Endotelcell Co-kultur förmedlar Mognad av mänskliga embryonala stamceller att producera insulin från bukspottkörteln celler i en riktad differentiering strategi

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Den aktuella studien beskriver en riktad differentiering strategi att framkalla bukspottkörteln differentiering av mänskliga embryonala stamceller. Av stor betydelse är upptäckten att endotelcell samodling förmedlar mognad av mänskliga embryonala stamceller som härrör pankreas stamceller till insulinproducerande celler som uttrycker.

Cite this Article

Copy Citation | Download Citations

Jaramillo, M., Banerjee, I. Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach. J. Vis. Exp. (61), e3759, doi:10.3791/3759 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Embryonala stamceller (ESC) har två huvudsakliga egenskaper: de kan vara på obestämd tid förökas in vitro i ett odifferentierat tillstånd och de är pluripotenta, vilket har potential att differentieras till flera linjer. Sådana egenskaper gör ekonomiska och sociala råd extremt attraktiv för cell-baserad terapi och regenerativ program behandling 1. Men för sin fulla potential skall kunna förverkligas cellerna måste differentieras till mogna och funktionella fenotyper, vilket är en skrämmande uppgift. En lovande metod att framkalla cellulär differentiering är att efterlikna vägen organogenesen i in vitro inställningen. Pankreatisk utveckling är känd att uppträda i olika stadier 2, med början med endoderm, som kan utvecklas till flera organ, inkluderande lever och pankreas. Endoderm induktion kan uppnås genom modulering av den nodala väg genom tillsats av Aktivin A 3 i kombination med flera tillväxtfaktorer 4-7 in vitro genom tillsats av cyklopamin 8. Pancreatic mognad förmedlas av flera parallella händelser inklusive hämning av skåran signalering, sammanslagning av pankreas föregångare till 3-dimensionella kluster, induktion av vaskularisering, för att nämna några. Den överlägset mest framgångsrika in vitro mognaden av ESC härledda celler i bukspottkörteln stamceller har uppnåtts genom hämning av skåran signalering av DAPT tillskott 9. Även framgångsrika, resulterar detta i lågt utbyte av den mogna fenotypen med reducerad funktionalitet. En mindre studerat område är effekten av endotelceller signalering i bukspottkörteln mognad, som alltmer uppskattad som en viktig bidragande faktor i in-vivo pankreasö mognad 10,11.

Den aktuella studien undersöker en sådan effekt av endotelIAL cell signalering i mognaden av humana ESC härledda celler i bukspottkörteln progenitorceller i insulinproducerande ö-liknande celler. Vi rapporterar flera steg riktad differentiering protokoll där de mänskliga ekonomiska och sociala råden först induceras mot endoderm med Aktivin A tillsammans med hämning av PI3K väg. Pankreatisk specifikation av endoderm celler uppnås genom inhibering av sonisk Hedgehog-signalering genom Cyklopamin tillsammans med retinoiden induktion genom tillsats av retinsyra. Slutskedet av mognad induceras genom endotel-cell-signalering uppnås genom en samodling konfiguration. Medan flera endotelceller har testats i samodling, här presenterar vi våra data med mikrovaskulära råtthjärta endotelceller (RHMVEC), främst för att underlätta analysen.

Protocol

1. Cellupprätthållande

  1. H1 hESC (WiCell) hölls på hESC kvalificerade Matrigel brunnarna med mTeSR1 media, med medier förändras varje dag. Brunnarna belades med utspädd Matrigel-lösning, framställd genom tillsats av 300 | il av hESC Matrigel i 25 ml DMEM: F12. 1 ml av denna Matrigel lösning sattes till varje brunn i en platta med sex brunnar, eller 400 | il sattes till varje brunn i en 12 brunnars platta och tilläts att belägga under 1 timme vid rumstemperatur. Celler mekaniskt passerades vid en split förhållande av 1:4 genom att skrapa kolonier när de träffats mellan 1 och 1,5 mm i diameter.
  2. RHMVEC (VEC teknik) bibehölls i MCDB-131 media med media ändrar varannan dag. Celler delas av trypsinisering gång 80% konfluens nåddes vid ett split 1:3. Endotelceller mellan passagerna 3 och 7 användes för denna studie.

2. Beredning av stamlösningar

  1. Aktivin A rekonstituerades vid 50 | ig / ml i steril PBS innehållande 0,1% bovint serumalbumin. Lösningen uppdelades i alikvoter och lagrades vid -20 ° C.
  2. EGF rekonstituerades vid 500 | ig / ml i steril 10 mM ättiksyra. Lösningen uppdelades i alikvoter och lagrades vid -20 ° C.
  3. Insulin rekonstituerades med 10 mg / ml genom tillsats av surgjordes H2O (pH ≤ 2), framställd genom tillsats av 0,1 ml isättika och 10 ml vatten.
  4. DAPT rekonstituerades i DMSO vid 18 mg / ml. Det späddes ytterligare till 300 | iM koncentration i DMEM:, F12 alikvoterades och lagrades vid -20 ° C.
  5. KAAD-Cyklopamin ombildades i DMSO på 5mg/ml. Det späddes ytterligare till 2 jiM koncentration i DMEM:, F12 alikvoterades och lagrades vid -20 ° C.
  6. All-trans retinsyra rekonstituerades vid 2,7 mg / ml i 95% etanol. Det späddes ytterligare till 2 mM koncentration i DMEM: F12, alikvoterades och lagrades vid -80 ° C.

3. Slutgiltig endoderm (DE) och bukspottkörtel progenitorceller (PP) Induktion

  1. Gång hESC kolonier uppnåtts mellan 1 och 1,5 mm i diameter, DE induktion utfördes genom tillsats av DMEM: F12 kompletterat med B27, 0,2% BSA, 100 ng / ml Aktivin A och 1 ^ iM Wortmannin under 4 dagar (dag 0-dag 4) med mediet ändras varje dag.
  2. Efter DE induktion var fullbordad pankreatisk progenitorceller induktion induceras genom förändring av mediet till DMEM: F12 kompletterat med B27, 0,2% BSA och KAAD-Cyklopamin vid 0,2 | iM koncentration under 24 timmar (dag 4-dag 5).
  3. Efter 24 timmar byttes mediet till DMEM: F12 kompletterat med B27, 0,2% BSA, KAAD-Cyklopamin vid 0,2 | iM koncentration och all-trans-retinsyra vid 2 ^ M koncentration under 3 dagar med medium ändras varje dag (Dag 5 Dag-8) .

4. Pankreatiskt Mognad

  1. Efter PP induktion var alla grupper ändrades till mognadsmediema sammansatta av DMEM: F12 kompletterat med B27, 0,2% BSA, 10 mM nikotinamid, 25 | ig / ml insulin, 30 nM Na 2 SeO 3 och 50 | ig / ml transferrin i 2 dygnays med media förändras varje dag (Dag 8-dagars 10).
  2. Efter 2 dagar i mognadsmedier, den slutliga mognaden steget genomföras parallellt med flera olika villkor för jämförelse. Differentiering inducerades under följande villkor: (i) med skåra hämmare DAPT (ii) med co-kultur media enbart, utan endotelceller som kontroll och (iii) med hjälp av kontakt samodling med RHMVEC celler. Celler bibehölls i DAPT eller co-kultur media i en vecka (Dag 10-Day 17) med media förändras varje dag.
    1. DAPT media framställdes genom att komplettera de mognadsmedier med 30 M DAPT. Celler i dessa grupper först exponerades för att fullborda MCDB131 under 24 timmar och exponerades sedan för DAPT medier under 6 dagar (Dag 11 Dag-17).
    2. Co-odlingsmedier framställdes genom att komplettera MCDB-131-medium med B27, 0,2% BSA, 10 mM nikotinamid, 10 ng / ml EGF, 1 | ig / ml hydrokortison, 10 mg EndoGro, 90 | ig / ml heparin. För mediakontroll konditionera differentierande cellerna exponeradestill MCDB-131 komplett medium i 24 timmar (dag 10-Dag 11), varefter medierna ändrades till co-kultur media under 6 dagar (dag 11-Day 17) (inga endotelceller).
    3. För kontakt samodling villkoret har miljoner RHMVEC sattes till de differentierande cellerna i komplett MCDB-131 medium (VEC teknik) under 24 timmar (dag 10-Dag 11) för att möjliggöra fastsättning. Efter 24 timmar media ändrades till co-kultur media under 6 dagar (dag 11-Day 17) med media förändras varje dag.

5. QRT-PCR-analys

  1. Vid slutet av varje stadium av differentiering (endoderm, pankreas stamfader, mogen holmen) lyserades och RNA extraherades med NucleoSpin RNA II extraktion kit enligt tillverkarens instruktioner.
  2. RNA-kvaliteten analyserades genom att kontrollera RNA-absorbans vid 260 nm och 280 nm, följt av RNA-kvantifiering med användning av en SmartSpec Plus spektrofotometer.
  3. Omvänd transkription utfördes med användning av ImProm II omvänd transkription kDet i enlighet med tillverkarens instruktioner. Alla reaktioner utfördes med 100 ng RNA.
  4. QRT-PCR utfördes med användning av Mx3005P QPCR-systemet (Agilent) och Brilliant II SYBR Green QPCR huvudblandning i enlighet med tillverkarens instruktioner. De använda primrarna är listade i tabell 1. Initialiseringssteget utfördes vid 50 ° C under 2 minuter följt av 95 ° C under 10 minuter. 50 amplifieringscykler utfördes enligt följande: 95 ° C under 30 sekunder, 54 ° C under 30 sekunder och 72 ° C under 1 minut.
  5. Faldig förändring av mål-mRNA-expression under odifferentierade celler beräknades från CT-värden med hjälp av följande formler:
    ACt (Marker i) = CT (Marker i) - CT (GAPDH)
    Δ ACt (markör i) = ACt (Marker i) (Sample) - ACt (Marker i) (diverse celler)
    Relativa expressionen (Marker i) = 2-ΔΔCT(Markör i)

6. Immunocytokemi

  1. Vid slutet av varje stadium av differentiering (endoderm, pankreas stamfader, mogna holmen) celler fixerades i 4% formaldehyd i 15 minuter vid rumstemperatur.
  2. Fixerade celler permeabiliserades med användning av 0,25% Triton X-100 (TX) under 15 minuter.
  3. Icke-specifik färgning blockerades genom inkubation i 10% åsna serum i 0,05% TX under 30 minuter.
  4. Primär antikropp inkubation utfördes över natt vid 4 ° C i blockeringsbuffert vid den rekommenderade antikroppsutspädning (se tabell 1).
  5. Cellerna tvättades med 0,05% TX tre gånger under 5 minuter.
  6. Sekundär antikropp inkubation utfördes under en timme vid rumstemperatur i mörker med lämpliga antikroppar utspädda i blockerande buffert.
  7. Cellerna tvättades med 0,05% TX tre gånger under 5 minuter.
  8. Nukleär färgning utfördes genom inkubering med Hoescht färgning vid 1:1000 utspädning i PBSunder 5 minuter följt av 3 tvättar med PBS.
  9. Fasta och färgade celler avbildades med Olympus IX81 inverterat mikroskop och Metamorph bildhanteringsprogram.

7. Representativa resultat

Tillsats av Aktivin A och Wortmannin att odifferentierade hESC under 4 dagar inducerar slutgiltig endoderm vilket bekräftas av QRT-PCR-analys för DE markörer Sox17, CXCR4 och Foxa2 och immunfärgning för Sox17 såsom illustreras i figur 2. Differentiering till celler i pankreas ursprungsceller efter tillsats av cyklopamin och retinsyra bekräftades genom QRT-PCR av markörer pankreatiska ursprungsceller och immunfärgning för Pdx1 såsom illustreras i figur 3.

I slutskedet av differentiering, kontakta samodling med RHMVEC celler starkt inducerade uppreglering av insulin uttryck i de härledda progenitorceller hESC pankreasceller. Effektiviteten i samodling medierad differentiering analyserades av samtidigmparing med kontroll tillstånd med användning DAPT. DAPT användes som en positiv kontroll eftersom det är idag en av de mest använda metoderna för att uppnå bukspottkörteln mognad. Eftersom co-kulturen utfördes i en modifierad media kompletteras med faktorer som stöder av endotelceller, gjordes ytterligare kontroll utfördes med medier i frånvaro av endotelceller att kontrollera effekten av media på differentiering. Detaljer av denna analys presenteras i figur 4.

Figur 1.
Figur 1. Flera steg protokoll för differentiering av hESC in insulin-uttryckande celler.

Figur 2.
Figur 2. Slutgiltigt endoderm induktion av mänskliga embryonala stamceller. A) QRT-PCR-analys av representativa DE markörer i hESC celler exponerade för Aktivin A och Wortmannin under 4 dagar. Resultaten ar e normaliserade med avseende på odifferentierade hESC. B) Sox17 färgning (Grön) och DAPI (blå) visar kärnkraft uttryck för Sox17. Skala bar: 50 nm.

Figur 3.
Figur 3. Pankreatiskt stamfader induktion av den embryonala stamceller härledda endoderm celler. A) QRT-PCR-analys av tidiga pankreatiska markörer i hESC härledda endoderm celler exponerade för cyklopamin och retinsyra under 4 dagar efter DE-induktion. Resultaten normaliserades med avseende på odifferentierade hESC. B) Pdx1 färgning (violett) och DAPI (blå) visar kärnkraft uttryck för Pdx1. Skala bar: 50 nm.

">

Figur 4.
Figur 4. Bukspottskörteln mognaden steg A) QRT-PCR-analys av pankreas hormoner i hESC efter pankreas mognaden med DAPT, kontakta co-kultur eller sam-kultur media (kontroll). Resultaten normaliserades med avseende på odifferentierade hESC. p-värden erhölls genom studentens t-test. B) Samarbete kultur med Dil-Ac-LDL märkt RHMVEC (Red) visar regioner där EC fäster plattan, om det finns tomma utrymmen (överst), kan andra RHMVEC hittas i direkt kontakt med differentierande ESC (botten). C) C-peptid (grön)-färgning för celler differentieras genom användning av samodling metod. Skala bar: 12,5 m (överst) och 50 nm (botten) D) immunfärgning av RHMVEC visar inget insulin uttryck i RHMVEC.

Markör Primer1 (5 'till 3') </ Td> Priiner2 (5 'till 3') Ref
SOX17 CTCTGCCTCCTCCACGAA CAGAATCCAGACCTGCACAA 12
CXCR4 CACCGCATCTGGAGAACCA GCCCATTTCCTCGGTGTAGTT 4
FOXA2 GGAGCGGTGAAGATGGAA TACGTGTTCATGCCGTTCAT 12
PDX1 AAGTCTACCAAAGCTCACGCG GTAGGCGCCGCCTGC 4
PTF1 CATAGAGAACGAAACCACCCTTTGAG GCACGGAGTTTCCTGGACAGAGTTC 12
HLXB9 CACCGCGGGCATGATC ACTTCCCCAGGAGGTTCGA 4
HNF6 TGTGGAAGTGGCTGCAGGA TGTGAAGACCAACCTGGGCT 5
PAX6 CGAATTCTGCAGGTGTCCAA ACAGACCCCCTCGGACAGTAAT 5
NKX6.1 AGACCCACTTTTTCCGGACA CCAACGAATAGGCCAAACGA 5
ISL1 GATCTATGTCACCTCGCAAGG TACAACCACCATTTCACTG 12
GLUKAGON AGGCAGACCCACTCAGTGA AACAATGGCGACCTCTTCTG 4
INSULIN AAGAGGCCATCAAGCAGATCA CAGGAGGCGCATCCACA 12

Tabell 1. Primrar som används för qPCR reaktioner.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Under bukspottkörtelns utveckling, differentierande pankreasceller är i närheten med endotelceller från aorta, dessutom pankreasöar är tätt vaskulariserade att främja snabbt utbyte av blodglukos och hormoner ö. Med tanke på dessa fakta, är det inte överraskande att endotelceller spela en viktig roll i processen för pankreatiskt organogenes. Även om betydelsen av endoteliala celler under pankreatisk utveckling används alltmer uppenbart, är dess roll i in vitro-differentiering av embryonala celler mindre undersöktes. I vår tidigare rapport har vi etablerat den positiva roll av endotelceller om bukspottkörtelns mognaden av mus embryonala stamceller 13. I den aktuella studien undersöker vi effekten av endotelceller signalering på differentiera mänskliga embryonala stamceller.

Flera endotelceller användes i detta protokoll resulterade som alla i liknande totala effekten although med variationer i effektivitet av differentiering. I den aktuella rapporten presenterar vi effekten av samodling hESC härledda celler i bukspottkörteln progenitorceller med mikrovaskulära råtthjärta endotelceller (RHMVEC). Endotelceller kan lämpligen visualiseras genom AC-LDL-färgning, vilket är specifikt för endast endotelceller. Samodling av de differentierande rådens med pre-färgade endotelceller visade att medan de flesta av de endotelceller var livskraftiga i kultur under en längre tid, det RHMEV gradvis försvinna efter 4 dagar och inte längre kunde upptäckas efter 6 dagar av mognad. Avsaknad av RHMVEC förenklar analysen genom att eliminera behovet för sortering, därför valdes för optimering av samodling protokollet.

Medan den aktuella studien visar tydligt den positiva effekten av endotelceller i inducerande bukspottkörtelns mognad, är den exakta mekanismen bakom en sådan induktion fortfarande okänd och som för närvarande undersöks i vårt laboratorium. En few rimliga mekanismer skulle kunna vara (i) effekten av cell utsöndrade-molekyler (ii) endotelceller hämning av Notch-signalering (iii) rollen av extracellulär matrix som utsöndras av endotelceller. Medan den första kategorin inte kräver cell-cellkontakt, är en sådan kontakt obligatoriskt för den andra och den tredje kategorin. Därför har vi utfört en preliminär analys med hjälp av olika co-kultur-konfigurationer: (i) kontakt sam-kultur (ii) transwell sam-kultur och (iii) betingad mediekulturen. Det observerades att kontakt samodling gav maximal differentiering, såsom bedömdes genom insulinuttryck; följt av transwell samodling; medan konditionerat medium kultur gav minimal effekt på insulin uttryck (data visas ej). Dessa analyser visar att samtidigt som cell-cell kontakten är viktig, kan det finnas vissa kortlivade utsöndrade molekyler som är viktiga också.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Vi har inget att lämna ut.

Acknowledgements

Vi erkänner stöd från NIH New Innovator Award DP2 116.520 och ORAU Ralph Powe Junior Faculty Enhancement Award.

Materials

Name Company Catalog Number Comments
mTeSR1 (with supplement) Stem Cell Technologies 5850
hESC qualified matrigel BD Biosciences 354277
DMEM:F12 Invitrogen 11330-032
MCDB-131 Invitrogen 10372019
MCDB-131 (Complete) VEC Technologies MCDB-131
B27 Supplement Invitrogen 17504044
Activin A R&D Systems 338-AC 100ng/ml
Wortmannin Invitrogen W3144 1μM
KAAD-Cyclopamie Sigma-Aldrich C4116 0.2μM
All-Trans Retinoic Acid Sigma-Aldrich R2625 2μM
DAPT Sigma-Aldrich D5942 30μM
Nicotinamide Sigma-Aldrich N0636 10 mM
Sodium Selenite Sigma-Aldrich S5261 30 nM
Insulin Sigma-Aldrich I1882 25 μg/ml
Transferrin Sigma-Aldrich T8158 50 μg/ml
EGF R&D Systems 236-EG 10ng/ml
EndoGro VEC Technologies ENDOGRO 10mg
Heparin Sigma-Aldrich H3149 90μg/ml
Hydrocortisone Sigma-Aldrich H0888 1μg/ml
NucleoSpin RNA II Macherey-Nagel 740955
ImProm II reverse transcription System Promega Corp. A3800
Brilliant II SYBR Green QPCR master mix Stratagene, Agilent Technologies 600548
Sox17 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-17355 1/500
PDX1 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-14662 1/500
C-Peptide Rabbit polyclonal Cell Signaling Technology 4593 1/500
Alexa Fluor 488 donkey anti-rabbit IgG Invitrogen A-21206 1/1000
Alexa Fluor 647 donkey anti-goat IgG Invitrogen A-21447 1/1000
Table 2. Reagents and Kits

DOWNLOAD MATERIALS LIST

References

  1. De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain á la médecine régénératrice de demain. Gynécologie Obstétrique & Fertilité. 37, 620-626 (2009).
  2. Murtaugh, L. C., Melton, D. A. Genes, Signals, and Lineages in Pancreas Development. Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).
  3. Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. Development of definitive endoderm from embryonic stem cells in culture. Development. 131, 1651-1662 (2004).
  4. D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat. Biotech. 24, 1392-1401 (2006).
  5. Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells. Cell Res. 19, 429-438 (2009).
  6. Basma, H., Soto-Gutiérrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes. Gastroenterology. 136, 990-999 (2009).
  7. Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -P., Chipperfield, H., Tan, E. -K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage. Stem Cells and Development. 16, 561-578 (2007).
  8. Kim, S. K., Melton, D. A. Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor. Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).
  9. Docherty, K. Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus. Current Opinion in Pharmacology. 1, 641-649 (2001).
  10. Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., Fässler, R., Gu, G., Gerber, H. -P., Ferrara, N., Melton, D. A. The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]> Cell Proliferation. Developmental Cell. 10, 397-405 (2006).
  11. Yoshitomi, H., Zaret, K. S. Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a. Development. 131, 807-817 (2004).
  12. Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. Marked differences in differentiation propensity among human embryonic stem cell lines. Nat. Biotech. 26, 313-315 (2008).
  13. Banerjee, I., Sharma, N., Yarmush, M. Impact of co-culture on pancreatic differentiation of embryonic stem cells. J. Tissue Eng. Regen. Med. 5, 313-323 (2010).

Comments

2 Comments

  1. good

    Reply
    Posted by: Zhongchun S.
    July 20, 2012 - 2:15 AM
  2. Dear Maria Jaramillo

    I am a student of the licencientura in biotechnology in the Universidad Argentina de la Empresa.
    I am currently studying the cell cultures, researching on the internet I find interesting the abstract, I would like to know if it is possible for me to send the paper by email please.
    thanks and greetings


    Ana Clara López Novo
    Matter cell cultures
    Department of biotechnology and food technology
    Faculty of engineering and Sciences
    Universidad Argentina de la Empresa
    Lima 717 (C1073AAO)
    Ciudad Autónoma de Buenos Aires
    Email: anaclaralopeznovo@gmail.com

    Reply
    Posted by: Ana L.
    May 6, 2013 - 10:24 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics