Endotheelcel Co-cultuur Bemiddelt Rijping van menselijke embryonale stamcellen te Pancreatic insuline producerende cellen in een Geregisseerd Differentiatie aanpak

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

De huidige studie beschrijft een gerichte aanpak van differentiatie in het induceren van de alvleesklier differentiatie van humane embryonale stamcellen. Van grote betekenis is de bevinding dat endotheelcel co-cultuur bemiddelt rijping van menselijke embryonale stamcellen afkomstig van de pancreas voorlopercellen in insuline tot expressie brengen.

Cite this Article

Copy Citation | Download Citations

Jaramillo, M., Banerjee, I. Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach. J. Vis. Exp. (61), e3759, doi:10.3791/3759 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Embryonale stamcellen (ESC) hebben twee belangrijke kenmerken: zij kunnen voor onbepaalde tijd gekweekt in vitro in een ongedifferentieerde staat en ze zijn pluripotent, waardoor er meer mogelijkheden om te differentiëren in meerdere geslachten. Dergelijke eigenschappen maken SER zeer aantrekkelijk voor cel-gebaseerde therapie en regeneratieve behandeling aanvragen 1. Echter zijn volle potentieel worden gerealiseerd de cellen worden onderscheiden in volwassen en functionele fenotypen, een moeilijke taak. Een veelbelovende benadering induceren celdifferentiatie is het pad van toestanden in nauw Organogenese in vitro omgeving. Pancreas ontwikkeling is bekend dat het voorkomen in specifieke fasen 2, te beginnen met endoderm, die kunnen leiden tot verschillende organen, waaronder de lever en de alvleesklier. Endoderm inductie kan worden bereikt door modulatie van de knooppunten pad door toevoeging van activine A 3 in combinatie met verschillende groeifactoren 4-7 in vitro worden bereikt door toevoeging van cyclopamine 8. Pancreas rijping wordt gemedieerd door een aantal parallelle evenementen, waaronder remming van de inkeping signalering, aggregatie van de pancreas voorlopercellen in 3-dimensionale clusters; inductie van vascularisatie, een paar te noemen. Verreweg de meest succesvolle in vitro maturatie van ESC afgeleide pancreas voorlopercellen zijn bereikt door remming van de inkeping signalering door dApt suppletie 9. Hoewel succesvol, resulteert in een lage opbrengst van het rijpe fenotype met beperkte functionaliteit. Een minder bestudeerde gebied is het effect van endotheelcellen signalering in de alvleesklier rijping, die steeds meer wordt gewaardeerd als een belangrijke factor in de in-vivo eilandjes van Langerhans rijping 10,11.

De huidige studie onderzoekt dergelijke effecten van endothelial cel signalisatie in de rijping van de menselijke ESC afgeleide pancreas voorlopercellen naar insuline producerende eilandjes van Langerhans-achtige cellen. We brengen verslag uit van een multi-stage gericht differentiatie protocol waar de menselijke sociaal-economische raden het eerst naar endoderm veroorzaakt door Activin A, samen met remming van de PI3K. Pancreas specificatie van endoderm cellen wordt bereikt door remming van sonic hedgehog signalering door Cyclopamine samen met retinoïde inductie door toevoeging van retinoïnezuur. De laatste fase van rijping wordt veroorzaakt door endotheelcellen signalering bereikt door een co-cultuur configuratie. Terwijl een aantal endotheelcellen zijn getest in de co-cultuur, hier presenteren wij onze gegevens met rattenhart microvasculaire endotheelcellen (RHMVEC), voornamelijk voor het gemak van de analyse.

Protocol

1. Celonderhoud

  1. H1 hESC (WiCell) werden aangehouden op hESC gekwalificeerde Matrigel beklede putjes met mTeSR1 media, met de media veranderen elke dag. Wells werden bekleed met verdunde Matrigel oplossing, bereid door toevoeging van 300 ul hESC Matrigel in 25 ml DMEM: F12. 1 ml van deze Matrigel oplossing werd toegevoegd aan elk putje van een zes wei-plaat, en 400 pi aan elk putje toegevoegd van een 12 wei-plaat en men liet laag gedurende 1 uur bij kamertemperatuur. Cellen werden mechanisch gepasseerd bij een splitsingsverhouding van 1:4 door schrapen kolonies eenmaal bereikt tussen 1 en 1,5 mm diameter.
  2. RHMVEC (VEC technologie) werd gehandhaafd in MCDB-131 media met media te veranderen om de andere dag. Cellen werden gesplitst door trypsinebehandeling als 80% confluentie werd bereikt bij een splitsingsverhouding van 1:3. Endotheelcellen tussen doorvoeropeningen 3 en 7 werden gebruikt voor deze studie.

2. Bereiding van de stam Solutions

  1. Activine A werd opgelost bij 50 ug / ml in steriel PBS die 0,1% runderserumalbumine. De oplossing werd in hoeveelheden verdeeld en opgeslagen bij -20 ° C.
  2. EGF werd opgelost in 500 ug / ml in steriel 10 mM azijnzuur. De oplossing werd in hoeveelheden verdeeld en opgeslagen bij -20 ° C.
  3. Insuline is opgelost bij 10 mg / ml door toevoeging aangezuurd H2O (pH ≤ 2) bereid door toevoeging van 0,1 ml ijsazijn 10 ml water.
  4. DApt werd opgelost in DMSO bij 18 mg / ml. Voorts werd verdund tot 300 pM concentratie in DMEM: F12, in hoeveelheden verdeeld en opgeslagen bij -20 ° C.
  5. KAAD-Cyclopamine werd opgelost in DMSO bij 5mg/ml. Er werd verder verdund tot 2 uM concentratie in DMEM: F12, in hoeveelheden verdeeld en opgeslagen bij -20 ° C.
  6. All-trans-retinoïnezuur werd gereconstitueerd met 2,7 mg / ml in 95% ethanol. Er werd verder verdund om 2mM concentratie in DMEM: F12, in hoeveelheden verdeeld en opgeslagen bij -80 ° C.

3. Definitieve Endoderm (DE) en pancreas Progenitor (PP) Inductie

  1. Zodra hESC kolonies bereikt tussen 1 en 1,5 mm diameter, DE inductie uitgevoerd door het toevoegen DMEM: F12 aangevuld met B27, 0,2% BSA, 100 ng / ml Activin A en 1 uM wortmannine 4 dagen (dag 0-Dag 4) met media veranderen elke dag.
  2. Na DE inductie was voltooid, werd de pancreas voorlopercellen inductie opgewekt door het veranderen van de media om DMEM: F12 aangevuld met B27, 0,2% BSA en KAAD-Cyclopamine bij 0,2 uM concentratie voor 24 uur (Dag 4-Dag 5).
  3. Na 24 uur media werd veranderd in DMEM: F12 aangevuld met B27, 0,2% BSA, KAAD-Cyclopamine bij 0,2 uM concentratie en all-trans-retinoïnezuur op 2 uM concentratie voor 3 dagen met de media veranderen elke dag (Dag 5-Dag 8) .

4. Alvleesklier Rijping

  1. Na PP inductie werden alle groepen gewijzigd rijping uit samengesteld DMEM: F12 aangevuld met B27, 0,2% BSA, 10 mM nicotinamide, 25 ug / ml insuline, 30 nM Na 2 SeO 3 en 50 ug / ml transferrine 2 degen met media veranderen elke dag (Dag 8-Day 10).
  2. Na 2 dagen in rijping media, wordt de definitieve rijping stap parallel uitgevoerd met behulp van verschillende voorwaarden voor een vergelijking. Differentiatie werd geïnduceerd onder de volgende voorwaarden: (i) met uitsparing inhibitor dApt (ii) door middel van co-cultuurmedia zonder enige endotheelcellen als controle en (iii) met contact co-kweek met RHMVEC cellen. De cellen werden gehandhaafd in dApt of co-voedingsbodems voor een week (Dag 10-daagse 17) met de media te veranderen elke dag.
    1. DApt media werd voorbereid door aanvulling van de rijping media met 30 uM dApt. Cellen in deze groepen eerst blootgesteld aan MCDB131 voltooien 24 uur en vervolgens blootgesteld aan dApt media gedurende 6 dagen (Dag 11 Dag-17).
    2. Co-cultuurmedia werd bereid door toevoeging MCDB 131 media B27, 0,2% BSA, 10 mM nicotinamide, 10 ng / ml EGF, 1 pg / ml hydrocortison, 10 mg EndoGro, 90 ug / ml heparine. Voor de controle op de toestand van de differentiërende cellen werden blootgesteldaan MCDB 131 compleet medium gedurende 24 uur (Dag 10 Dag-11), waarna het medium werd co-cultuurmedia veranderd 6 dagen (Dag 11 Dag 17) (geen endotheelcellen).
    3. Voor contact co-cultuur staat, is een miljoen RHMVEC toegevoegd aan de differentiërende cellen in volledige MCDB-131 media (VEC technologieën) voor 24 uur (Dag 10-daagse 11) naar bijlage toe te staan. Na 24 uur media werd veranderd in co-cultuur media voor 6 dagen (Dag 11-Day 17) met de media te veranderen elke dag.

5. qRT-PCR analyse

  1. Aan het einde van elk stadium van differentiatie (endoderm, pancreas progenitor, volwassen eiland) werden gelyseerd en RNA werd geëxtraheerd met NucleoSpin RNA II extractie kit volgens de fabrikant.
  2. RNA kwaliteit werd geanalyseerd door controle RNA absorptie bij 260 nm en 280 nm, gevolgd door RNA met een kwantificering SmartSpec Plus spectrofotometer.
  3. Omgekeerde transcriptie werd uitgevoerd met ImProm II reverse transcriptie kHet volgens de instructies van de fabrikant. Alle reacties werden uitgevoerd met 100 ng RNA.
  4. qRT-PCR werd uitgevoerd met behulp van de Mx3005P QPCR systeem (Agilent) en Brilliant II SYBR Green QPCR master mix volgens de instructies van de fabrikant. De gebruikte primers staan ​​in tabel 1. De initialisatie stap werd uitgevoerd bij 50 ° C gedurende 2 minuten, gevolgd door 95 ° C gedurende 10 minuten. 50 amplificatie cycli uitgevoerd als volgt: 95 ° C gedurende 30 seconden 54 ° C gedurende 30 seconden 72 ° C gedurende 1 minuut.
  5. Voudige verandering van target mRNA expressie dan ongedifferentieerde cellen werd berekend op basis van CT-waarden met behulp van de volgende formules:
    ΔCT (Marker i) = CT (Marker i) - CT (GAPDH)
    Δ ΔCT (Marker i) = ΔCT (Marker i) (Sample) - ΔCT (Marker i) (ongedifferentieerde cellen)
    Relatieve expressie (Marker i) = 2-ΔΔCT(Marker i)

6. Immunocytochemie

  1. Aan het einde van elk stadium van differentiatie (endoderm, pancreas progenitor, rijpe eilandjes) cellen werden gefixeerd in 4% formaldehyde gedurende 15 minuten bij kamertemperatuur.
  2. Gefixeerde cellen werden gepermeabiliseerd met 0,25% Triton X-100 (TX) gedurende 15 minuten.
  3. Niet-specifieke kleuring werd geblokkeerd door incubatie in 10% ezel serum van 0,05% TX gedurende 30 minuten.
  4. Primaire antilichamen incubatie werd overnacht uitgevoerd bij 4 ° C in blockbuffer bij de aanbevolen verdunning antilichaam (zie tabel 1).
  5. Cellen werden gewassen met 0.05% TX driemaal gedurende 5 minuten.
  6. Secundair antilichaam incubatie werd uitgevoerd gedurende een uur bij kamertemperatuur in het donker met geschikte antilichamen verdund in blokkeringsbuffer.
  7. Cellen werden gewassen met 0.05% TX driemaal gedurende 5 minuten.
  8. Nucleaire kleuring werd uitgevoerd door incubatie met Hoescht vlek op 1:1000 verdunning in PBS5 minuten gevolgd door 3 wasbeurten met PBS.
  9. Vaste en gekleurde cellen werden afgebeeld met behulp van Olympus IX81 omgekeerde microscoop en Metamorph imaging software.

7. Representatieve resultaten

Toevoeging van Activin A wortmannine te ongedifferentieerde hESC 4 dagen induceert definitieve endoderm zoals bevestigd door qRT-PCR analyse voor DE markers Sox17, CXCR4 en Foxa2 en immunokleuring voor Sox17 zoals geïllustreerd in figuur 2. Differentiatie de alvleesklier progenitorcellen na toevoeging van cyclopamine en retinoïnezuur werd bevestigd door PCR-qRT van pancreatische progenitor merkers en Immunokleuring voor Pdx1 zoals in figuur 3.

In de laatste fase van differentiatie, contact opnemen met co-cultuur met RHMVEC cellen sterk geïnduceerde opregulatie van insuline tot uitdrukking in de hESC afgeleid pancreas progenitorcellen. De efficiëntie van co-kweek gemedieerde differentiatie geanalyseerd door comparing met controle toestand en met behulp dApt. DApt werd gebruikt als een positieve controle omdat het momenteel de meest gebruikte methoden pancreas rijping te bereiken. Aangezien de co-kweek werd uitgevoerd in een gemodificeerde media aangevuld door factoren ondersteunen endotheelcellen werd extra controle die de media in afwezigheid van endotheelcellen het effect van media differentiatie verifiëren. Details van deze analyse worden in figuur 4.

Figuur 1.
Figuur 1. Meertraps protocol voor differentiatie van hESC in insuline expresserende cellen.

Figuur 2.
Figuur 2. Definitieve endoderm inductie van menselijke embryonale stamcellen. A) qRT-PCR analyse van representatieve DE markers in hESC cellen blootgesteld aan Activin A wortmannine gedurende 4 dagen. Resultaten ar e genormaliseerd met betrekking tot de ongedifferentieerde hESC. B) Sox17 kleuring (groen) en DAPI (blauw) geven de nucleaire expressie van Sox17. Schaal bar: 50 urn.

Figuur 3.
Figuur 3. Pancreas voorlopercellen inductie van de embryonale stamcellen afgeleid endoderm cellen. A) qRT-PCR analyse van de eerste pancreas markers in hESC verkregen endoderm cellen blootgesteld aan cyclopamine en retinoïnezuur 4 dagen na DE inductie. Resultaten genormaliseerd met betrekking tot de ongedifferentieerde hESC. B) Pdx1 kleuring (violet) en DAPI (blauw) geven de nucleaire expressie van Pdx1. Schaal bar: 50 urn.

">

Figuur 4.
Figuur 4. Pancreatic rijping stadium A) qRT-PCR analyse van de pancreas hormonen in hESC na pancreas rijping met dApt, neem dan contact co-cultuur of co-cultuur media (controle). Resultaten genormaliseerd met betrekking tot de ongedifferentieerde hESC. P-waarden verkregen door student t-test. B) Co-cultuur met Dil-Ac-LDL gelabeld RHMVEC (Red) te tonen regio's waar de EC hechten aan de plaat als er lege ruimtes (boven), kunnen andere RHMVEC te vinden in direct contact met de onderscheidende ESC (onder). C) C-peptide (Groen) kleuring voor cellen gemaakt met behulp van co-cultuur-methode. Schaal bar: 12,5 micrometer (Top) en 50 micrometer (Onder) D) immunokleuring van RHMVEC toont geen insuline uitdrukking in de RHMVEC.

Marker Primer1 (5 'naar 3') </ Td> Primer2 (5 'naar 3') Ref
SOX17 CTCTGCCTCCTCCACGAA CAGAATCCAGACCTGCACAA 12
CXCR4 CACCGCATCTGGAGAACCA GCCCATTTCCTCGGTGTAGTT 4
FOXA2 GGAGCGGTGAAGATGGAA TACGTGTTCATGCCGTTCAT 12
PDX1 AAGTCTACCAAAGCTCACGCG GTAGGCGCCGCCTGC 4
PTF1 CATAGAGAACGAAACCACCCTTTGAG GCACGGAGTTTCCTGGACAGAGTTC 12
HLXB9 CACCGCGGGCATGATC ACTTCCCCAGGAGGTTCGA 4
HNF6 TGTGGAAGTGGCTGCAGGA TGTGAAGACCAACCTGGGCT 5
PAX6 CGAATTCTGCAGGTGTCCAA ACAGACCCCCTCGGACAGTAAT 5
NKX6.1 AGACCCACTTTTTCCGGACA CCAACGAATAGGCCAAACGA 5
ISL1 GATCTATGTCACCTCGCAAGG TACAACCACCATTTCACTG 12
Glucagon AGGCAGACCCACTCAGTGA AACAATGGCGACCTCTTCTG 4
INSULINE AAGAGGCCATCAAGCAGATCA CAGGAGGCGCATCCACA 12

Tabel 1. Primers voor qPCR reacties.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Tijdens de pancreas ontwikkeling, waarbij een onderscheid pancreatische cellen zijn in de nabijheid met de endotheelcellen van de aorta, bovendien, pancreas-eilandjes zijn dicht gevasculariseerd voor een snelle uitwisseling van bloed glucose en eilandje hormonen te bevorderen. Gezien deze feiten, is het niet verwonderlijk dat de endotheliale cellen een belangrijke rol in het proces van de alvleesklier organogenese te spelen. Het belang van endotheelcellen in pancreas ontwikkeling steeds gewaardeerd, wordt de rol in vitro differentiatie van embryonale cellen minder onderzocht. In ons vorige verslag hebben we de positieve rol van endotheelcellen op de alvleesklier rijping van muis embryonale stamcellen 13. In de huidige studie onderzoeken we het effect van endotheelcellen signalering op het onderscheiden van menselijke embryonale stamcellen.

Meerdere endotheelcellen werden in dit protocol, die resulteerde in gelijkaardige totale effect although met variaties van de efficiëntie van differentiatie. In het huidige rapport presenteren we het effect van co-kweken van hESC afgeleide pancreas voorlopercellen met rattenhart microvasculaire endotheelcellen (RHMVEC). Endotheelcellen kan geschikt worden gevisualiseerd door AC-LDL kleuring, die specifiek slechts endotheelcellen. Co-cultuur van de differentiërende SER met vooraf gekleurde endotheelcellen is gebleken dat het merendeel van de endotheelcellen waren levensvatbaar in kweek gedurende langere tijd geleidelijk RHMEV verdwijnt na 4 dagen niet meer worden waargenomen na 6 dagen rijping. Afwezigheid van de RHMVEC vereenvoudigt de analyse door het elimineren van de noodzaak voor het sorteren, dus werd gekozen voor optimalisatie van de co-cultuur protocol.

Terwijl de huidige studie geeft duidelijk aan het positieve effect van de endotheelcellen in het induceren van de alvleesklier rijping, het exacte mechanisme van deze inductie is nog onbekend en wordt momenteel onderzocht in ons laboratorium. Een few plausibele mechanismen zou kunnen zijn (i) het effect van cel-afgescheiden moleculen (ii) endotheelcellen gemedieerde remming van de inkeping signalering (iii) de rol van extracellulaire matrix uitgescheiden door de endotheelcellen. Terwijl de eerste categorie niet nodig cel-cel contact dergelijk contact is verplicht voor de tweede en derde categorie. Vandaar dat we enkele voorlopige analyses uitgevoerd met behulp van verschillende co-cultuur configuraties: (i) contact co-cultuur (ii) transwell co-cultuur en (iii) geconditioneerde media cultuur. Er werd waargenomen dat co-kweek contact geleid maximale differentiatie, beoordeeld door insuline expressie, gevolgd door transwell co-cultuur, terwijl geconditioneerde media cultuur resulteerde in een minimaal effect op insuline uitdrukking (gegevens niet getoond). Deze analyses geven aan dat terwijl de cel-cel contact is belangrijk, er misschien een paar korte duur uitgescheiden moleculen die van belang zijn ook.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Wij hebben niets te onthullen.

Acknowledgements

Wij erkennen de steun van NIH New Innovator Award DP2 116520 en ORAU Ralph Powe Junior Faculteit Enhancement Award.

Materials

Name Company Catalog Number Comments
mTeSR1 (with supplement) Stem Cell Technologies 5850
hESC qualified matrigel BD Biosciences 354277
DMEM:F12 Invitrogen 11330-032
MCDB-131 Invitrogen 10372019
MCDB-131 (Complete) VEC Technologies MCDB-131
B27 Supplement Invitrogen 17504044
Activin A R&D Systems 338-AC 100ng/ml
Wortmannin Invitrogen W3144 1μM
KAAD-Cyclopamie Sigma-Aldrich C4116 0.2μM
All-Trans Retinoic Acid Sigma-Aldrich R2625 2μM
DAPT Sigma-Aldrich D5942 30μM
Nicotinamide Sigma-Aldrich N0636 10 mM
Sodium Selenite Sigma-Aldrich S5261 30 nM
Insulin Sigma-Aldrich I1882 25 μg/ml
Transferrin Sigma-Aldrich T8158 50 μg/ml
EGF R&D Systems 236-EG 10ng/ml
EndoGro VEC Technologies ENDOGRO 10mg
Heparin Sigma-Aldrich H3149 90μg/ml
Hydrocortisone Sigma-Aldrich H0888 1μg/ml
NucleoSpin RNA II Macherey-Nagel 740955
ImProm II reverse transcription System Promega Corp. A3800
Brilliant II SYBR Green QPCR master mix Stratagene, Agilent Technologies 600548
Sox17 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-17355 1/500
PDX1 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-14662 1/500
C-Peptide Rabbit polyclonal Cell Signaling Technology 4593 1/500
Alexa Fluor 488 donkey anti-rabbit IgG Invitrogen A-21206 1/1000
Alexa Fluor 647 donkey anti-goat IgG Invitrogen A-21447 1/1000
Table 2. Reagents and Kits

DOWNLOAD MATERIALS LIST

References

  1. De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain á la médecine régénératrice de demain. Gynécologie Obstétrique & Fertilité. 37, 620-626 (2009).
  2. Murtaugh, L. C., Melton, D. A. Genes, Signals, and Lineages in Pancreas Development. Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).
  3. Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. Development of definitive endoderm from embryonic stem cells in culture. Development. 131, 1651-1662 (2004).
  4. D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat. Biotech. 24, 1392-1401 (2006).
  5. Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells. Cell Res. 19, 429-438 (2009).
  6. Basma, H., Soto-Gutiérrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes. Gastroenterology. 136, 990-999 (2009).
  7. Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -P., Chipperfield, H., Tan, E. -K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage. Stem Cells and Development. 16, 561-578 (2007).
  8. Kim, S. K., Melton, D. A. Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor. Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).
  9. Docherty, K. Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus. Current Opinion in Pharmacology. 1, 641-649 (2001).
  10. Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., Fässler, R., Gu, G., Gerber, H. -P., Ferrara, N., Melton, D. A. The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]> Cell Proliferation. Developmental Cell. 10, 397-405 (2006).
  11. Yoshitomi, H., Zaret, K. S. Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a. Development. 131, 807-817 (2004).
  12. Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. Marked differences in differentiation propensity among human embryonic stem cell lines. Nat. Biotech. 26, 313-315 (2008).
  13. Banerjee, I., Sharma, N., Yarmush, M. Impact of co-culture on pancreatic differentiation of embryonic stem cells. J. Tissue Eng. Regen. Med. 5, 313-323 (2010).

Comments

2 Comments

  1. good

    Reply
    Posted by: Zhongchun S.
    July 20, 2012 - 2:15 AM
  2. Dear Maria Jaramillo

    I am a student of the licencientura in biotechnology in the Universidad Argentina de la Empresa.
    I am currently studying the cell cultures, researching on the internet I find interesting the abstract, I would like to know if it is possible for me to send the paper by email please.
    thanks and greetings


    Ana Clara López Novo
    Matter cell cultures
    Department of biotechnology and food technology
    Faculty of engineering and Sciences
    Universidad Argentina de la Empresa
    Lima 717 (C1073AAO)
    Ciudad Autónoma de Buenos Aires
    Email: anaclaralopeznovo@gmail.com

    Reply
    Posted by: Ana L.
    May 6, 2013 - 10:24 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics