 18 mg / ml. È stato ulteriormente diluito a concentrazione 300 pM in DMEM: F12, aliquotati e conservati a -20 ° C.
  5. KAAD-Cyclopamine è stato ricostituito in DMSO a 5mg/ml. Essa è stata ulteriormente diluita al 2 concentrazione pM in DMEM: F12, aliquotati e conservati a -20 ° C.
  6. Acido all-trans retinoico è stato ricostituito a 2,7 mg / ml in etanolo al 95%. Essa è stata ulteriormente diluita alla concentrazione 2mM in DMEM: F12, aliquotati e conservati a -80 ° C.

3. Endoderma definitivo (DE) e Progenitore pancreatico (PP) Induzione

  1. Una volta che hColonie ESC raggiunto tra 1 e 1,5 millimetri di diametro, DE induzione è stata eseguita aggiungendo DMEM: F12 supplementato con B27, 0,2% BSA, 100 ng / ml Activin A e 1 pM Wortmannin per 4 giorni (giorno 0-Day 4) con mezzi cambiano ogni giorno.
  2. Dopo l'induzione DE era completa, capostipite di induzione del pancreas è stata indotta cambiando i media DMEM: F12 integrato con B27, 0.2% BSA e KAAD-Cyclopamine alla concentrazione di 0,2 uM per 24 ore (Giorno 4 Giorno 5).
  3. Dopo 24 ore i media è stato cambiato in DMEM: F12 integrato con B27, 0,2% di BSA, KAAD-Cyclopamine concentrazione a 0,2 micron e acido all-trans retinoico a 2 concentrazione uM per 3 giorni con i media cambiano ogni giorno (Day 5-Day 8) .

4. Maturazione del pancreas

  1. Dopo induzione PP, tutti i gruppi sono stati cambiati per supporti maturazione composto di DMEM: F12 supplementato con B27, 0,2% BSA, 10 Nicotinamide mM, 25 pg / ml di insulina, 30 nM Na 2 ug SeO 3 e 50 / ml transferrina per 2 days con i media cambiano ogni giorno (Day 8-Day 10).
  2. Dopo 2 giorni a mezzi di maturazione, la fase di maturazione finale viene effettuata in parallelo utilizzando diverse condizioni per il confronto. Differenziazione stata indotta nelle seguenti condizioni: (i) utilizzando tacca inibitore DAPT (ii) mediante co-coltura supporto soltanto, senza cellule endoteliali come controllo e (iii) mediante contatto co-coltura con cellule RHMVEC. Le cellule sono state mantenute in media DAPT o co-coltura per una settimana (giorno 10-Day 17) con i media cambiano ogni giorno.
    1. Supporto DAPT è stato preparato integrando i mezzi di comunicazione di maturazione con 30 DAPT pM. Cellule in questo gruppo sono stati esposti a completare MCDB131 per 24 ore e poi esposto a supporti DAPT per 6 giorni (Day 11-Day 17).
    2. Co-coltura è stato preparato mediante mezzi integrandolo MCDB 131-B27 con supporti, 0,2% BSA, 10 Nicotinamide mM, 10 ng / ml EGF, 1 pg / ml di idrocortisone, 10 mg EndoGro, 90 mcg / ml di eparina. Per la condizione di controllo dei media di differenziazione le cellule sono state espostea MCDB-131 terreno completo per 24 ore (Giorno 10-11 ° giorno) dopo che è stato cambiato i media a co-cultura dei media per 6 giorni (11 ° giorno-Day 17) (assenza di cellule endoteliali).
    3. Per il contatto co-coltura condizione, un milione RHMVEC è stato aggiunto alle cellule differenziano in completo MCDB-131 mezzi (tecnologie VEC) per 24 ore (giorno 10-11 ° giorno) per consentire allegato. Dopo 24 ore i media è stato cambiato in co-cultura dei media per 6 giorni (11-Day Day 17) con i media cambiano ogni giorno.

5. qRT-PCR

  1. Al termine di ciascuna fase di differenziazione (endoderma; progenitore pancreatiche, isolotto maturo) sono state lisate e RNA è stato estratto usando il kit di estrazione di RNA NucleoSpin II secondo le istruzioni del produttore.
  2. RNA è stato analizzato qualità controllando RNA assorbanza a 260 nm e 280 nm, seguita da quantificazione RNA utilizzando uno spettrofotometro SmartSpec Plus..
  3. Trascrizione inversa è stata eseguita usando ImProm k trascrizione inversa IIsecondo le istruzioni del produttore. Tutte le reazioni sono state eseguite con 100 ng di RNA.
  4. qRT-PCR è stata eseguita utilizzando il Mx3005P QPCR sistema (Agilent) e Brilliant II SYBR Green QPCR master mix secondo le istruzioni del produttore. Gli inneschi usati sono elencati nella tabella 1. La fase di inizializzazione è stata eseguita a 50 ° C per 2 minuti seguiti da 95 ° C per 10 minuti. 50 cicli di amplificazione sono state eseguite come segue: 95 ° C per 30 secondi, 54 ° C per 30 secondi e 72 ° C per 1 minuto.
  5. Fold change di espressione di mRNA in cellule indifferenziate è stata calcolata a partire dai valori CT utilizzando le seguenti formule:
    ACT (Marker i) = CT (Marker i) - CT (GAPDH)
    Δ ACT (marcatori i) = ACT (Marker i) (Sample) - ACT (Marker i) (cellule indifferenziate)
    Espressione relativa (Marker i) = 2-ΔΔCT(Marker i)

6. Immunocitochimica

  1. Al termine di ciascuna fase di differenziazione (endoderma; progenitore pancreatiche, isolotto maturo) cellule sono state fissate in formaldeide 4% per 15 minuti a temperatura ambiente.
  2. Le cellule sono state fissi permeabilizzate con 0,25% Triton X-100 (TX) per 15 minuti.
  3. Marcatura non specifica è stata bloccata mediante incubazione in siero asino 10% in 0,05% TX per 30 minuti.
  4. L'anticorpo primario incubazione è stata eseguita la notte a 4 ° C in tampone di bloccaggio alla diluizione anticorpo raccomandata (vedi tabella 1).
  5. Le cellule sono state lavate con 0,05% TX tre volte per 5 minuti.
  6. Incubazione anticorpo secondario è stata eseguita per un'ora a temperatura ambiente al buio con anticorpi appropriati diluiti in tampone di bloccaggio.
  7. Le cellule sono state lavate con 0,05% TX tre volte per 5 minuti.
  8. Colorazione nucleare è stata eseguita da incubazione con Hoescht macchia di diluizione 1:1000 in PBSper 5 minuti, seguito da 3 lavaggi con PBS.
  9. Cellule fissate e colorate sono stati ripresi utilizzando Olympus IX81 microscopio invertito e Metamorph software di imaging.

7. Risultati rappresentativi

L'aggiunta di Activin A e Wortmannin di hESC indifferenziato per 4 giorni induce endoderma definitiva come confermato da qRT-PCR per marcatori DE Sox17, i CXCR4, e Foxa2 e immunocolorazione per Sox17 come illustrato in figura 2. La differenziazione di cellule progenitrici pancreatiche dopo aggiunta di acido retinoico cyclopamine ed è stato confermato dal qRT-PCR di marcatori progenitrici pancreatiche e l'immunocolorazione per Pdx1 come illustrato in figura 3.

Nella fase finale di differenziazione, contattare co-coltura con cellule RHMVEC fortemente indotta sovraregolazione di espressione insulina nelle cellule pancreatiche derivate hESC progenitrici. L'efficienza di co-coltura differenziazione mediata è stata analizzata mediante comparing con la condizione di controllo utilizzando DAPT. DAPT è stato usato come controllo positivo in quanto è attualmente uno dei metodi più utilizzati per ottenere la maturazione pancreatica. Poiché la co-coltura è stata eseguita in un mezzo modificati completata da fattori di supporto di cellule endoteliali, il controllo aggiuntivo è stato effettuato con i media in assenza di cellule endoteliali per verificare l'effetto dei media sulla differenziazione. I dettagli di questa analisi sono presentati in Figura 4.

Figura 1.
Figura 1. Multi-stage protocollo per la differenziazione delle hESC insulina in cellule che esprimono.

Figura 2.
Figura 2. Induzione endoderma definitivo delle cellule staminali embrionali umane. A) qRT-PCR di marcatori rappresentativi DE hESC in cellule esposte a Activin A e Wortmannin per 4 giorni. Risultati ar e normalizzati rispetto al hESC indifferenziata. B) Sox17 colorazione (verde) e DAPI (blu) mostrano l'espressione nucleare di Sox17. Scale bar: 50 micron.

Figura 3.
Figura 3. Progenitore induzione pancreatica delle cellule staminali embrionali derivate cellule endoderma. A) qRT-PCR di marcatori precoci in cellule pancreatiche endoderma hESC derivate esposti all'acido retinoico cyclopamine e per 4 giorni dopo l'induzione DE. Risultati normalizzati rispetto al hESC indifferenziata. B) Pdx1 colorazione (viola) e DAPI (blu) mostrano l'espressione nucleare di Pdx1. Scale bar: 50 micron.

">

Figura 4.
Figura 4. Fase di maturazione pancreatica A) qRT-PCR degli ormoni pancreatici in hESC dopo la maturazione del pancreas con DAPT, contattare il co-coltura o di co-cultura dei media (controllo). Risultati normalizzati rispetto al hESC indifferenziata. valori di p ottenuti dallo studente t-test. B) Co-coltura con Dil-Ac-LDL marcato RHMVEC (Red) mostrano regioni in cui EC fissano alla piastra se ci sono spazi vuoti (in alto), RHMVEC altri si possono trovare a diretto contatto con la differenziazione ESC (in basso). C) C-peptide (verde) colorazione di cellule differenziate con co-coltura metodo. Scale bar: 12,5 micron (Top) e 50 micron (basso) D) immunocolorazione RHMVEC dimostra nessuna espressione insulina nel RHMVEC.

Marcatore Primer1 (5 'a 3') </ Td> Primer2 (5 'a 3') Ref
SOX17 CTCTGCCTCCTCCACGAA CAGAATCCAGACCTGCACAA 12
CXCR4 CACCGCATCTGGAGAACCA GCCCATTTCCTCGGTGTAGTT 4
FOXA2 GGAGCGGTGAAGATGGAA TACGTGTTCATGCCGTTCAT 12
Pdx1 AAGTCTACCAAAGCTCACGCG GTAGGCGCCGCCTGC 4
PTF1 CATAGAGAACGAAACCACCCTTTGAG GCACGGAGTTTCCTGGACAGAGTTC 12
HLXB9 CACCGCGGGCATGATC ACTTCCCCAGGAGGTTCGA 4
HNF6 TGTGGAAGTGGCTGCAGGA TGTGAAGACCAACCTGGGCT 5
PAX6 CGAATTCTGCAGGTGTCCAA ACAGACCCCCTCGGACAGTAAT 5
NKX6.1 AGACCCACTTTTTCCGGACA CCAACGAATAGGCCAAACGA 5
ISL1 GATCTATGTCACCTCGCAAGG TACAACCACCATTTCACTG 12
Glucagone AGGCAGACCCACTCAGTGA AACAATGGCGACCTCTTCTG 4
INSULINA AAGAGGCCATCAAGCAGATCA CAGGAGGCGCATCCACA 12

Primer Tabella 1. Utilizzato per le reazioni qPCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Durante lo sviluppo del pancreas, le cellule pancreatiche di differenziazione sono in stretta vicinanza con le cellule endoteliali della aorta, inoltre, isole pancreatiche sono densamente vascolarizzati per promuovere lo scambio rapido di glucosio nel sangue e ormoni insulari. Dati questi fatti, non è sorprendente che le cellule endoteliali svolgono un ruolo importante nel processo di organogenesi pancreatica. Mentre l'importanza di cellule endoteliali durante lo sviluppo del pancreas è sempre più apprezzato, il suo ruolo nella differenziazione in vitro di cellule embrionali è meno studiato. Nella nostra precedente relazione abbiamo stabilito il ruolo positivo delle cellule endoteliali sulla maturazione del pancreas del topo cellule staminali embrionali 13. In questo studio indaghiamo l'effetto di segnalazione delle cellule endoteliali a differenziare cellule staminali embrionali umane.

Più cellule endoteliali sono stati utilizzati in questo protocollo, ognuno dei quali ha portato in simili althou effetto complessivogh con variazioni di efficienza della differenziazione. Nella presente relazione vi presentiamo l'effetto della co-coltura di cellule pancreatiche progenitrici derivate hESC con le cellule del cuore di ratto endoteliali microvascolari (RHMVEC). Le cellule endoteliali può essere convenientemente visualizzate mediante colorazione AC-LDL, che è specifico solo le cellule endoteliali. Co-cultura dei CES di differenziazione con le cellule endoteliali pre-macchiate hanno mostrato che mentre la maggior parte delle cellule endoteliali erano vitali in coltura per un periodo prolungato di tempo, la RHMEV a poco a poco scompaiono dopo 4 giorni e non poteva più essere rilevato dopo 6 giorni di maturazione. Assenza della RHMVEC semplifica analisi eliminando la necessità di smistamento, quindi è stato scelto per l'ottimizzazione della co-coltura protocollo.

Mentre il presente studio indica chiaramente l'effetto positivo delle cellule endoteliali a indurre la maturazione del pancreas, l'esatto meccanismo di induzione quali è ancora sconosciuta e di essere attualmente indagato nel nostro laboratorio. A femeccanismi w plausibile può essere (i) l'effetto di molecole secrete da cellule (ii) inibizione mediata da cellule endoteliali di notch segnalazione (iii) il ruolo della matrice extracellulare secreta dalle cellule endoteliali. Mentre la prima categoria non richiede contatto cellula-cellula, tale contatto è obbligatorio per la seconda e terza categoria. Quindi abbiamo effettuato alcune analisi preliminari con diversi co-coltura configurazioni: (i) il contatto co-cultura (ii) Transwell co-cultura e (iii) la cultura condizionata media. È stato osservato che il contatto co-coltura provocato massima differenziazione, come giudicato da espressione dell'insulina; seguita da Transwell co-coltura, mentre condizionata cultura mezzi comportato un effetto minimo sulla espressione dell'insulina (dati non mostrati). Queste analisi indicano che, mentre contatto cellula-cellula è importante, ci potrebbero essere alcuni brevi molecole secrete durata che sono importanti pure.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Non abbiamo nulla da rivelare.

Acknowledgements

Noi riconosciamo il sostegno NIH Innovator Award New DP2 116520 e ORAU Ralph Powe Facoltà Junior Enhancement Award.

Materials

Name Company Catalog Number Comments
mTeSR1 (with supplement) Stem Cell Technologies 5850
hESC qualified matrigel BD Biosciences 354277
DMEM:F12 Invitrogen 11330-032
MCDB-131 Invitrogen 10372019
MCDB-131 (Complete) VEC Technologies MCDB-131
B27 Supplement Invitrogen 17504044
Activin A R&D Systems 338-AC 100ng/ml
Wortmannin Invitrogen W3144 1μM
KAAD-Cyclopamie Sigma-Aldrich C4116 0.2μM
All-Trans Retinoic Acid Sigma-Aldrich R2625 2μM
DAPT Sigma-Aldrich D5942 30μM
Nicotinamide Sigma-Aldrich N0636 10 mM
Sodium Selenite Sigma-Aldrich S5261 30 nM
Insulin Sigma-Aldrich I1882 25 μg/ml
Transferrin Sigma-Aldrich T8158 50 μg/ml
EGF R&D Systems 236-EG 10ng/ml
EndoGro VEC Technologies ENDOGRO 10mg
Heparin Sigma-Aldrich H3149 90μg/ml
Hydrocortisone Sigma-Aldrich H0888 1μg/ml
NucleoSpin RNA II Macherey-Nagel 740955
ImProm II reverse transcription System Promega Corp. A3800
Brilliant II SYBR Green QPCR master mix Stratagene, Agilent Technologies 600548
Sox17 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-17355 1/500
PDX1 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-14662 1/500
C-Peptide Rabbit polyclonal Cell Signaling Technology 4593 1/500
Alexa Fluor 488 donkey anti-rabbit IgG Invitrogen A-21206 1/1000
Alexa Fluor 647 donkey anti-goat IgG Invitrogen A-21447 1/1000
Table 2. Reagents and Kits

DOWNLOAD MATERIALS LIST

References

  1. De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain á la médecine régénératrice de demain. Gynécologie Obstétrique & Fertilité. 37, 620-626 (2009).
  2. Murtaugh, L. C., Melton, D. A. Genes, Signals, and Lineages in Pancreas Development. Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).
  3. Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. Development of definitive endoderm from embryonic stem cells in culture. Development. 131, 1651-1662 (2004).
  4. D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat. Biotech. 24, 1392-1401 (2006).
  5. Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells. Cell Res. 19, 429-438 (2009).
  6. Basma, H., Soto-Gutiérrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes. Gastroenterology. 136, 990-999 (2009).
  7. Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -P., Chipperfield, H., Tan, E. -K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage. Stem Cells and Development. 16, 561-578 (2007).
  8. Kim, S. K., Melton, D. A. Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor. Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).
  9. Docherty, K. Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus. Current Opinion in Pharmacology. 1, 641-649 (2001).
  10. Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., Fässler, R., Gu, G., Gerber, H. -P., Ferrara, N., Melton, D. A. The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]> Cell Proliferation. Developmental Cell. 10, 397-405 (2006).
  11. Yoshitomi, H., Zaret, K. S. Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a. Development. 131, 807-817 (2004).
  12. Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. Marked differences in differentiation propensity among human embryonic stem cell lines. Nat. Biotech. 26, 313-315 (2008).
  13. Banerjee, I., Sharma, N., Yarmush, M. Impact of co-culture on pancreatic differentiation of embryonic stem cells. J. Tissue Eng. Regen. Med. 5, 313-323 (2010).

Comments

2 Comments

  1. good

    Reply
    Posted by: Zhongchun S.
    July 20, 2012 - 2:15 AM
  2. Dear Maria Jaramillo

    I am a student of the licencientura in biotechnology in the Universidad Argentina de la Empresa.
    I am currently studying the cell cultures, researching on the internet I find interesting the abstract, I would like to know if it is possible for me to send the paper by email please.
    thanks and greetings


    Ana Clara López Novo
    Matter cell cultures
    Department of biotechnology and food technology
    Faculty of engineering and Sciences
    Universidad Argentina de la Empresa
    Lima 717 (C1073AAO)
    Ciudad Autónoma de Buenos Aires
    Email: anaclaralopeznovo@gmail.com

    Reply
    Posted by: Ana L.
    May 6, 2013 - 10:24 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics