Endotelcelle Co-kulturen formidler Modning av Human embryonale stamceller til Bukspyttkjertelen insulinproduserende celler i en Regissert Differensiering Approach

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Den nåværende studien beskriver en rettet differensiering tilnærming i inducing bukspyttkjertelen differensiering av humane embryonale stamceller. Av stor betydning er det faktum at endotelceller co-kulturen formidler modning av humane embryonale stamceller hentet bukspyttkjertelen stamfedre til insulin som uttrykker cellene.

Cite this Article

Copy Citation | Download Citations

Jaramillo, M., Banerjee, I. Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach. J. Vis. Exp. (61), e3759, doi:10.3791/3759 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Embryonale stamceller (ESC) har to viktigste kjennetegnene: de kan være på ubestemt tid dyrket in vitro i en udifferensiert tilstand og de ​​er pluripotent, og dermed ha potensial til å differensiere i flere linjene. Slike egenskaper gjør ESCs svært attraktivt for celle-basert terapi og regenererende behandling applikasjoner en. Men for sitt fulle potensial til å bli realisert cellene må differensieres til modne og funksjonelle fenotyper, som er en skremmende oppgave. En lovende tilnærming i inducing cellulær differensiering er å nøye etterligne banen organogenesen i in vitro-innstillingen. Bukspyttkjertelen utvikling forekommer i bestemte stadier 2, starter med endoderm, som kan utvikle seg til flere organer, blant annet lever og bukspyttkjertel. Endoderm induksjon kan oppnås ved modulering av nodal vei gjennom tilførsel av activin A 3 i kombinasjon med flere vekstfaktorer 4-7 in vitro ved tilsetting av cyclopamine 8. Bukspyttkjertelen modning er mediert av flere parallelle arrangementer, inkludert hemming av hakk signalering, aggregering av pankreas progenitors inn 3-dimensjonale klynger; induksjon av vascularization, for å nevne noen. Den klart mest vellykkede in vitro modning av MGP avledet bukspyttkjertelen stamceller har blitt oppnådd gjennom hemming av hakk signalisere ved DAPT tilskudd ni. Selv vellykket, dette resulterer i lav avkastning på den modne fenotype med redusert funksjonalitet. En mindre studert område er effekten av endotelial celle signalisering i bukspyttkjertelen modning, noe som blir i økende grad verdsatt som en viktig medvirkende faktor i in-vivo bukspyttkjertelen holmen modning 10,11.

Den nåværende studien utforsker slik effekt av endothelIAL celle signalisering i modning av menneskelige MGP avledet bukspyttkjertelen stamceller til insulinproduserende holme-lignende celler. Vi rapporterer en flertrinns rettet differensiering protokoll hvor de menneskelige ESCs er første indusert mot endoderm av activin A langs med hemming av PI3K veien. Bukspyttkjertelen spesifikasjon av endoderm celler oppnås ved hemming av sonic hedgehog signalering ved Cyclopamine sammen med retinoid induksjon ved tilsetting av retinsyre. Den siste etappen av modning er indusert av endotelceller signalering oppnås ved en co-kultur konfigurasjon. Mens flere endotelceller har blitt testet i co-kulturen, her vi presentere våre data med rotte hjerte mikrovaskulære endotelceller (RHMVEC), primært for enkel analyse.

Protocol

1. Cell Vedlikehold

  1. H1 hESC (WiCell) ble opprettholdt på hESC kvalifiserte matrigel belagt brønner med mTeSR1 media, med media endres hver dag. Brønnene ble belagt med fortynnet matrigel løsning, utarbeidet ved å legge til 300 mL av hESC matrigel i 25 ml DMEM: F12. 1 ml av denne matrigel løsningen ble lagt til hver brønn av en seks brønn plate, eller 400 mL lagt til hver brønn av en 12 brønn plate og lov til pels i 1 time ved romtemperatur. Celler ble mekanisk passaged ved en splitt forholdet 1:04 ved å skrape kolonier når de nådde mellom 1 og 1,5 i diameter.
  2. RHMVEC (VEC teknologier) ble opprettholdt i MCDB-131 media med media endres annenhver dag. Celler ble splittet av trypsinization gang 80% samløpet ble nådd ved en splitt forholdet 1:3. Endotelceller mellom passasjer 3 og 7 ble brukt for denne studien.

2. Utarbeidelse av Stock Solutions

  1. Activin A ble rekonstruert ved 50 mikrogram / ml i steril PBS inneholder 0,1% bovint serum albumin. Løsningen ble alikvoteres og oppbevart ved -20 ° C.
  2. EGF ble rekonstruert ved 500 mikrogram / ml i steril 10 mM eddiksyre. Løsningen ble alikvoteres og oppbevart ved -20 ° C.
  3. Insulin ble rekonstruert ved 10 mg / ml ved å tilsette syrnet H 2 O (pH ≤ 2), utarbeidet av tillegg på 0,1 ml iseddik til 10 ml vann.
  4. DAPT ble rekonstituert i DMSO på 18 mg / ml. Det ble videre fortynnet til 300 mM konsentrasjon i DMEM: F12, alikvoteres og lagret ved -20 ° C.
  5. KAAD-Cyclopamine ble rekonstituert i DMSO på 5mg/ml. Det ble videre fortynnet til 2 mM konsentrasjon i DMEM: F12, alikvoteres og lagret ved -20 ° C.
  6. All-trans retinsyre ble rekonstruert på 2,7 mg / ml i 95% etanol. Det ble videre fortynnet til 2mm konsentrasjon i DMEM: F12, alikvoteres og oppbevart ved -80 ° C.

3. Definitive endoderm (DE) og bukspyttkjertelen progenitor (PP) Induksjon

  1. Når hMGP kolonier nådde mellom 1 og 1,5 mm i diameter, ble DE induksjon utført ved å legge DMEM: F12 supplert med B27, 0,2% BSA, 100 ng / ml activin A og 1 mM Wortmannin for 4 dager (dag 0-dag 4) med media endres hver dag.
  2. Etter DE induksjon var fullført, ble bukspyttkjertelen stamfar induksjon indusert ved å endre media til DMEM: F12 supplert med B27, 0,2% BSA og KAAD-Cyclopamine på 0,2 mM konsentrasjon i 24 timer (Dag 4-Day 5).
  3. Etter 24 timer media ble endret til DMEM: F12 supplert med B27, 0,2% BSA, KAAD-Cyclopamine på 0,2 mM konsentrasjon og all-trans retinsyre på 2 mM konsentrasjon i 3 dager med media endres hver dag (Dag 5-Day 8) .

4. Bukspyttkjertelen Modning

  1. Etter PP induksjon, ble alle gruppene endret til modning media består av DMEM: F12 supplert med B27, 0,2% BSA, 10 mM nikotinamid, 25 mikrogram / ​​ml insulin, 30 nM Na 2 SEO 3 og 50 mikrogram / ​​ml transferrin for 2 days med media endres hver dag (Dag 8-Day 10).
  2. Etter 2 dager i modning media, er det siste modningen trinnet utføres parallelt med flere ulike forhold for sammenligning. Differensiering ble indusert under følgende forutsetninger: (i) med hakket hemmer DAPT (ii) med co-dyrkingsmedier bare, uten endotelceller som kontroll og (iii) bruke kontakt co-kulturen med RHMVEC celler. Celler ble opprettholdt i DAPT eller co-kulturen media for en uke (Dag 10 Dag 17) med media endres hver dag.
    1. DAPT media ble utarbeidet ved å supplere modningen media med 30 mM DAPT. Celler i denne grupper ble først utsatt for å fullføre MCDB131 i 24 timer og deretter utsatt for DAPT media i 6 dager (dag 11-Day 17).
    2. Co-kultur media ble utarbeidet ved å supplere MCDB-131 media med B27, 0,2% BSA, 10 mM nikotinamid, 10 ng / ml EGF, 1 mikrogram / ml hydrokortison, 10 mg EndoGro, 90 mikrogram / ml heparin. For media kontroll tilstand de unike cellene ble utsatttil MCDB-131 komplett medium i 24 timer (Dag 10 Dag 11) etter som media ble endret til co-kultur media i 6 dager (dag 11-Day 17) (ingen endotelceller).
    3. For kontakt co-kulturen tilstand, ble millioner RHMVEC lagt til de unike cellene i komplette MCDB-131 media (VEC teknologier) for 24 timer (Dag 10 Dag 11) for å tillate vedlegg. Etter 24 timer media ble endret til co-kultur media i 6 dager (dag 11-Day 17) med media endres hver dag.

5. QRT-PCR-analyse

  1. På slutten av hvert stadium av differensiering (endoderm, bukspyttkjertelen stamfar; moden holme) ble lysert og RNA ble ekstrahert ved hjelp NucleoSpin RNA II utvinning kit i henhold til produsentens anvisninger.
  2. RNA kvalitet ble analysert ved å sjekke RNA absorbansen ved 260 nm og 280 nm, etterfulgt av RNA kvantifisering bruke en SmartSpec Plus spektrofotometer.
  3. Revers transkripsjon ble utført ved hjelp ImProm II revers transkripsjon kdet i henhold til produsentens anvisninger. Alle reaksjonene ble utført med 100 ng av RNA.
  4. QRT-PCR ble utført ved hjelp av Mx3005P QPCR system (Agilent) og Brilliant II SYBR Grønn QPCR mester blanding henhold til produsentens anvisninger. De primere som brukes er notert på bordet en. Initialisering trinnet ble utført ved 50 ° C i 2 minutter etterfulgt av 95 ° C i 10 minutter. 50 forsterkning sykluser ble utført som følger: 95 ° C i 30 sekunder, 54 ° C i 30 sekunder og 72 ° C i 1 minutt.
  5. Fold endring av målet mRNA uttrykk enn udifferensierte celler ble beregnet ut fra CT verdier ved hjelp av følgende formler:
    ΔCT (Marker i) = CT (Marker i) - CT (GAPDH)
    Δ ΔCT (Marker i) = ΔCT (Marker i) (Sample) - ΔCT (Marker i) (Udifferensiert celler)
    Relativ uttrykk (Marker i) = 2-ΔΔCT(Markør i)

6. Immunocytochemistry

  1. På slutten av hvert stadium av differensiering (endoderm, bukspyttkjertelen stamfar; moden holme) celler, fiksert i 4% formaldehyd i 15 minutter ved romtemperatur.
  2. Faste celler ble permeabilized bruker 0,25% Triton X-100 (TX) i 15 minutter.
  3. Ikke-spesifikk farging ble blokkert ved inkubasjon i 10% esel serum i 0,05% TX i 30 minutter.
  4. Primær antistoff inkubering ble utført over natten ved 4 ° C i blokkering buffer ved anbefalt antistoff fortynning (se tabell 1).
  5. Cellene ble vasket med 0,05% TX tre ganger i 5 minutter.
  6. Sekundær antistoff inkubasjon ble utført en time ved romtemperatur i mørket med aktuelle antistoffer utvannet i blokkering buffer.
  7. Cellene ble vasket med 0,05% TX tre ganger i 5 minutter.
  8. Nuclear farging ble utført ved inkubasjon med Hoescht flekk 1:1000 fortynning i PBSi 5 minutter, etterfulgt av 3 vasker med PBS.
  9. Faste og beiset celler ble fotografert med Olympus IX81 invertert mikroskop og Metamorph bildebehandlingsprogrammer.

7. Representative Resultater

Tilsetting av activin A og Wortmannin til udifferensiert hESC for 4 dager induserer definitive endoderm som bekreftes av Qrt-PCR-analyse for DE markører Sox17 og CXCR4, og Foxa2 og farging for Sox17 som illustrert i figur 2. Differensiering til bukspyttkjertelen stamceller etter tilsetting av cyclopamine og retinsyre ble bekreftet av Qrt-PCR av pankreas progenitor markører og farging for Pdx1 som illustrert i figur 3.

På den siste etappen av differensiering, kontakt co-kulturen med RHMVEC celler sterkt indusert oppregulering av insulin uttrykk i de hESC avledet bukspyttkjertelen stamceller. Effektiviteten av co-kulturen mediert differensiering ble analysert ved comparing med kontroll tilstand ved hjelp DAPT. DAPT ble brukt som en positiv kontroll fordi det er for øyeblikket en av de mest brukte metodene for å oppnå bukspyttkjertelen modning. Siden co-kulturen ble utført i en modifisert media supplert med faktorer støttende av endotelceller, ble ytterligere kontroll utført med media i fravær av endotelceller å verifisere effekten av media på differensiering. Detaljer om denne analysen presenteres i figur 4.

Figur 1.
Figur 1. Multi-stage protokoll for differensiering av hESC inn insulin uttrykke celler.

Figur 2.
Figur 2. Definitive endoderm induksjon av humane embryonale stamceller. A) QRT-PCR analyse av representative DE markører i hESC celler eksponert for activin A og Wortmannin i 4 dager. Resultater ar e normalisert med hensyn til udifferensiert hESC. B) Sox17 farging (Green) og DAPI (blå) viser kjernefysisk uttrykk for Sox17. Scale bar: 50 mikrometer.

Figur 3.
Figur 3. Bukspyttkjertelen stamfar induksjon av embryonale stamceller hentet endoderm celler. A) QRT-PCR analyse av tidlige pankreas markører i hESC avledet endoderm celler eksponert for cyclopamine og retinsyre i 4 dager etter DE induksjon. Resultater normalisert med hensyn til udifferensiert hESC. B) Pdx1 farging (fiolett) og DAPI (blå) viser kjernefysisk uttrykk for Pdx1. Scale bar: 50 mikrometer.

">

Figur 4.
Figur 4. Bukspyttkjertelen modning scenen A) Qrt-PCR analyse av pankreas hormoner i hESC etter pankreas modning hjelp DAPT, kontakt co-kultur eller co-culture media (kontroll). Resultater normalisert med hensyn til udifferensiert hESC. p Verdiene er oppnådd ved student t-test. B) Co-kulturen med Dil-Ac-LDL merket RHMVEC (Red) viser områder hvor egenkapitalbevis festes til platen hvis det er tomrommene (øverst), kan andre RHMVEC finnes i direkte kontakt med differensierende ESC (nederst). C) C-peptid (Green) farging av celler differensiert bruk av co-kulturen metode. Scale bar: 12,5 mikrometer (øverst) og 50 mikrometer (nederst) D) farging av RHMVEC demonstrerer ikke insulin uttrykk i RHMVEC.

Marker Primer1 (5 'til 3') </ Td> Primer2 (5 'til 3') Ref
SOX17 CTCTGCCTCCTCCACGAA CAGAATCCAGACCTGCACAA 12
CXCR4 CACCGCATCTGGAGAACCA GCCCATTTCCTCGGTGTAGTT 4
FOXA2 GGAGCGGTGAAGATGGAA TACGTGTTCATGCCGTTCAT 12
PDX1 AAGTCTACCAAAGCTCACGCG GTAGGCGCCGCCTGC 4
PTF1 CATAGAGAACGAAACCACCCTTTGAG GCACGGAGTTTCCTGGACAGAGTTC 12
HLXB9 CACCGCGGGCATGATC ACTTCCCCAGGAGGTTCGA 4
HNF6 TGTGGAAGTGGCTGCAGGA TGTGAAGACCAACCTGGGCT 5
PAX6 CGAATTCTGCAGGTGTCCAA ACAGACCCCCTCGGACAGTAAT 5
NKX6.1 AGACCCACTTTTTCCGGACA CCAACGAATAGGCCAAACGA 5
ISL1 GATCTATGTCACCTCGCAAGG TACAACCACCATTTCACTG 12
Glukagon AGGCAGACCCACTCAGTGA AACAATGGCGACCTCTTCTG 4
Insulin AAGAGGCCATCAAGCAGATCA CAGGAGGCGCATCCACA 12

Tabell 1. Primere brukt for qPCR reaksjoner.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Under bukspyttkjertelen utvikling, differensierende bukspyttkjertelen celler er i umiddelbar nærhet med endotelceller fra aorta, og videre, bukspyttkjertel holmer er tett vascularized å fremme rask utveksling av blodsukker og holmen hormoner. Gitt disse fakta, er det ikke overraskende at endotelceller spiller en viktig rolle i prosessen med bukspyttkjertelen organogenesen. Mens betydningen av endotelceller under bukspyttkjertelen utvikling blir i økende grad verdsatt, er dens rolle i in vitro differensiering av embryonale celler mindre undersøkt. I vår tidligere rapport etablerte vi den positive rollen endotelceller på bukspyttkjertelen modning av mus embryonale stamceller 13. I denne studien undersøker vi effekten av endotelceller signalering på differensierende humane embryonale stamceller.

Flere endotelceller ble brukt i denne protokollen, resulterte alle i lignende samlede effekten althouGH med variasjoner i effektivitet av differensiering. I dagens rapport presenterer vi effekten av co-dyrking hESC avledet bukspyttkjertelen stamceller med rotte hjerte mikrovaskulære endotelceller (RHMVEC). Endotelceller kan enkelt visualiseres ved AC-LDL flekker, som er spesifikk for bare endotelceller. Co-kulturen av de differensierende ESCs med pre-fargede endotelceller viste at mens de fleste av endotelceller var levedyktig i kultur for lengre tid, RHMEV gradvis forsvinne etter 4 dager og kunne ikke lenger påvises etter 6 dagers modning. Fravær av RHMVEC forenkler analysen ved å eliminere behovet for sortering, dermed ble valgt for optimalisering av co-kulturen protokollen.

Mens denne studien indikerer klart den positive effekten av endotelceller i induserende bukspyttkjertelen modning, er den eksakte mekanismen for slik induksjon fortsatt ukjent og blir nå undersøkt i laboratoriet vårt. En few plausible mekanismer kan være (i) effekten av celle-utskilt molekyler (ii) endotelcelle mediert hemming av hakk signalering (iii) rolle ekstracellulær matrix skilles ut av endotelceller. Mens den første kategorien ikke krever celle-celle kontakt, er slik kontakt obligatorisk for den andre og tredje kategori. Derfor har vi utført noen foreløpige analyser ved hjelp av ulike co-kultur konfigurasjoner: (i) kontakt co-kultur (ii) transwell co-kultur og (iii) betinget mediekultur. Det ble observert at kontakten co-kultur resulterte i maksimal differensiering, som bedømt av insulin uttrykk, etterfulgt av transwell co-kulturen, mens betinget mediekultur resulterte i minimal effekt på insulin uttrykk (data ikke vist). Disse analysene indikerer at mens celle-celle kontakt er viktig, kan det være noen kortlivede skilles molekyler som er viktig i tillegg.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Vi har ingenting å avsløre.

Acknowledgements

Vi erkjenner støtte fra NIH New Innovator Award DP2 116520 og ORAU Ralph Powe Junior fakultet Enhancement Award.

Materials

Name Company Catalog Number Comments
mTeSR1 (with supplement) Stem Cell Technologies 5850
hESC qualified matrigel BD Biosciences 354277
DMEM:F12 Invitrogen 11330-032
MCDB-131 Invitrogen 10372019
MCDB-131 (Complete) VEC Technologies MCDB-131
B27 Supplement Invitrogen 17504044
Activin A R&D Systems 338-AC 100ng/ml
Wortmannin Invitrogen W3144 1μM
KAAD-Cyclopamie Sigma-Aldrich C4116 0.2μM
All-Trans Retinoic Acid Sigma-Aldrich R2625 2μM
DAPT Sigma-Aldrich D5942 30μM
Nicotinamide Sigma-Aldrich N0636 10 mM
Sodium Selenite Sigma-Aldrich S5261 30 nM
Insulin Sigma-Aldrich I1882 25 μg/ml
Transferrin Sigma-Aldrich T8158 50 μg/ml
EGF R&D Systems 236-EG 10ng/ml
EndoGro VEC Technologies ENDOGRO 10mg
Heparin Sigma-Aldrich H3149 90μg/ml
Hydrocortisone Sigma-Aldrich H0888 1μg/ml
NucleoSpin RNA II Macherey-Nagel 740955
ImProm II reverse transcription System Promega Corp. A3800
Brilliant II SYBR Green QPCR master mix Stratagene, Agilent Technologies 600548
Sox17 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-17355 1/500
PDX1 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-14662 1/500
C-Peptide Rabbit polyclonal Cell Signaling Technology 4593 1/500
Alexa Fluor 488 donkey anti-rabbit IgG Invitrogen A-21206 1/1000
Alexa Fluor 647 donkey anti-goat IgG Invitrogen A-21447 1/1000
Table 2. Reagents and Kits

DOWNLOAD MATERIALS LIST

References

  1. De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain á la médecine régénératrice de demain. Gynécologie Obstétrique & Fertilité. 37, 620-626 (2009).
  2. Murtaugh, L. C., Melton, D. A. Genes, Signals, and Lineages in Pancreas Development. Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).
  3. Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. Development of definitive endoderm from embryonic stem cells in culture. Development. 131, 1651-1662 (2004).
  4. D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat. Biotech. 24, 1392-1401 (2006).
  5. Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells. Cell Res. 19, 429-438 (2009).
  6. Basma, H., Soto-Gutiérrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes. Gastroenterology. 136, 990-999 (2009).
  7. Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -P., Chipperfield, H., Tan, E. -K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage. Stem Cells and Development. 16, 561-578 (2007).
  8. Kim, S. K., Melton, D. A. Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor. Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).
  9. Docherty, K. Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus. Current Opinion in Pharmacology. 1, 641-649 (2001).
  10. Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., Fässler, R., Gu, G., Gerber, H. -P., Ferrara, N., Melton, D. A. The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]> Cell Proliferation. Developmental Cell. 10, 397-405 (2006).
  11. Yoshitomi, H., Zaret, K. S. Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a. Development. 131, 807-817 (2004).
  12. Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. Marked differences in differentiation propensity among human embryonic stem cell lines. Nat. Biotech. 26, 313-315 (2008).
  13. Banerjee, I., Sharma, N., Yarmush, M. Impact of co-culture on pancreatic differentiation of embryonic stem cells. J. Tissue Eng. Regen. Med. 5, 313-323 (2010).

Comments

2 Comments

  1. good

    Reply
    Posted by: Zhongchun S.
    July 20, 2012 - 2:15 AM
  2. Dear Maria Jaramillo

    I am a student of the licencientura in biotechnology in the Universidad Argentina de la Empresa.
    I am currently studying the cell cultures, researching on the internet I find interesting the abstract, I would like to know if it is possible for me to send the paper by email please.
    thanks and greetings


    Ana Clara López Novo
    Matter cell cultures
    Department of biotechnology and food technology
    Faculty of engineering and Sciences
    Universidad Argentina de la Empresa
    Lima 717 (C1073AAO)
    Ciudad Autónoma de Buenos Aires
    Email: anaclaralopeznovo@gmail.com

    Reply
    Posted by: Ana L.
    May 6, 2013 - 10:24 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics