Endothelial Cell Co-Kultur Vermittelt Reifung von humanen embryonalen Stammzellen zu Pankreas-Insulin-produzierenden Zellen in einer gerichteten Differenzierung Ansatz

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Die aktuelle Studie beschreibt eine gerichtete Differenzierung Ansatz bei der Induktion von Pankreas-Differenzierung von humanen embryonalen Stammzellen. Von großer Bedeutung ist der Befund, dass Endothelzellen Co-Kultur vermittelt Reifung von humanen embryonalen Stammzellen abgeleiteten Pankreas-Vorläuferzellen in Insulin exprimierenden Zellen.

Cite this Article

Copy Citation | Download Citations

Jaramillo, M., Banerjee, I. Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach. J. Vis. Exp. (61), e3759, doi:10.3791/3759 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Embryonale Stammzellen (ESC) haben zwei wesentliche Eigenschaften: Sie können unbegrenzt in vitro vermehrt in einem undifferenzierten Zustand und sie sind pluripotent, somit die Möglichkeit besteht, sich in verschiedene Linien zu differenzieren. Solche Eigenschaften machen WSR äußerst attraktiv für die Zell-basierte Therapie und regenerative Behandlung Anwendungen ein. Jedoch für das volle Potenzial realisiert werden die Zellen zu reifen und funktionellen Phänotypen, die eine schwierige Aufgabe ist unterschieden werden. Ein vielversprechender Ansatz bei der Induktion der zellulären Differenzierung ist es, genau imitieren den Pfad der Organogenese in der In-vitro-Einstellung. Pankreas-Entwicklung ist bekannt, dass in bestimmten Stufen 2 auftreten, beginnend mit Entoderm, die in mehrere Organe, einschließlich Leber und Bauchspeicheldrüse entwickeln können. Endoderm Induktion durch Modulation des Knotenkörpers Weg durch Zugabe von Activin A 3 in Kombination mit mehreren Wachstumsfaktoren 4-7 erreicht werden in vitro durch Zugabe von Cyclopamin 8 erreicht werden. Pankreas-Reifung wird durch mehrere parallele Ereignisse einschließlich der Hemmung der Notch-vermittelt; Aggregation von Pankreas-Vorläuferzellen in 3-dimensionale Cluster; Induktion der Vaskularisierung; um einige zu nennen. Mit Abstand das erfolgreichste in-vitro-Reifung der ESC abgeleiteten Pankreas-Vorläuferzellen wurden durch Hemmung der Notch-Signalweg durch DAPT Supplementierung 9 erreicht worden. Obwohl erfolgreich, führt dies zu geringen Ausbeute des reifen Phänotyp mit eingeschränkter Funktionalität. Ein weniger erforschtes Gebiet ist die Wirkung von Endothelzellen Signalgebung in der Bauchspeicheldrüse Reifung, die zunehmend als wichtiger Faktor in In-vivo-Inselzellen der Bauchspeicheldrüse Reifung 10,11 geschätzt.

Die aktuelle Studie untersucht, wie Wirkung von Endothelial Zellsignalen in Reifung menschlicher ESC abgeleiteten Pankreas-Vorläuferzellen in Insulin produzierenden Inselzellen-Zellen. Wir berichten über einen mehrstufigen gerichtete Differenzierung Protokoll, bei dem die menschlichen WSR zuerst in Richtung Endoderm von Activin A zusammen mit der Hemmung der PI3K induziert. Pancreatic Spezifikation von Entoderm-Zellen wird durch Hemmung der Sonic-Hedgehog-Signalgebung durch Cyclopamin zusammen mit Retinoid-Induktion durch Zugabe von Retinsäure erzielt. Die letzte Stufe der Reifung wird durch Endothelzellen Signalisierung durch eine Co-Kultur-Konfiguration erreicht induziert. Während mehrere Endothelzellen in der Co-Kultur getestet worden, hier präsentieren wir unsere Daten mit Ratten-Herzen mikrovaskulären Endothelzellen (RHMVEC), vor allem für die Analyse erleichtern.

Protocol

1. Zell-Wartung

  1. H1 hESC (WiCell) wurden an menschlichen embryonalen Stammzellen qualifizierte Matrigel beschichteten Wells mit mTeSR1 Medien gepflegt, mit Medien täglich ändern. F12: Die Vertiefungen wurden mit verdünnter Matrigel Lösung, durch Zugabe von 300 ul hESC Matrigel in 25 ml DMEM beschichtet. 1 ml dieser Lösung wurde Matrigel in jede Vertiefung einer Platte mit sechs Vertiefungen gegeben, oder 400 ul in jede Vertiefung einer 12-Well-Platte und man ließ die Beschichtung 1 Stunde bei Raumtemperatur. Die Zellen wurden mechanisch mit einer Split-Verhältnis von 1:4 durch Abkratzen Kolonien, wenn sie zwischen 1 und 1,5 mm im Durchmesser erreicht passagiert.
  2. RHMVEC (VEC-Technologien) wurde im MCDB-131 Medien mit Medien verändern jeden zweiten Tag gepflegt. Die Zellen wurden durch Trypsinisierung aufgeteilt einmal 80% Konfluenz in einem Teilungsverhältnis von 1:3 erreicht wurde. Endothelzellen zwischen den Kanälen 3 und 7 wurden für diese Studie verwendet.

2. Herstellung von Stammlösungen

  1. Activin A wurde bei 50 pg / ml in sterilem P rekonstituiertBS, enthaltend 0,1% Rinderserumalbumin. Die Lösung wurde aliquotiert und bei -20 ° C gelagert
  2. EGF wurde bei 500 pg / ml in sterilem 10 mM Essigsäure rekonstituiert. Die Lösung wurde aliquotiert und bei -20 ° C gelagert
  3. Insulin wurde mit 10 mg / ml mit indem angesäuert H 2 O (pH-Wert ≤ 2), durch Zugabe von 0,1 ml Eisessig zu 10 ml Wasser hergestellt rekonstituiert.
  4. DAPT wurde in DMSO bei 18 mg / ml rekonstituiert. Es wurde weiter auf 300 pM Konzentration in DMEM verdünnt: F12, aliquotiert und bei -20 ° C
  5. KAAD-Cyclopamin wurde in DMSO bei 5mg/ml rekonstituiert. Es wurde weiter auf 2 pM Konzentration in DMEM verdünnt: F12, aliquotiert und bei -20 ° C
  6. All-trans-Retinsäure wurde mit 2,7 mg / ml in 95% Ethanol rekonstituiert. Ferner wurde auf 2 mM Konzentration in DMEM verdünnt: F12, aliquotiert und bei -80 ° C

3. Definitive Endoderm (DE) und Pankreas-Vorläuferzellen (PP) Induction

  1. Einmal hESC Kolonien erreicht zwischen 1 und 1,5 mm im Durchmesser, wurde DE Induktion mit indem DMEM durchgeführt: F12 mit B27, 0,2% BSA, 100 ng / ml Activin A und 1 nM Wortmannin für 4 Tage (Tag 0-Tag 4) mit Medien ergänzt täglich ändern.
  2. Nach DE Induktion beendet war, wurde Pankreas-Vorläuferzellen Induktion durch Veränderung der Medien zu DMEM induziert: F12 mit B27, 0,2% BSA und KAAD-Cyclopamin bei 0,2 pM Konzentration für 24 Stunden (Tag 4-Tage-5) ergänzt.
  3. Nach 24 Stunden wurde auf Medien DMEM geändert: F12 ergänzt mit B27, 0,2% BSA, KAAD-Cyclopamin bei 0,2 pM Konzentration und all-trans-Retinsäure auf 2 pM Konzentration für 3 Tage mit den Medien jeden Tag ändern (Tag 5-Tages-8) .

4. Pankreas-Reifung

  1. Nach PP Induktion wurden alle Gruppen zur Reifung Medien aus DMEM geändert: F12 mit B27, 0,2% BSA, 10 mM Nicotinamid, 25 ug / ml Insulin, 30 nM Na 2 SeO 3 und 50 pg / ml Transferrin für 2 d ergänztays mit Medien jeden Tag ändern (Tag 8-Tag 10).
  2. Nach 2 Tagen in Medien Reifung wird die endgültige Reifung Schritt aus parallel unter Verwendung von verschiedenen Bedingungen zum Vergleich durchgeführt. (I) der Kerbe Inhibitor DAPT (ii) unter Verwendung von Co-Kulturmedium nur ohne endothelialen Zellen als Kontrolle und (iii) mit Kontakt Co-Kultur mit RHMVEC Zellen: Die Differenzierung wurde unter den folgenden Bedingungen induziert. Die Zellen wurden in DAPT oder Co-Kultur-Medien für eine Woche aufrecht erhalten (Tag 10-Tage-17) mit den Medien täglich ändern.
    1. DAPT Medien wurde durch eine Ergänzung der Reifung Medien mit 30 uM DAPT vorbereitet. Die Zellen in dieser Gruppe wurden zunächst ausgesetzt MCDB131 für 24 Stunden abzuschließen und dann zu DAPT Medien ausgesetzt für 6 Tage (Tag 11-Tage-17).
    2. Co-Kulturmedium wurde durch Hinzufügung MCDB-131 hergestellt Medien mit B27, 0,2% BSA, 10 mM Nicotinamid, 10 ng / ml EGF, 1 pg / ml Hydrocortison, 10 mg EndoGro, 90 ug / ml Heparin. Für die media control Zustand differenzierenden Zellen ausgesetzt waren,um MCDB-131 vollständig Weg für 24 Stunden (Tag 10-Tage-11), nach der die Medien, um die Zusammenarbeit Kulturmedien für 6 Tage (Tag 11-Tag 17) (keine Endothelzellen) geändert wurde.
    3. Für den Kontakt Co-Kultur Bedingungen wurde eine Million RHMVEC den differenzierenden Zellen in völliger MCDB-131 Medien (VEC Technologien) für 24 Stunden (Tag 10-Tage-11) zugegeben, um die Befestigung zu ermöglichen. Nach 24 Stunden wurde auf Medien Co-Kultur-Medien für 6 Tage (Tag 11-Tage-17) mit den Medien verändert sich täglich ändern.

5. qRT-PCR-Analyse

  1. Am Ende jeder Phase der Differenzierung (Endoderm, Pankreas-Vorläuferzellen, reife Insel) wurden lysiert und RNA wurde unter Verwendung NucleoSpin RNA II-Extraktions-Kits nach den Anweisungen des Herstellers.
  2. RNA-Qualität wurde durch Prüfen RNA Absorption bei 260 nm und 280 nm, gefolgt von RNA-Quantifizierung unter Verwendung eines SmartSpec Zzgl. Spektrophotometer analysiert.
  3. Die reverse Transkription wurde unter Verwendung ImProm II reverse Transkription kes nach den Anweisungen des Herstellers. Alle Reaktionen wurden mit 100 ng RNA durchgeführt.
  4. qRT-PCR erfolgte unter Verwendung des Mx3005P QPCR System (Agilent) und Brilliant II SYBR Green qPCR Master Mix nach Anweisungen des Herstellers. Die verwendeten Primer sind in Tabelle 1 aufgelistet. Die Initialisierung Schritt wurde bei 50 ° C für 2 Minuten bei 95 ° C für 10 Minuten. 50 Amplifikationszyklen wurden wie folgt durchgeführt: 95 ° C für 30 Sekunden, 54 ° C für 30 Sekunden und 72 ° C für 1 Minute.
  5. Fache Änderung der Ziel-mRNA-Expression in undifferenzierten Zellen wurde aus CT-Werte nach folgenden Formeln berechnet:
    ΔCT (Markierung i) = CT (Markierung I) - CT (GAPDH)
    Δ ΔCT (Markierung i) = ΔCT (Markierung i) (Sample) - ΔCT (Markierung i) (undifferenzierte Zellen)
    Relativen Expression (Markierung i) = 2-ΔΔCT(Marker-i)

6. Immunzytochemie

  1. Am Ende jeder Phase der Differenzierung (Endoderm, Pankreas-Vorläuferzellen, reife Insel-Zellen) wurden in 4% Formaldehyd für 15 Minuten bei Raumtemperatur fixiert.
  2. Die fixierten Zellen wurden permeabilisiert mit 0,25% Triton X-100 (TX) für 15 Minuten.
  3. Nicht-spezifische Färbung wurde durch Inkubation in 10% Eselserum in 0,05% für 30 Minuten blockiert TX.
  4. Der primäre Antikörper Inkubation wurde über Nacht bei 4 ° C in Blocking-Puffer in der empfohlenen Antikörper-Verdünnung (siehe Tabelle 1).
  5. Die Zellen wurden mit 0,05% TX dreimal für 5 Minuten gewaschen.
  6. Sekundäre Antikörper-Inkubation wurde für eine Stunde bei Raumtemperatur im Dunkeln mit geeigneten Antikörpern in Blocking-Puffer verdünnt durchgeführt.
  7. Die Zellen wurden mit 0,05% TX dreimal für 5 Minuten gewaschen.
  8. Kernfärbung wurde durch Inkubation mit Hoechst durchgeführt Tinte in einer Verdünnung von 1:1000 in PBSfür 5 Minuten mit 3 Waschschritten mit PBS.
  9. Fixierten und gefärbten Zellen wurden aufgenommen mit Olympus IX81 inversen Mikroskop und Metamorph Imaging-Software.

7. Repräsentative Ergebnisse

Die Zugabe von Activin A und Wortmannin undifferenzierte HES für 4 Tage induziert endgültigen Endoderm durch qRT-PCR-Analyse für DE Marker Sox17, CXCR4, und Foxa2 bestätigt und Immunfärbung auf Sox17 wie in 2 dargestellt. Abgrenzung zu Pankreas-Vorläuferzellen nach Zugabe von Cyclopamin und Retinsäure wurde durch qRT-PCR von Pankreas-Vorläuferzellen Marker und Immunfärbung für Pdx1 wie in 3 dargestellt bestätigt.

In der letzten Stufe der Differenzierung, wenden Sie sich Co-Kultur mit RHMVEC Zellen stark induziert Hochregulierung der Insulin-Expression in den humanen embryonalen Stammzellen abgeleiteten Pankreas-Vorläuferzellen. Die Effizienz der Co-Kultur vermittelten Differenzierung wurde durch die gleichzeitige Analysemparing mit Kontrollbedingung mit DAPT. DAPT wurde als positive Kontrolle verwendet, da es derzeit eine der am häufigsten verwendeten Verfahren zur Reifung Pankreas zu erreichen. Da die Co-Kultur in einem modifizierten Medienstroms durch Faktoren unterstützt Endothelzellen ergänzt durchgeführt wurde, wurde zusätzliches Steuerelement mit den Medien in Abwesenheit von Endothelzellen, um die Wirkung von Medien auf die Differenzierung zu verifizieren. Details zu dieser Analyse sind in Abbildung 4 dargestellt.

Abbildung 1.
Abbildung 1. Mehrstufige Protokoll für die Differenzierung von hES in Insulin exprimierenden Zellen.

Abbildung 2.
2. Definitive Endoderm Induktion von humanen embryonalen Stammzellen. A) qRT-PCR-Analyse der repräsentativen DE Marker in HES Zellen, die A und Wortmannin für 4 Tage Activin. Ergebnisse ar e, bezogen auf undifferenzierte HES normalisiert. B) Sox17 Färbung (grün) und DAPI (blau) zeigen nukleare Expression von Sox17. Maßstab: 50 um.

Abbildung 3.
Abbildung 3. Pankreas-Vorläuferzellen Induktion des embryonalen Stammzellen abgeleitet Entodermzellen. A) qRT-PCR-Analyse der frühen Pankreas-Marker im HES abgeleitet Entodermzellen ausgesetzt Cyclopamin und Retinsäure für 4 Tage nach der DE Induktion. Die in Bezug auf undifferenzierte HES normalisiert. B) Pdx1 Färbung (violett) und DAPI (blau) zeigen nukleare Expression von Pdx1. Maßstab: 50 um.

">

Abbildung 4.
Abbildung 4. Pancreatic Reifung Stufe A) qRT-PCR-Analyse von Pankreas-Hormone im menschlichen embryonalen Stammzellen nach Pankreas-Reifung mit DAPT, wenden Sie sich Co-Kultur-oder Co-Kultur-Medien (Kontrolle). Die in Bezug auf undifferenzierte HES normalisiert. p erhaltenen Werte von Student t-Tests. B) Co-Kultur mit Dil-Ac-LDL beschriftet RHMVEC (Rot) zeigen Regionen, in denen ECs auf den Teller legen, wenn es leere Räume (oben) sind, können andere RHMVEC in direkten Kontakt mit der differenzierenden ESC (unten) zu finden. C) C-Peptid (grün) Färbung für Zellen differenziert mit Co-Kultur-Methode. Maßstab: 12,5 um (oben) und 50 um (unten) D) Immunfärbung von RHMVEC zeigt kein Insulin Ausdruck in der RHMVEC.

Marker Primer1 (5 'nach 3') </ Td> Primer2 (5 'nach 3') Ref
Sox17 CTCTGCCTCCTCCACGAA CAGAATCCAGACCTGCACAA 12
CXCR4 CACCGCATCTGGAGAACCA GCCCATTTCCTCGGTGTAGTT 4
Foxa2 GGAGCGGTGAAGATGGAA TACGTGTTCATGCCGTTCAT 12
PDX1 AAGTCTACCAAAGCTCACGCG GTAGGCGCCGCCTGC 4
PTF1 CATAGAGAACGAAACCACCCTTTGAG GCACGGAGTTTCCTGGACAGAGTTC 12
HLXB9 CACCGCGGGCATGATC ACTTCCCCAGGAGGTTCGA 4
HNF6 TGTGGAAGTGGCTGCAGGA TGTGAAGACCAACCTGGGCT 5
PAX6 CGAATTCTGCAGGTGTCCAA ACAGACCCCCTCGGACAGTAAT 5
NKX6.1 AGACCCACTTTTTCCGGACA CCAACGAATAGGCCAAACGA 5
Isl1 GATCTATGTCACCTCGCAAGG TACAACCACCATTTCACTG 12
GLUCAGON AGGCAGACCCACTCAGTGA AACAATGGCGACCTCTTCTG 4
INSULIN AAGAGGCCATCAAGCAGATCA CAGGAGGCGCATCCACA 12

Tabelle 1. Primer für die qPCR-Reaktionen verwendet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Während Bauchspeicheldrüsenentwicklung sind Differenzieren Pankreaszellen in unmittelbarer Nähe mit Endothelzellen aus der Aorta, ferner sind Pankreasinseln dicht vaskularisiert raschen Austausch von Blutglukose und Inselhormone zu präsentieren. Angesichts dieser Tatsachen ist es nicht verwunderlich, dass Endothelzellen eine wichtige Rolle im Prozess der Organogenese Pankreas spielen. Während die Bedeutung von Endothelzellen während der Pankreas-Entwicklung wird zunehmend geschätzt wird seine Rolle bei der in vitro Differenzierung von embryonalen Zellen weniger untersucht. In unserem früheren Bericht gründeten wir die positive Rolle der endothelialen Zellen der Bauchspeicheldrüse auf die Reifung von embryonalen Stammzellen der Maus 13. In der aktuellen Studie untersuchen wir die Wirkung von Endothelzellen Signalisierung auf die Differenzierung humaner embryonaler Stammzellen.

Mehrere Endothelzellen in diesem Protokoll verwendet wurden, führte die alle in ähnlicher Gesamteffekt although mit Variationen in der Effizienz der Differenzierung. Im aktuellen Bericht stellen wir die Wirkung von Co-Kultivierung embryonaler Stammzellen abgeleiteten Pankreas-Vorläuferzellen mit Rattenherz mikrovaskulären Endothelzellen (RHMVEC). Endothelzellen können bequem visualisiert AC-LDL-Färbung, die spezifisch für nur Endothelzellen. Co-Kultur der Differenzierung Regler mit vorgefärbten endothelialen Zellen zeigte, dass die meisten der Endothelzellen in Kultur lebensfähigen für längere Zeit, die RHMEV allmählich nach 4 Tagen nach der Impfung und nicht mehr nach 6 Tagen der Reifung nachgewiesen werden. Die Abwesenheit des RHMVEC vereinfacht die Analyse, indem die Notwendigkeit für die Sortierung, daher wurde für die Optimierung der Co-Kultur-Protokoll gewählt.

Obwohl die vorliegende Studie zeigt deutlich die positive Wirkung von Endothelzellen in induzierende Pankreas Reifung, ist die genaue Mechanismus dieser Induktion noch unbekannt und wird derzeit in unserem Labor untersucht. Ein Few plausible Mechanismen könnten (i) die Wirkung von Zell-Moleküle sezerniert (ii) Endothel-Zell-vermittelte Inhibition der Notch-Signalweg (iii) die Rolle der extrazellulären Matrix von den Endothelzellen sezerniert. Während die erste Kategorie nicht erforderlich ist Zell-Zell-Kontakt, ist ein solcher Kontakt notwendig für die zweiten und dritten Kategorie. Daher führten wir einige vorläufige Analyse mit verschiedenen Co-Kultur-Konfigurationen: (i) Kontakt Co-Kultur (ii) Transwell Co-Kultur und (iii) konditionierten Medien Kultur. Es wurde beobachtet, dass der Kontakt Co-Kultur in der maximalen Differenzierung in Folge, wie durch Insulinexpression beurteilt, gefolgt von Transwell Co-Kultur, während konditionierten Medien Kultur zu einer minimalen Wirkung auf Insulin Ausdruck (Daten nicht gezeigt). Diese Analysen zeigen, dass während der Zell-Zell-Kontakt ist wichtig, könnte es einige kurzlebige Moleküle, die abgesondert ebenso wichtig sind.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Wir haben nichts zu offenbaren.

Acknowledgements

Dieses Projekt wurde von NIH New Innovator Award DP2 116520 und ORAU Ralph Powe Junior Faculty Enhancement Award.

Materials

Name Company Catalog Number Comments
mTeSR1 (with supplement) Stem Cell Technologies 5850
hESC qualified matrigel BD Biosciences 354277
DMEM:F12 Invitrogen 11330-032
MCDB-131 Invitrogen 10372019
MCDB-131 (Complete) VEC Technologies MCDB-131
B27 Supplement Invitrogen 17504044
Activin A R&D Systems 338-AC 100ng/ml
Wortmannin Invitrogen W3144 1μM
KAAD-Cyclopamie Sigma-Aldrich C4116 0.2μM
All-Trans Retinoic Acid Sigma-Aldrich R2625 2μM
DAPT Sigma-Aldrich D5942 30μM
Nicotinamide Sigma-Aldrich N0636 10 mM
Sodium Selenite Sigma-Aldrich S5261 30 nM
Insulin Sigma-Aldrich I1882 25 μg/ml
Transferrin Sigma-Aldrich T8158 50 μg/ml
EGF R&D Systems 236-EG 10ng/ml
EndoGro VEC Technologies ENDOGRO 10mg
Heparin Sigma-Aldrich H3149 90μg/ml
Hydrocortisone Sigma-Aldrich H0888 1μg/ml
NucleoSpin RNA II Macherey-Nagel 740955
ImProm II reverse transcription System Promega Corp. A3800
Brilliant II SYBR Green QPCR master mix Stratagene, Agilent Technologies 600548
Sox17 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-17355 1/500
PDX1 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-14662 1/500
C-Peptide Rabbit polyclonal Cell Signaling Technology 4593 1/500
Alexa Fluor 488 donkey anti-rabbit IgG Invitrogen A-21206 1/1000
Alexa Fluor 647 donkey anti-goat IgG Invitrogen A-21447 1/1000
Table 2. Reagents and Kits

DOWNLOAD MATERIALS LIST

References

  1. De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain á la médecine régénératrice de demain. Gynécologie Obstétrique & Fertilité. 37, 620-626 (2009).
  2. Murtaugh, L. C., Melton, D. A. Genes, Signals, and Lineages in Pancreas Development. Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).
  3. Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. Development of definitive endoderm from embryonic stem cells in culture. Development. 131, 1651-1662 (2004).
  4. D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat. Biotech. 24, 1392-1401 (2006).
  5. Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells. Cell Res. 19, 429-438 (2009).
  6. Basma, H., Soto-Gutiérrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes. Gastroenterology. 136, 990-999 (2009).
  7. Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -P., Chipperfield, H., Tan, E. -K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage. Stem Cells and Development. 16, 561-578 (2007).
  8. Kim, S. K., Melton, D. A. Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor. Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).
  9. Docherty, K. Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus. Current Opinion in Pharmacology. 1, 641-649 (2001).
  10. Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., Fässler, R., Gu, G., Gerber, H. -P., Ferrara, N., Melton, D. A. The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]> Cell Proliferation. Developmental Cell. 10, 397-405 (2006).
  11. Yoshitomi, H., Zaret, K. S. Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a. Development. 131, 807-817 (2004).
  12. Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. Marked differences in differentiation propensity among human embryonic stem cell lines. Nat. Biotech. 26, 313-315 (2008).
  13. Banerjee, I., Sharma, N., Yarmush, M. Impact of co-culture on pancreatic differentiation of embryonic stem cells. J. Tissue Eng. Regen. Med. 5, 313-323 (2010).

Comments

2 Comments

  1. good

    Reply
    Posted by: Zhongchun S.
    July 20, 2012 - 2:15 AM
  2. Dear Maria Jaramillo

    I am a student of the licencientura in biotechnology in the Universidad Argentina de la Empresa.
    I am currently studying the cell cultures, researching on the internet I find interesting the abstract, I would like to know if it is possible for me to send the paper by email please.
    thanks and greetings


    Ana Clara López Novo
    Matter cell cultures
    Department of biotechnology and food technology
    Faculty of engineering and Sciences
    Universidad Argentina de la Empresa
    Lima 717 (C1073AAO)
    Ciudad Autónoma de Buenos Aires
    Email: anaclaralopeznovo@gmail.com

    Reply
    Posted by: Ana L.
    May 6, 2013 - 10:24 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics