Endothelial सेल सह संस्कृति मानव भ्रूण की mediates परिपक्वता निर्देशित भेदभाव दृष्टिकोण में अग्नाशय इंसुलिन कोशिकाओं का उत्पादन करने के लिए सेल स्टेम

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

वर्तमान अध्ययन मानव भ्रूण स्टेम कोशिकाओं की अग्नाशय भेदभाव उत्प्रेरण में एक निर्देशित भेदभाव के दृष्टिकोण का वर्णन करता है. महान महत्व का लग रहा है कि endothelial सेल सह संस्कृति मानव भ्रूण स्टेम सेल व्युत्पन्न इंसुलिन व्यक्त कोशिकाओं में अग्नाशय के progenitors की मध्यस्थता परिपक्वता है.

Cite this Article

Copy Citation | Download Citations

Jaramillo, M., Banerjee, I. Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach. J. Vis. Exp. (61), e3759, doi:10.3791/3759 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Protocol

1. सेल रखरखाव

  1. एच 1 hESC (WiCell) hESC योग्य Matrigel लेपित कुओं पर mTeSR1 मीडिया के साथ बनाए रखा गया है, मीडिया के साथ हर दिन बदलते हैं. F12: वेल्स पतला Matrigel समाधान, DMEM की 25 मिलीलीटर में hESC Matrigel के 300 μl जोड़ने के द्वारा तैयार लेपित रहे थे. इस Matrigel समाधान के 1 मिलीग्राम एक छह अच्छी तरह से थाली के प्रत्येक अच्छी तरह से जोड़ा गया, या 400 μl एक 12 अच्छी तरह से थाली के प्रत्येक अच्छी तरह से जोड़ा और कोट करने के लिए कमरे के तापमान पर 1 घंटे के लिए अनुमति दी. कोशिकाओं यंत्रवत् से कालोनियों scraping के एक बार वे और 1 के बीच में व्यास 1.5mm पहुँचे थे 1:04 का एक अलग अनुपात में passaged.
  2. RHMVEC (ज्यादा प्रौद्योगिकियों) MCDB 131 मीडिया में मीडिया हर दूसरे दिन बदलने के साथ बनाए रखा गया था. कोशिकाएं trypsinization द्वारा विभाजित किया गया है एक बार 80% संगम 1:03 का एक अलग अनुपात में पहुँच गया था. मार्ग 3 और 7 के बीच Endothelial कोशिकाओं इस अध्ययन के लिए इस्तेमाल किया गया.

2. स्टॉक समाधान की तैयारी

  1. Activin एक 50 μg / एमएल पर बाँझ पी में पुनर्गठन किया गयाबी एस 0.1% युक्त गोजातीय सीरम albumin. समाधान aliquoted था और -20 डिग्री सेल्सियस पर संग्रहीत
  2. EGF 500 / बाँझ 10 मिमी एसिटिक एसिड में μg एमएल पर पुनर्गठन किया गया. समाधान aliquoted था और -20 डिग्री सेल्सियस पर संग्रहीत
  3. इंसुलिन 10 मिलीग्राम / एमएल acidified एच 2 (पीएच 2 ≤) हे, 0.1 मिलीग्राम ग्लेशियल एसिटिक एसिड के पानी की 10 मिलीलीटर के अलावा द्वारा तैयार जोड़कर पुनर्गठन किया गया था.
  4. DAPT DMSO में 18 मिग्रा / मिली पर पुनर्गठन किया गया था. यह आगे पतला DMEM में 300 माइक्रोन एकाग्रता के लिए किया गया था: F12, aliquoted और -20 डिग्री सेल्सियस पर संग्रहीत
  5. KAAD - cyclopamine DMSO में 5mg/ml में पुनर्गठित किया गया था. यह आगे पतला 2 DMEM में माइक्रोन एकाग्रता के लिए किया गया था: F12, aliquoted और -20 डिग्री सेल्सियस पर संग्रहीत
  6. अखिल पार retinoic एसिड / 95% इथेनॉल में 2.7 मिलीग्राम मिलीग्राम पर पुनर्गठन किया गया था. यह आगे पतला DMEM में 2mm एकाग्रता के लिए किया गया था: F12, aliquoted और -80 डिग्री सेल्सियस पर संग्रहीत

3. निश्चित (डे) अन्तर्जनस्तर और अग्नाशय के पूर्वपुस्र्ष प्रेरण (पीपी)

  1. घंटे एक बारईएससी कालोनियों 1 और व्यास में 1.5mm के बीच पहुँच गए, डे प्रेरण DMEM जोड़ने के द्वारा किया गया था: F12 B27, 0.2% बीएसए, 100 एनजी / एमएल मीडिया के साथ एक और 4 दिनों के लिए 1 माइक्रोन Wortmannin (4 0 दिवस दिवस) Activin साथ पूरक हर दिन बदल जाते हैं.
  2. डे प्रेरण के बाद पूरा किया गया, अग्नाशय के पूर्वज शामिल DMEM करने के लिए बदल रहा है मीडिया द्वारा प्रेरित किया गया था: F12 B27, 0.2% BSA और 24 घंटे के लिए 0.2 माइक्रोन एकाग्रता (दिन 4 5 दिन) पर KAAD cyclopamine साथ पूरक.
  3. 24 घंटे के बाद मीडिया DMEM बदल गया था: B27-F12 के साथ पूरक, बीएसए, 0.2% 0.2 माइक्रोन एकाग्रता और 3 दिनों के लिए 2 माइक्रोन एकाग्रता में सब पार retinoic एसिड मीडिया हर दिन बदल के साथ (5 दिवस दिवस 8) पर KAAD cyclopamine .

4. अग्नाशय परिपक्वता

  1. पीपी प्रेरण के बाद, सभी समूहों परिपक्वता DMEM का बना मीडिया के लिए बदल गया: F12 2 घ के लिए B27, 0.2% बीएसए, 10 मिमी nicotinamide, 25 इंसुलिन / μg मिलीलीटर, 30 एनएम ना 2 3 एसईओ और 50 μg / एमएल transferrin के साथ पूरकमीडिया के साथ ays हर दिन बदल (दिवस 10 8 दिन).
  2. परिपक्वता मीडिया में 2 दिनों के बाद, अंतिम परिपक्वता कदम के बाहर समानांतर तुलना के लिए कई अलग अलग स्थितियों का उपयोग करने में किया जाता है. (I) के पायदान अवरोध करनेवाला DAPT (ii) सह संस्कृति मीडिया का उपयोग केवल, और नियंत्रण के रूप में endothelial कोशिकाओं के बिना (iii) RHMVEC कोशिकाओं के साथ सह संस्कृति से संपर्क का उपयोग कर का उपयोग कर: भेदभाव निम्नलिखित शर्तों के अधीन प्रेरित किया गया था. कोशिकाओं DAPT या सह संस्कृति मीडिया में एक सप्ताह के लिए बनाए रखा गया मीडिया हर दिन बदल के साथ (17 10 दिवस दिवस).
    1. DAPT मीडिया परिपक्वता मीडिया 30 माइक्रोन DAPT के साथ सप्लीमेंट द्वारा तैयार किया गया था. इस समूहों में कोशिकाओं को पहले 24 घंटे के लिए MCDB131 पूरा खुल गए थे और 6 दिनों (दिन में 17 11 दिन) के लिए तो DAPT मीडिया को अवगत कराया.
    2. सह संस्कृति मीडिया के साथ MCDB 131 - मीडिया का सप्लीमेंट द्वारा तैयार किया गया था B27, 0.2% बीएसए, 10 मिमी nicotinamide, 10 एनजी / एमएल EGF, 1 μg / मिलीलीटर hydrocortisone, 10 मिलीग्राम EndoGro, 90 μg / मिलीलीटर हेपरिन. मीडिया नियंत्रण हालत के लिए फर्क कोशिकाओं को अवगत कराया गयाMCDB 131 के 24 घंटे के लिए पूरी मध्यम (11 - 10 दिन दिन) के बाद जो मीडिया 6 (दिन में 17 11 दिन) दिन (कोई endothelial कोशिकाओं) के लिए सह संस्कृति मीडिया के लिए बदल गया था.
    3. संपर्क हालत सह संस्कृति के लिए, मिलियन RHMVEC एक पूरा MCDB 131 मीडिया में फर्क कोशिकाओं (ग्राम शिक्षा समिति प्रौद्योगिकियों) (11 10 दिवस दिवस) 24 घंटे के लिए जोड़ा गया लगाव की अनुमति है. 24 घंटे के बाद मीडिया 6 दिन (दिन में 17 11 दिन) के लिए मीडिया के साथ सह - संस्कृति मीडिया के लिए बदल गया था हर दिन बदल जाते हैं.

5. qRT-पीसीआर विश्लेषण

  1. भेदभाव (, अग्नाशय के पूर्वज, अन्तर्जनस्तर परिपक्व आइलेट) के प्रत्येक चरण के अंत में lysed गया और शाही सेना के निर्माता के निर्देशों के अनुसार द्वितीय NucleoSpin शाही सेना निष्कर्षण किट का उपयोग कर निकाला गया था.
  2. शाही सेना गुणवत्ता 260 एनएम और 280 एनएम में शाही सेना के absorbance के जाँच, आरएनए मात्रा का ठहराव का उपयोग एक SmartSpec प्लस स्पेक्ट्रोफोटोमीटर के बाद से विश्लेषण किया गया था.
  3. रिवर्स प्रतिलेखन ImProm द्वितीय रिवर्स प्रतिलेखन कश्मीर का उपयोग किया गया थायह निर्माता के निर्देशों के अनुसार. सभी प्रतिक्रियाओं शाही सेना के 100 एनजी के साथ प्रदर्शन किया गया.
  4. qRT - पीसीआर निर्माता के निर्देशों के अनुसार Mx3005P qPCR (Agilent है) प्रणाली और बहुत खूब द्वितीय SYBR ग्रीन qPCR मास्टर मिश्रण का उपयोग किया गया था. प्राइमरों का इस्तेमाल किया 1 टेबल पर सूचीबद्ध हैं. ° 2 मिनट के बाद 10 मिनट के लिए 95 ° C के लिए सी आरंभीकरण कदम 50 में किया गया था. 50 प्रवर्धन चक्र के रूप में प्रदर्शन किया गया है: 95 ° C 30 सेकंड के लिए, 54 ° सी के लिए 30 सेकंड और 72 ° C 1 मिनट के लिए.
  5. Undifferentiated कोशिकाओं पर लक्ष्य mRNA अभिव्यक्ति गुना परिवर्तन सीटी निम्न सूत्रों का उपयोग करते हुए मानों से गणना की गई है:
    ΔCT (मार्कर मैं) = सीटी (मार्कर मैं) - सीटी (GAPDH)
    Δ ΔCT (मार्कर मैं) = ΔCT, मैं मार्कर (नमूना) - ΔCT मैं मार्कर (undifferentiated कोशिकाओं)
    सापेक्ष अभिव्यक्ति (मार्कर मैं) = 2 - ΔΔCT(मैं मार्कर)

6. Immunocytochemistry

  1. भेदभाव (, अग्नाशय के पूर्वज, अन्तर्जनस्तर परिपक्व आइलेट) के प्रत्येक चरण के अंत में कोशिकाओं 4% formaldehyde में कमरे के तापमान पर 15 मिनट के लिए निर्धारित किए गए.
  2. निश्चित कोशिकाओं 0.25% का उपयोग कर ट्राइटन (TX) एक्स 15 मिनट के लिए 100 permeabilized गया.
  3. गैर विशिष्ट धुंधला ऊष्मायन द्वारा 10% गधा सीरम में 0.05% 30 मिनट के लिए TX में अवरुद्ध किया गया था.
  4. प्राथमिक एंटीबॉडी ऊष्मायन रात 4 बजे किया गया था ° सिफारिश प्रतिरक्षी मन्दन (देखें तालिका 1) में बफर को रोकने में सी.
  5. कोशिकाओं 5 मिनट के लिए 0.05% TX तीन बार के साथ धोया गया.
  6. माध्यमिक एंटीबॉडी ऊष्मायन के एक घंटे के लिए कमरे के तापमान पर उचित अवरुद्ध बफर में पतला एंटीबॉडी के साथ अंधेरे में प्रदर्शन किया गया था.
  7. कोशिकाओं 5 मिनट के लिए 0.05% TX तीन बार के साथ धोया गया.
  8. परमाणु धुंधला ऊष्मायन द्वारा Hoescht के साथ प्रदर्शन किया था पीबीएस में 1:1000 कमजोर पड़ने पर दागपीबीएस के साथ 3 washes के द्वारा पीछा किया 5 मिनट के लिए.
  9. फिक्स्ड और दाग कोशिकाओं ओलिंप IX81 उलटा माइक्रोस्कोप और Metamorph इमेजिंग सॉफ्टवेयर का उपयोग imaged थे.

7. प्रतिनिधि परिणाम

इसके अलावा Activin के एक और undifferentiated hESC 4 दिनों के लिए के लिए Wortmannin निश्चित अन्तर्जनस्तर लाती रूप डे Sox17 मार्करों, CXCR4, और Foxa2 के लिए qRT-पीसीआर विश्लेषण द्वारा की पुष्टि की और Sox17 के लिए Immunostaining के रूप में चित्रा 2 में सचित्र. Cyclopamine और retinoic एसिड के अलावा के बाद अग्नाशय के पूर्वपुस्र्ष कोशिकाओं भेदभाव अग्नाशय के पूर्वज मार्करों और Pdx1 के लिए Immunostaining के रूप में चित्रा 3 में सचित्र qRT-पीसीआर द्वारा पुष्टि की गई.

भेदभाव के अंतिम चरण में, दृढ़ता से प्रेरित hESC व्युत्पन्न अग्नाशय के पूर्वपुस्र्ष कोशिकाओं में इंसुलिन अभिव्यक्ति की upregulation RHMVEC कोशिकाओं के साथ सह संस्कृति संपर्क के. सह संस्कृति मध्यस्थता भेदभाव की दक्षता सह द्वारा विश्लेषण किया गया थाहालत नियंत्रण DAPT का उपयोग के साथ mparing. DAPT एक सकारात्मक नियंत्रण के रूप में इस्तेमाल किया गया था क्योंकि यह वर्तमान में सबसे व्यापक रूप से इस्तेमाल किया अग्नाशय परिपक्वता को प्राप्त करने के तरीकों में से एक है. के बाद से सह संस्कृति एक संशोधित endothelial कोशिकाओं का समर्थन कारकों द्वारा पूरक मीडिया में प्रदर्शन किया गया था, अतिरिक्त नियंत्रण मीडिया के साथ भेदभाव पर मीडिया के प्रभाव को सत्यापित endothelial कोशिकाओं के अभाव में किया गया था. चित्रा 4 में इस विश्लेषण का विवरण प्रस्तुत कर रहे हैं.

आकृति 1.
चित्रा 1 hESC इंसुलिन व्यक्त कोशिकाओं में भेदभाव के लिए बहु चरण प्रोटोकॉल.

चित्रा 2.
चित्रा 2 मानव भ्रूण स्टेम कोशिकाओं की निश्चित अन्तर्जनस्तर प्रेरण. ए) प्रतिनिधि hESC 4 दिनों के लिए एक और Wortmannin Activin उजागर कोशिकाओं में डे मार्करों के qRT-पीसीआर विश्लेषण. परिणाम की गिरफ्तारी ई undifferentiated hESC के लिए सम्मान के साथ सामान्य. बी) Sox17 (ग्रीन) धुंधला और DAPI (नीला) Sox17 की परमाणु अभिव्यक्ति दिखा. पैमाने पर पट्टी: 50 माइक्रोन.

चित्रा 3.
चित्रा की भ्रूण स्टेम व्युत्पन्न सेल अन्तर्जनस्तर कोशिकाओं के अग्नाशय के 3. पूर्वज प्रेरण. ए) hESC व्युत्पन्न अन्तर्जनस्तर डे अधिष्ठापन के बाद 4 दिनों के लिए cyclopamine और retinoic एसिड के संपर्क में कोशिकाओं में जल्दी अग्नाशय मार्करों के qRT-पीसीआर विश्लेषण. Undifferentiated hESC के लिए सम्मान के साथ सामान्य परिणाम. बी) Pdx1 (बैंगनी) धुंधला और DAPI (नीला) Pdx1 की परमाणु अभिव्यक्ति दिखा. पैमाने पर पट्टी: 50 माइक्रोन.

">

चित्रा 4.
चित्रा 4 अग्नाशय परिपक्वता मंच. ए) hESC में अग्नाशय हार्मोन के qRT-पीसीआर विश्लेषण DAPT का उपयोग अग्नाशय परिपक्वता के बाद, सह संस्कृति या सह संस्कृति मीडिया (नियंत्रण) से संपर्क करें. Undifferentiated hESC के लिए सम्मान के साथ सामान्य परिणाम. पी मूल्यों टी परीक्षण छात्र द्वारा प्राप्त. बी) दिल एसी एलडीएल RHMVEC लेबल (लाल) के साथ सह - संस्कृति क्षेत्रों में जहां ईसीएस थाली करने के लिए देते हैं अगर वहाँ खाली स्थान (ऊपर) हैं, अन्य RHMVEC फर्क ईएससी (नीचे) के साथ सीधे संपर्क में पाया जा सकता है. सी) सी पेप्टाइड सह संस्कृति विधि का उपयोग कर विभेदित कोशिकाओं के लिए धुंधला हो जाना (ग्रीन). पैमाने पर पट्टी: 12.5 (शीर्ष) माइक्रोन और 50 माइक्रोन (नीचे) डी) RHMVEC की Immunostaining के RHMVEC में कोई इंसुलिन अभिव्यक्ति को दर्शाता है.

मार्कर Primer1 (5 '3') </ P> Primer2 (5 '3') रेफरी
SOX17 CTCTGCCTCCTCCACGAA CAGAATCCAGACCTGCACAA 12
CXCR4 CACCGCATCTGGAGAACCA GCCCATTTCCTCGGTGTAGTT 4
FOXA2 GGAGCGGTGAAGATGGAA TACGTGTTCATGCCGTTCAT 12
PDX1 AAGTCTACCAAAGCTCACGCG GTAGGCGCCGCCTGC 4
PTF1 CATAGAGAACGAAACCACCCTTTGAG GCACGGAGTTTCCTGGACAGAGTTC 12
HLXB9 CACCGCGGGCATGATC ACTTCCCCAGGAGGTTCGA 4
HNF6 TGTGGAAGTGGCTGCAGGA TGTGAAGACCAACCTGGGCT 5
PAX6 CGAATTCTGCAGGTGTCCAA ACAGACCCCCTCGGACAGTAAT 5
NKX6.1 AGACCCACTTTTTCCGGACA CCAACGAATAGGCCAAACGA 5
ISL1 GATCTATGTCACCTCGCAAGG TACAACCACCATTTCACTG 12
ग्लूकागन AGGCAGACCCACTCAGTGA AACAATGGCGACCTCTTCTG 4
इंसुलिन AAGAGGCCATCAAGCAGATCA CAGGAGGCGCATCCACA 12

तालिका 1. प्राइमर्स qPCR प्रतिक्रियाओं के लिए इस्तेमाल किया.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

अग्नाशय के विकास के दौरान, अग्नाशय फर्क कोशिकाओं महाधमनी से endothelial कोशिकाओं के साथ करीब निकटता में हैं, इसके अलावा, अग्नाशय islets घनी vascularized रक्त ग्लूकोज और आइलेट हार्मोन के तेजी से आदान - प्रदान को बढ़ावा देने. इन तथ्यों को देखते हुए, यह आश्चर्य की बात है कि endothelial कोशिकाओं अग्नाशय organogenesis की प्रक्रिया में एक महत्वपूर्ण भूमिका निभा नहीं है. जबकि अग्नाशय के विकास के दौरान endothelial कोशिकाओं का महत्व तेजी से सराहना की जा रही है, भ्रूण कोशिकाओं की इन विट्रो में भेदभाव में अपनी भूमिका कम की जांच की है. हमारे पहले की रिपोर्ट में हम माउस भ्रूणीय स्टेम कोशिकाओं के 13 अग्नाशय परिपक्वता पर endothelial कोशिकाओं की सकारात्मक भूमिका की स्थापना की. वर्तमान अध्ययन में हम मानव भ्रूण स्टेम कोशिकाओं के फर्क पर endothelial सेल संकेतन के प्रभाव की जांच.

इस प्रोटोकॉल एकाधिक endothelial कोशिकाओं में इस्तेमाल किया गया, जिनमें से सभी समान समग्र प्रभाव althou के परिणामस्वरूप मेंभेदभाव की दक्षता में बदलाव के साथ gh. वर्तमान रिपोर्ट में हम सह संवर्धन hESC चूहा दिल microvascular endothelial कोशिकाओं (RHMVEC) के साथ व्युत्पन्न अग्नाशय के पूर्वपुस्र्ष कोशिकाओं का प्रभाव प्रस्तुत करते हैं. Endothelial कोशिकाओं एसी एलडीएल धुंधला हो जाना है, जो केवल endothelial कोशिकाओं के लिए विशिष्ट है द्वारा आसानी से कल्पना कर सकते हैं. पूर्व दाग endothelial कोशिकाओं के साथ फर्क ESCs के सह - संस्कृति से पता चला है कि जबकि endothelial कोशिकाओं की संस्कृति में सबसे अधिक समय की विस्तारित अवधि के लिए व्यवहार्य थे, RHMEV 4 दिनों के बाद धीरे - धीरे गायब हो और अब परिपक्वता के 6 दिन बाद पता लगाया जा सकता है. RHMVEC की अनुपस्थिति सॉर्टिंग के लिए आवश्यकता को नष्ट करने से विश्लेषण सरल इसलिए प्रोटोकॉल सह - संस्कृति के अनुकूलन के लिए चुना गया था.

जबकि वर्तमान अध्ययन में स्पष्ट रूप से उत्प्रेरण अग्नाशय परिपक्वता में endothelial कोशिकाओं के सकारात्मक प्रभाव को इंगित करता है, इस तरह के प्रेरण की सटीक व्यवस्था अभी भी अज्ञात है और किया जा रहा है वर्तमान में हमारी प्रयोगशाला में जांच की. एक फ़ेडब्ल्यू प्रशंसनीय तंत्र (i) हो सकता है सेल स्रावित (ii) के निशान (iii) बाह्य मैट्रिक्स endothelial कोशिकाओं द्वारा secreted की भूमिका संकेत के endothelial सेल मध्यस्थता निषेध अणुओं के प्रभाव. जबकि पहली श्रेणी सेल सेल संपर्क की आवश्यकता नहीं है, इस तरह के संपर्क दूसरी और तीसरी श्रेणी के लिए अनिवार्य है. इसलिए हम कुछ प्रारंभिक सह संस्कृति अलग विन्यास का उपयोग कर विश्लेषण किया है: (i) सह संस्कृति (ii) के संपर्क transwell सह संस्कृति और (iii) वातानुकूलित मीडिया संस्कृति. यह देखा गया कि सह संस्कृति संपर्क अधिकतम भेदभाव के परिणामस्वरूप, के रूप में इंसुलिन अभिव्यक्ति के द्वारा न्याय, सह संस्कृति transwell के द्वारा पीछा किया, जबकि वातानुकूलित मीडिया संस्कृति इंसुलिन अभिव्यक्ति (नहीं दिखाया डेटा) पर न्यूनतम प्रभाव में हुई. ये विश्लेषण से संकेत मिलता है कि जब सेल सेल से संपर्क महत्वपूर्ण है, वहाँ कुछ अल्पकालिक secreted है जो अणुओं के रूप में अच्छी तरह से महत्वपूर्ण हैं हो सकता है.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

हम खुलासा करने के लिए कुछ भी नहीं है.

Acknowledgements

हम एनआईएच नई अन्वेषक +११६५२० DP2 और ORAU राल्फ Powe जूनियर संकाय संवर्धन पुरस्कार पुरस्कार से समर्थन स्वीकार करते हैं.

Materials

Name Company Catalog Number Comments
mTeSR1 (with supplement) Stem Cell Technologies 5850
hESC qualified matrigel BD Biosciences 354277
DMEM:F12 Invitrogen 11330-032
MCDB-131 Invitrogen 10372019
MCDB-131 (Complete) VEC Technologies MCDB-131
B27 Supplement Invitrogen 17504044
Activin A R&D Systems 338-AC 100ng/ml
Wortmannin Invitrogen W3144 1μM
KAAD-Cyclopamie Sigma-Aldrich C4116 0.2μM
All-Trans Retinoic Acid Sigma-Aldrich R2625 2μM
DAPT Sigma-Aldrich D5942 30μM
Nicotinamide Sigma-Aldrich N0636 10 mM
Sodium Selenite Sigma-Aldrich S5261 30 nM
Insulin Sigma-Aldrich I1882 25 μg/ml
Transferrin Sigma-Aldrich T8158 50 μg/ml
EGF R&D Systems 236-EG 10ng/ml
EndoGro VEC Technologies ENDOGRO 10mg
Heparin Sigma-Aldrich H3149 90μg/ml
Hydrocortisone Sigma-Aldrich H0888 1μg/ml
NucleoSpin RNA II Macherey-Nagel 740955
ImProm II reverse transcription System Promega Corp. A3800
Brilliant II SYBR Green QPCR master mix Stratagene, Agilent Technologies 600548
Sox17 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-17355 1/500
PDX1 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-14662 1/500
C-Peptide Rabbit polyclonal Cell Signaling Technology 4593 1/500
Alexa Fluor 488 donkey anti-rabbit IgG Invitrogen A-21206 1/1000
Alexa Fluor 647 donkey anti-goat IgG Invitrogen A-21447 1/1000
Table 2. Reagents and Kits

DOWNLOAD MATERIALS LIST

References

  1. De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain á la médecine régénératrice de demain. Gynécologie Obstétrique & Fertilité. 37, 620-626 (2009).
  2. Murtaugh, L. C., Melton, D. A. Genes, Signals, and Lineages in Pancreas Development. Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).
  3. Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. Development of definitive endoderm from embryonic stem cells in culture. Development. 131, 1651-1662 (2004).
  4. D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat. Biotech. 24, 1392-1401 (2006).
  5. Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells. Cell Res. 19, 429-438 (2009).
  6. Basma, H., Soto-Gutiérrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes. Gastroenterology. 136, 990-999 (2009).
  7. Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -P., Chipperfield, H., Tan, E. -K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage. Stem Cells and Development. 16, 561-578 (2007).
  8. Kim, S. K., Melton, D. A. Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor. Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).
  9. Docherty, K. Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus. Current Opinion in Pharmacology. 1, 641-649 (2001).
  10. Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., Fässler, R., Gu, G., Gerber, H. -P., Ferrara, N., Melton, D. A. The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]> Cell Proliferation. Developmental Cell. 10, 397-405 (2006).
  11. Yoshitomi, H., Zaret, K. S. Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a. Development. 131, 807-817 (2004).
  12. Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. Marked differences in differentiation propensity among human embryonic stem cell lines. Nat. Biotech. 26, 313-315 (2008).
  13. Banerjee, I., Sharma, N., Yarmush, M. Impact of co-culture on pancreatic differentiation of embryonic stem cells. J. Tissue Eng. Regen. Med. 5, 313-323 (2010).

Comments

2 Comments

  1. good

    Reply
    Posted by: Zhongchun S.
    July 20, 2012 - 2:15 AM
  2. Dear Maria Jaramillo

    I am a student of the licencientura in biotechnology in the Universidad Argentina de la Empresa.
    I am currently studying the cell cultures, researching on the internet I find interesting the abstract, I would like to know if it is possible for me to send the paper by email please.
    thanks and greetings


    Ana Clara López Novo
    Matter cell cultures
    Department of biotechnology and food technology
    Faculty of engineering and Sciences
    Universidad Argentina de la Empresa
    Lima 717 (C1073AAO)
    Ciudad Autónoma de Buenos Aires
    Email: anaclaralopeznovo@gmail.com

    Reply
    Posted by: Ana L.
    May 6, 2013 - 10:24 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics