תגובת שרשרת פולימרז: פרוטוקול בסיסי פלוס אסטרטגיות לפתרון בעיות ואופטימיזציה

Biology
 

Summary

PCR התפתחה טכניקה נפוצה הרבה מעבדות ביולוגיה מולקולרית. בתנאי הנה מדריך מהיר קונבנציונאלי פרוטוקולים מספר ה-PCR. כי כל תגובה היא ניסוי ייחודי, תנאים אופטימליים הנדרשים כדי לייצר מוצר להשתנות. הבנת המשתנים התגובה יהיה מאוד לשפר את יעילות לפתרון בעיות, ובכך להגדיל את הסיכוי להשיג את התוצאה הרצויה.

Cite this Article

Copy Citation | Download Citations

Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998, doi:10.3791/3998 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

במדעים הביולוגיים היו ההתקדמות הטכנולוגית, כי מעוט משמעת לתוך גיל הזהב של גילוי. לדוגמה, בתחום המיקרוביולוגיה הפך עם כניסתו של המיקרוסקופ אנטון ואן לוונהוק, שאיפשרה למדענים לחזות פרוקריוטים בפעם הראשונה. התפתחות התגובה פולימראז שרשרת (PCR) הוא אחד מאותם חידושים ששינו את מהלך המדע מולקולרית עם השפעתה פורש subdisciplines אינספור בביולוגיה. תהליך תיאורטי קווי המתאר של Keppe ועמיתים לעבודה בשנת 1971, עם זאת, זה היה עוד 14 שנים עד הליך שלם PCR תואר ויישם באופן ניסיוני על ידי Kary מוליס תוך Cetus החברה בשנת 1985. אוטומציה ושכלול של טכניקה זו התקדם עם הקדמה של פולימראז ה-DNA תרמית יציבה מ aquaticus החיידק Thermus, וכתוצאה מכך פולימראז שם Taq DNA.

PCR הוא poweהגברה rful טכניקה שיכולה ליצור היצע נרחב של קטע מסוים של דנ"א (כלומר, amplicon) מתוך כמות קטנה בלבד של חומר המוצא (כלומר, תבנית ה-DNA או רצף המטרה). אמנם פשוט, ובדרך כלל ללא בעיות, יש מלכודות שיסבכו את התגובה לייצר תוצאות מזויפות. כאשר ה-PCR נכשל זה יכול להוביל שאינם ספציפיים מוצרים רבים דנ"א בגדלים שונים המופיעים כסולם או כתם של להקות על ג'ל agarose. לפעמים מוצרי שום צורה כלל. בעיה נוספת מתרחשת כאשר הפוטנציאל מוטציות פוגש בטעות ב amplicons, וכתוצאה מכך לאוכלוסייה הטרוגנית של מוצרי ה-PCR. כשלים PCR יכול להיות מתסכל, אלא אם כן סבלנות פתרון בעיות זהיר מועסקים לברר ולפתור את הבעיה (S). פרוטוקול זה מתאר את העקרונות הבסיסיים של ה-PCR, מספק מתודולוגיה יביא הגברה של רצפי היעד ביותר, מציג אסטרטגיות למיטוב התגובה. על ידי ביצוע מדריך זה PCR, רח'udents צריכים להיות מסוגלים:

  • הגדר את התגובות ותנאי רכיבה תרמית לניסוי ה-PCR קונבנציונאלי
  • להבין את תפקידם של מרכיבי התגובה שונים ואת השפעתם הכוללת על ניסוי ה-PCR
  • עיצוב לייעל הניסוי PCR עבור כל תבנית ה-DNA
  • פתרון ה-PCR ניסויים כושלים

Protocol

1. תכנון פריימרים

תכנון פריימרים מתאימים חיונית לתוצאה מוצלחת של ניסוי ה-PCR. בעת תכנון מערכת primers לאזור מסוים של הדנ"א הרצויה הגברה, 1 פריימר צריך לחשל את הגדיל החיובי, אשר על פי האמנה היא שכיוונו בכיוון 5 '→ 3' (המכונה גם במובן או nontemplate גדיל) ו פריימר אחרים צריכים להשלים חוט מינוס, שהוא שכיוונו 3 '→ 5' לכיוון (antisense או גדיל התבנית). יש כמה בעיות נפוצות המתעוררות בעת תכנון פריימרים: 1) עצמית של חישול primers וכתוצאה מכך היווצרות של מבנים משניים כגון לולאות מכבנה (איור 1 א), 2) פריימר חישול זה לזה, במקום תבנית ה-DNA, יצירת פריימר הדימרים (איור 1 ב) 3) נמסים בטמפרטורות שונות באופן דרסטי (T מ ') עבור כל צבע יסוד, ולכן קשה לבחור הטמפרטורה חישול כי יהיה כלow primers הן ביעילות להיקשר רצף המטרה שלהם במהלך themal רכיבה על אופניים (איור 1 ג) (עיין בסעיפים חישוב טמפרטורת התכה (ט מ ') שינויים בתנאי רכיבה לקבלת מידע נוסף על T מ' ים).

  1. להלן רשימה של תכונות הנחשבות בעת תכנון פריימרים.
    1. אורך פריימר צריך להיות 15-30 שאריות נוקלאוטידים (בסיסים).
    2. אופטימלית תוכן GC צריך לנוע בין 40-60%.
    3. בסופו של דבר '3 של primers להכיל G או C כדי לצבוט פריימר ולמנוע "נשימה" של הקצוות, הגברת היעילות תחול. ה-DNA "נשימה" מתרחשת כאשר הקצוות לא להישאר מרותק אבל למערכה או פיצול בנפרד. שלושת קשרי מימן בזוגות-GC למנוע נשימה אלא גם להעלות את טמפרטורת ההתכה של primers את.
    4. הקצוות "3 של קבוצת פריימר, הכולל צבע יסוד גדיל פלוס ו פריימר גדיל מינוס, לא צריך להיות ג omplementary זה לזה, וגם לא סוף "3 של צבע יסוד אחד יכול להיות משלים רצפים אחרים פריימר. שני תרחישים לגרום היווצרות של הדימרים ראשונה, לולאה מבנים חדים, בהתאמה.
    5. התכה בטמפרטורות אופטימלי (T מ ') עבור מגוון primers בין 52-58 מעלות צלזיוס, אם כי טווח ניתן להרחיב עד 45-65 מעלות ג מ 'סופית T עבור primers שני צריך שינוי על לא יותר מ 5 ° C.
    6. Di-נוקלאוטיד חוזר (למשל, GCGCGCGCGC או ATATATATAT) או מפעילה בסיס אחת (למשל, AAAAA או CCCCC) יש להימנע מכיוון שהם עלולים לגרום החלקה לאורך קטע דרוך מבנים דנ"א או סיכת ראש לולאה להיווצר. אם בלתי נמנע בשל אופי של תבנית ה-DNA, ורק כוללים חוזר או בסיס אחד רץ עם מקסימום של 4 בסיסים.

הערות:

  1. יש תוכנות מחשב רבות שנועדו לסייע בעיצוב זוגות פריימר. עיצוב צמח השדה פריימר כליw.ncbi.nlm.nih.gov / כלים / צבע יסוד, הפיצוץ / "target =" _blank "> http://www.ncbi.nlm.nih.gov/tools/primer-blast/ ו Primer3 http://frodo .wi.mit.edu/primer3 / אתרי אינטרנט מומלצים עבור מטרה זו.
  2. כדי למנוע הגברה של גנים או homologs הקשורים זה יכול להיות מועיל להפעיל את הפיצוץ על צמח השדה כדי לבדוק אם היעד הספציפיות של primers את.

2. חומרים ריאגנטים

  1. בעת הגדרת הניסוי PCR, חשוב להיות מוכנים. ללבוש כפפות, כדי למנוע זיהום את התערובת תגובה או חומרים כימיים. כלול שליטה שלילית, ואם אפשר שליטה חיובית.
  2. מסדרים את כל חומרים כימיים הדרושים לניסוי PCR בדלי קרח מלא טרי, ולתת להם להפשיר לחלוטין לפני הקמת תגובה (איור 2). לשמור על חומרים כימיים על קרח לאורך כל הניסוי.
    • תקן ה-PCR כוללים חומרים כימייםקבוצה של פריימרים מתאימים גן המטרה הרצויה או קטע DNA להיות מוגבר, פולימראז ה-DNA, מאגר של פולימראז ה-DNA מסוים, deoxynucleotides (dNTPs), תבנית ה-DNA, ועל מים סטריליים.
    • ריאגנטים נוספים עשויים לכלול מלח מגנזיום Mg 2 + (בריכוז הסופי של mM 0.5-5.0), מלח אשלגן K + (בריכוז סופי של 35 מ"מ עד 100), dimethylsulfoxide (DMSO, בריכוז האחרון של 1-10% ), לפוראמיד (בריכוז הסופי של% 1.25-10), שור סרום אלבומין (בריכוז הסופי של 10-100 מיקרוגרם / מ"ל), ו Betaine (בריכוז הסופי של M 0.5 ל 2.5 מ '). תוספים הם דנו נוספת בסעיף פתרון בעיות.
  3. לארגן ציוד מעבדה על שולחן העבודה.
    • החומרים כוללים צינורות ה-PCR ו כובעים, מתלה צינור ה-PCR, סמן אתנול עמידים, ומערכת של micropipettors לוותר כי בין 1-10 μl (P10) 2-20 μl (P20), 20-200 μl (P200)ו 200 - 1000 μl (P1000), כמו גם Cycler תרמית.
    • בעת הגדרת ניסויים ה-PCR כמה שכל להשתמש ריאגנטים אותם, הם יכולים להיות מדורגים הולם בשילוב יחד בתערובת שני (מיקס מאסטר). שלב זה יכול להיעשות צינור סטרילי מ"ל 1.8 microcentrifuge (ראה הערות).
    • כדי לנתח את amplicons כתוצאה מניסוי ה-PCR, חומרים כימיים וציוד ג'ל אלקטרופורזה agarose נדרש. הגודל המשוער של מוצר ה-PCR, בהתאם, זמין מסחרית רגילה מולקולרית גודל, משקל נחוץ.

3. הגדרת תערובת תגובה

  1. התחל על ידי יצירת טבלה של חומרים כימיים אשר יתווספו לתערובת התגובה (ראה לוח 1).
  2. לאחר מכן, תווית PCR צינור (ים) עם סמן אתנול עמיד.
  3. כרכים התגובה משתנה בהתאם לריכוזים של חומרים כימיים המניות. הריכוזים האחרונים(CF) עבור התגובה הטיפוסית 50 μl הן כדלקמן.
    • X חיץ (מסופק בדרך כלל על ידי היצרן של פולימראז ה-DNA, עשוי להכיל 15 מ"מ MgCl 2). הוסף 5 μl מאגר 10X לכל תגובה.
    • DNTPs 200 מיקרומטר (50 מיקרומטר של כל אחד מארבעת נוקלאוטידים). הוסף 1 μl של 10 מ"מ dNTPs לכל תגובה (dATP, dCTP, dTTP ו dGTP נמצאים 2.5 מ"מ כל אחד).
    • 1.5 מ"מ Mg 2 +. הוסף רק אם היא לא נמצאת במאגר 10X או לפי הצורך לאופטימיזציה PCR. לדוגמה, כדי לקבל את mM 4.0 Mg 2 + הנדרש לייצור amplicon אופטימלי של קטע משומר BP 566-DNA שנמצא Mycobacteriophage uncharacterized להוסיף 8 μl של 25 מ"מ MgCl 2 לתגובה (איור 3).
    • 20-50 pmol של כל צבע יסוד. הוסף 1 μl של פריימר כל 20 מיקרומטר.
    • הוסף 10 4 עד 10 7 מולקולות (או בערך 1-1000 נ"ג) תבנית ה-DNA. הוספת 0.5 μl של 2ng / & mu; הגנומי אני Mycobacteriophage DNA.
    • להוסיף 0.5 עד 2.5 יחידות של ה-DNA פולימראז התגובה לכל 50 μl (ראו המלצות היצרן) כך, למשל, להוסיף 0.5 μl של סיגמא 0.5 יחידות / μl DNA פולימרז Taq.
    • מוסיפים מים מזוקקים QS סטרילית להשיג נפח 50 הסופי μl לכל תגובה כפי שנקבע מראש בטבלה של חומרים כימיים (QS הוא ראשי תיבות בלטינית הקוונטים satis כלומר את הסכום הדרוש). כך, 33 μl לכל תגובה נדרש להביא את עוצמת הקול עד μl 50. עם זאת, ראוי לציין כי מים מוסיפים 1 אבל דורש בתחילה עושה טבלה של חומרים כימיים וקביעת הכרכים של כל ריאגנטים אחרים להוסיף תגובה.

4. בסיסי PCR פרוטוקול

  1. מניחים צלחת 96 גם לתוך דלי קרח כבעלת עבור 0.2 מ"ל צינורות דקים קירות ה-PCR. המאפשר ריאגנטים ה-PCR כדי להוסיף לקור 0.2 מ"ל צינורות קירות דקים ה-PCR יסייע למנוע nucleasדואר הפעילות תחול ספציפי.
  2. פיפטה ריאגנטים הבאים ה-PCR, לפי הסדר הבא לתוך צינור 0.2 מ"ל דק PCR חומה (איור 4): מים סטריליים, 10X חיץ PCR, dNTPs, MgCl 2, primers, ו-DNA תבנית (ראה טבלה 1). מאז ניסויים צריך לפחות שליטה שלילית, ואולי שליטה חיובית, זה מועיל להקים מיקס שני צינור 1.8 microcentrifuge מ"ל (ראה הסבר הערות).
  3. בעוד כמה נפרדים 0.2 מ"ל צינורות דקים חומה PCR (איור 4) להוסיף את כל חומרים כימיים, למעט ה-DNA תבנית עבור שלילי (להעלות את המים, כדי לפצות על היקף חסר). בנוסף, תגובה אחרת (אם חומרים כימיים זמינים) צריך להכיל ביקורת חיובית באמצעות ה-DNA תבנית או primers ידועים קודם לכן כדי להגביר באותם תנאים כמו צינורות הניסוי ה-PCR.
  4. פולימראז ה-DNA Taq מאוחסן בדרך כלל גליצרול 50%פתרון לפיזור מלאה בתערובת התגובה דורש ערבוב עדין של חומרים כימיים PCR ידי pipetting מעלה ומטה לפחות 20 פעמים. Micropipettor יש לקבוע את היקף כמחצית התגובה של שילוב הורים כאשר ערבוב, יש להיזהר כדי למנוע החדרת בועות.
  5. לשים כובעים על 0.2 מ"ל צינורות דקים קירות ה-PCR ומניחים אותם Cycler תרמית (איור 5). פעם את המכסה כדי Cycler תרמית סגור היטב הפעלת התוכנית (ראו טבלה 2).
  6. כאשר התוכנית הסתיימה, 0.2 מ"ל של צינורות דקים קירות ה-PCR ניתן להסיר ומאוחסנים ב 4 ° C. מוצרי ה-PCR ניתן לאתר על ידי טעינת aliquots של התגובה של כל לתוך הבארות של ג'ל agarose אז מכתים DNA אשר היגרו אל אלקטרופורזה בג'ל הבאה עם ברומיד ethidium. אם מוצר ה-PCR נמצא, ברומיד ethidium יהיה intercalate בין בסיסי של גדילי דנ"א, המאפשר להקות להיות דמיינו עם הפנס UV. </ Li>

הערות:

  1. בעת הגדרת מספר רב של ניסויים PCR, זה יתרון להרכיב תערובת של חומרים כימיים משותפים לכל התגובות (כלומר, מיקס מאסטר). בדרך כלל קוקטייל המכיל פתרון של פולימראז ה-DNA, dNTPs, מאגר התגובה, והמים התאספו לתוך צינור microcentrifuge 1.8 מ"ל. כמות מגיב אחד נוסף מיקס מאסטר שווה למספר הכולל של התגובות בתוספת 10% אספו את התגובה השלם הקרוב ביותר. למשל, אם יש 10 X 0.1 = 1 תגובות, אז (10 + 1) X 5 חיץ 10X μl שווה 55 μl של חיץ 10X של מיקס מאסטר. ריאגנטים את בתמהיל מאסטר מעורבבים היטב בעדינות על ידי שאיבה של הבוכנה micropipettor למעלה ולמטה בערך 20 פעמים כמתואר לעיל. כל צינור PCR מקבל aliquot של מיקס מאסטר שאליו תבנית ה-DNA, כל primers הנדרשים, ולהתנסות ספציפיות ריאגנטים מתווספים אז (ראה לוחות 1 ו -7).
  2. Followiהאתר מציע ng מחשבון לקבוע את מספר העותקים של ה-DNA תבנית ( http://www.uri.edu/research/gsc/resources/cndna.html ). המספר הכולל של עותקים של גדילי הדנ"א הכפול יכול להיות מחושב באמצעות המשוואה הבאה:
    מספר העותקים של ה-DNA = (כמות ה-DNA (ng) x 6.022x10 23) / (אורך של ה-DNA צילומי 1x10 9 ng / ml 650 צילומי Daltons)
    חישוב מספר העותקים של ה-DNA משמש כדי לקבוע עד כמה נחוצה תבנית לכל תגובה.
  3. תוצאות חיוביות שגויות עלולה להתרחש כתוצאה למסירה על מתגובה אחרת PCR אשר דמיינו כמו מוצרים לא רצויים רבים על ג'ל אלקטרופורזה agarose לאחר. לכן, זה נבון להשתמש בטכניקה נכונה, כולל שליטה שלילית (ושליטה חיובית במידת האפשר).
  4. בעוד ethidium ברומיד הוא F כתם הנפוץ ביותראו חומצות גרעין יש חלופות בטוחות יותר ולא פחות רעיל מספר. האתר הבאה מתארת ​​כמה מן החלופות כולל מתילן בלו, קריסטל ויולט, SYBR בטוח ולאחר ג'ל אדום יחד עם תיאורים של אופן השימוש לזהות את המוצר הסופי ( http://bitesizebio.com/articles/ethidium-bromide-the- חלופות / ).
  5. בעוד רוב המחשבים המודרניים ה-PCR להשתמש צינורות 0.2 מ"ל, בדגמים מסוימים עשויים לדרוש התגובות צינורות 0.5 מ"ל. ראה cyclers תרמית ידנית כדי לקבוע צינור בגודל המתאים.

5. חישוב טמפרטורת התכה (ט מ)

  1. לדעת את טמפרטורת התכה (ט מ ') של primers את חובה עבור ניסוי מוצלח PCR. למרות שיש כמה טי מחשבונים מ זמין, חשוב לציין כי החישובים האלה הם אומדן בפועל T מ עקב חוסר מידע מפורט על התגובה ועל הנחות מיוחד שנעשה על אלגוריתמים עבור מחשבונים מ-T עצמם. עם זאת, השכן הקרוב ביותר, מודלים תרמודינמיים יש עדיפות על פני החישוב המקובל יותר: T מ ≈ 4 (GC) + 2 (AT). לשעבר ייתן הערכה מדויקת יותר מ T כי זה לוקח בחשבון את האנרגיה הערמה של זוגות בסיסים שכנים. זה האחרון משמש לעתים קרובות יותר, כי החישובים הם פשוטים ניתן לעשות זאת במהירות ביד. ראה סעיף פתרון בעיות לקבלת מידע על התנאים השונים ה-PCR ותוספים להשפיע על טמפרטורת ההתכה.
    לחישוב ערכי ה-T על ידי מ 'הקרוב, השכן מודלים תרמודינמיים, אחת מחשבונים הבאה מומלצת:
    http://www6.appliedbiosystems.com/support/techtools/calc/
    edu / ~ צימר / oligoTMcalc.html "target =" _blank "> http://www.cnr.berkeley.edu/ ~ צימר / oligoTMcalc.html
    http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/
    http://www.finnzymes.com/tm_determination.html~~V
    http://mobyle.pasteur.fr/cgi-bin/portal.py? מס 'צורות :: התכה

6. הגדרת תנאי רכיבה תרמית

  1. Cyclers ה-PCR תרמית החום במהירות מגניב תערובת התגובה, המאפשר denaturation חום הנגרמת של ה-DNA דופלקס (ההפרדה גדיל), חישול של primers אל חוטי פלוס ומינוס של תבנית ה-DNA, ואת התארכות של מוצר ה-PCR. פעמים רכיבה מחושבים על פי גודל התבנית והתוכן GC של ה-DNA. בכלל formulמתחיל בצעד denaturation הראשונית ב 94 ° C עד 98 ° C בהתאם לטמפרטורה אופטימלית לפעילות ה-DNA פולימראז ותוכן GC-DNA של התבנית. תגובה אופיינית יתחיל עם denaturation 1 דקות ב 94 ° C. כל עוד מ -3 דקות יכול לנטרל את ה-DNA פולימרז, להרוס הפעילות האנזימטית שלו. שיטה אחת, הידועה בשם חם תחילת PCR, מרחיב באופן משמעותי את הזמן denaturation ראשונית מ -3 דקות עד 9 דקות. עם חם תחילת PCR, פולימראז ה-DNA הוא הוסיף אחרי צעד ראשון denaturation מוגזמת נגמר. זה שינוי פרוטוקול נמנע איון סביר של האנזים פולימראז ה-DNA. עיין בסעיף פתרון בעיות של פרוטוקול זה לקבלת מידע נוסף על חם תחילת PCR ושיטות אלטרנטיביות אחרות.
  2. השלב הבא הוא להגדיר את Cycler תרמית ליזום הראשון של 25 עד 35 סיבובים של מחזור בן שלושה שלבים הטמפרטורה (טבלה 2). תוך הגדלת מספר מחזורי מעל 35 תגרוםכמות גדולה יותר של מוצרי ה-PCR, סיבובים רבים מדי לעתים קרובות תוצאות העשרת מוצרים משניים לא רצויים. שלושת השלבים טמפרטורה במחזור אחד לבצע שלוש משימות: הצעד הראשון משנה את טיבעו של התבנית (וגם במחזורים מאוחרים יותר, כמו גם את amplicons), השלב השני מאפשר אופטימלית חישול של פריימרים, ואת השלב השלישי מאפשר ה-DNA פולימראז להיקשר תבנית ה-DNA ו לסנתז את המוצר PCR. משך וטמפרטורה של כל שלב במחזור ניתן לשנות כדי לייעל את הייצור של amplicon הרצוי.
    השעה לשלב denaturation נשמר קצר ככל האפשר. בדרך כלל 10 עד 60 שניות מספיק עבור רוב תבניות ה-DNA. זמן denaturation והטמפרטורה עשויה להשתנות בהתאם לתוכן GC של ה-DNA את התבנית, כמו גם את שיעור הרמפה, המהווה את משך הזמן שלוקח Cycler תרמית לשנות מן הטמפרטורה אחד למשנהו. הטמפרטורה של שלב זה הוא בדרך כלל זהה לזה המשמש בשלב הראשוני denaturation(שלב 1 לעיל, למשל, 94 ° C).
    צעד 30 חישול 2 הבא במחזור בטמפרטורה להגדיר על 5 מעלות צלזיוס מתחת מ T לכאורה של primers את (באופן אידיאלי בין 52 ° C עד 58 ° C).
    מחזור מסתיים שלב הארכה. הטמפרטורה תלויה פולימראז ה-DNA שנבחר לניסוי. לדוגמה, ה-DNA פולימראז Taq יש התארכות טמפרטורה אופטימלית של 70 ° C עד 80 ° C דורש 1 דקה כדי להאריך את הראשון 2 קילו, ואז דורש דקה נוספת עבור כל 1 קילו נוספים מוגבר. פולימראז ה-DNA Pfu עוד האנזים thermostable כי יש התארכות טמפרטורה אופטימלית של 75 ° C. פולימראז ה-DNA Pfu מומלץ לשימוש ב PCR והסיומת פריימר תגובות הדורשים איכות גבוהה ודורשת 2 דקות על כל 1 KB להיות מוגבר. ראה המלצות היצרן בטמפרטורות התארכות מדויקים וזמן התארכות הצביע עבור כל ה-DNA פולימראז ספציפי.
  3. Taq, מאפשרת תוספת של שאריות אדנין אל הקצוות "3 של כל מוצרי ה-PCR. שינוי זה מתווך על ידי פעילות transferase הטרמינל של פולימראז ה-DNA Taq והיא שימושית הבאים נהלים שיבוט מולקולרי הדורשים הסככה 3'-.
  4. הפסקת התגובה מושגת על ידי מצמרר את התערובת עד 4 ° C ו / או על ידי תוספת של EDTA לריכוז סופי של 10 מ"מ.

7. שיקולים חשובים בעת פתרון ה-PCR

אם סטנדרטיים תנאי ה-PCR לא להיכנע amplicon הרצוי, PCR אופטימיזציה הוא הכרחי כדי להשיג תוצאות טובות יותר. החמרת התגובה יכולה להיות מווסתת כך הספציפיות מותאם על ידי משתנים משינוי (למשל, מגיבריכוזים, תנאי רכיבה על אופניים) המשפיעים על התוצאה של הפרופיל amplicon. לדוגמה, אם התגובה היא לא מחמירים מספיק, amplicons שווא רבות יופק בעלות אורך משתנה. אם התגובה היא מחמירה מדי, המוצר לא יופק. פתרון בעיות PCR תגובות יכול להיות מאמץ מתסכל לפעמים. עם זאת, ניתוח זהיר הבנה טובה של חומרים כימיים המשמשים בניסוי ה-PCR יכולה להפחית את משך הזמן ואת הניסויים הדרושים כדי להשיג את התוצאות הרצויות. מכל השיקולים המשפיעים להחמיר PCR, טיטרציה של Mg 2 + ו / או מניפולציה בטמפרטורות חישול סביר שיפתור את מרבית בעיות. עם זאת, לפני שינוי כל דבר, להיות בטוח כי התוצאה שגויה לא היה בשל טעות אנוש. התחל על ידי המאשר את כל ריאגנטים נוספו התגובה נתונה וכי ריאגנטים לא היו מזוהמים. גם לרשום את התוצאה השגויה, ולשאול את השאלות הבאות: האם הדימרים פריימר גלוי על ג'ל לאחר electrophoresis (אלה בטווח כמו להקות קטנות <100 ב 'בחלק התחתון של המסלול)? האם יש מוצרים שאינם ספציפיים (להקות הנודדים בגודל שונה המוצר הרצוי)? היה שם חוסר של כל מוצר? האם ה-DNA היעד על פלסמיד או תמצית ה-DNA הגנומי? כמו כן, רצוי לנתח את התוכן של GC amplicon הרצוי.

  1. ראשית לקבוע אם כל אחד ריאגנטים ה-PCR הם אסון לתגובה שלך. ניתן להשיג זאת על ידי הכנת חומרים כימיים חדשים (למשל, מניות הפועלים טריים, דילולים חדשות) ולאחר מכן להוסיף 1 שיטתי מגיב חדשה בכל פעם, כדי תערובות התגובה. תהליך זה יקבע אשר מגיב הוא האשם לניסוי הכושל PCR. במקרה של ה-DNA עתיק מאוד, אשר לעיתים קרובות מצטבר מעכבי, הוכח כי תוספת של אלבומין בסרום שור עשוי לעזור להקל על הבעיה.
  2. הדימרים פריימר יכול להיווצר כאשר primers מעדיפים לחשל עצמית או כדי לחשל פריימר השני בתגובה. במקרה זה, קטןתוצר של פחות מ -100 נקודות בסיס יופיע ג'ל agarose. התחל על ידי שינוי היחס בין תבנית תחל, אם תחל ריכוז היא עודף קיצוני על ריכוז תבנית, אז primers יהיו יותר סיכוי לחשל את עצמם או אחד את השני על תבנית ה-DNA. הוספת DMSO ו או באמצעות התחל חם תרמית שיטת רכיבה על אופניים עשויה לפתור את הבעיה. בסופו של דבר, ייתכן שיהיה צורך לתכנן פריימרים חדשים.
  3. הלא ספציפית המוצרים מיוצרים בעת החמרת PCR נמוכה מדי וכתוצאה מכך שאינם ספציפיים להקות ה-PCR עם אורכים משתנים. זה יוצר אפקט הסולם על ג'ל agarose. לאחר מכן מומלץ לבחור תנאי ה-PCR המגבירים להחמיר. כתם בגדלים שונים עשויים להיגרם גם כתוצאה primers שנועדו רצפים חוזרים מאוד כאשר הגברה הדנ"א הגנומי. עם זאת, primers אותם עשויה להגביר רצף היעד על פלסמיד בלי להיתקל באותה בעיה.
  4. חוסר של מוצרים ה-PCR עשויה בשל תנאי התגובהכי הם מחמירים מדי. הדימרים ראשונה, לולאה מבנים חדים היוצרים עם primers או ב-DNA תבנית מפוגל זה עלול למנוע גם הגברה של מוצרי ה-PCR, כי מולקולות אלה אין עוד זוג בסיס עם עמיתו הדנ"א הרצויה.
  5. אם התוכן GC לא נותחו, הגיע הזמן לעשות זאת. PCR של אזורים עשירים-GC (GC תוכן> 60%) מהווים חלק מן האתגרים הגדולים ביותר PCR. עם זאת, קיימים תוספים רבים שנוצלו כדי לעזור להקל על אתגרים.

8. מניפולציה PCR ריאגנטים

הבנת תפקידו של חומרים כימיים המשמשים ב-PCR קונבנציונאלי הוא קריטי כאשר 1 להחליט מהי הדרך הטובה ביותר לשנות את התנאים התגובה להשיג את המוצר הרצוי. הצלחה פשוט יכול לסמוך על שינוי הריכוז של MgCl 2, KCl, dNTPs, פריימרים, תבנית ה-DNA, או דנ"א פולימראז. עם זאת, ריכוז נכון של חומרים כימיים כאלה עלול להוביל לתוצאות מזויף, הפחתת stringency התגובה. בעת פתרון ה-PCR, רק אחד מגיב צריך לטפל בכל פעם. עם זאת, זה עשוי להיות נבון לכיל מגיב מניפולציה.

  1. מלח מגנזיום Mg 2 + (ריכוז התגובה האחרון של mM 0.5-5.0)
    Polymerases דנ"א Thermostable דורשים נוכחות של מגנזיום לשמש cofactor במהלך התגובה. שינוי ריכוז מגנזיום הוא אחד ריאגנטים הכי קל לתמרן עם אולי ההשפעה הגדולה ביותר על חומרה של ה-PCR. באופן כללי, התשואה המוצר PCR יגדל עם תוספת של בריכוז של Mg 2 +. עם זאת, עלייה בריכוז של Mg 2 + גם להקטין את הספציפיות ונאמנות של פולימראז ה-DNA. רוב היצרנים כוללים פתרון של מגנזיום כלוריד (MgCl 2) יחד עם פולימראז ה-DNA ופתרון חיץ 10X-PCR. את 10 x-PCR תמיסות בופר עשוי להכיל 15 מ"מ MgCl 2, שהוא מספיק PCR טיפוסיתגובה, או ניתן להוסיף בנפרד בריכוז מותאם תגובה מסוימת. Mg 2 + לא נצרך בפועל התגובה, אך התגובה לא יכול להמשיך בלי זה להיות נוכח. כאשר יש יותר מדי Mg 2 +, היא עשויה למנוע denaturation מלאה של תבנית ה-DNA על ידי מייצב גדיל דופלקס. יותר מדי Mg 2 + גם יכול לייצב מזויף חישול של פריימרים למקומות לא נכונים תבנית וספציפיות ירידה וכתוצאה מכך לא רצויים מוצרי ה-PCR. כאשר אין מספיק Mg 2 +, תגובה לא ימשיך, וכתוצאה מכך המוצר לא PCR.
  2. מלח אשלגן K + (תגובה הריכוז הסופי של 35 מ"מ עד 100)
    מוצרי ה-PCR יותר (10 עד 40 KB) נהנים הפחתת מלח אשלגן (KCl) מריכוז התגובה הרגיל 50 מ"מ, לעתים קרובות יחד עם תוספת של DMSO ו / או גליצרול. אם amplicon הרצוי הוא מתחת 1000 BP ו ארוכים שאינם ספציפיים מוצרי יוצרים, specificiטאי ניתן לשפר על ידי titrating KCl, להגדיל את הריכוז ב -10 מ"מ במרווחים של עד 100 מ"מ. הגדלת ריכוז המלח מאפשר מולקולות דנ"א קצרות יותר כדי לפגל מעדיפים את מולקולות דנ"א ארוכות יותר.
  3. Deoxynucleotide 5'למוצרי triphosphates (ריכוז התגובה האחרון של 20 ו 200 מיקרומטר כל אחת)
    Deoxynucleotide 5'למוצרי triphosphates (dNTPs) יכול לגרום לבעיות עבור PCR אם הם אינם נמצאים הריכוזים דומים המתאימים (כלומר, [] = [T] = [C] = [ז]) ו / או עקב חוסר היציבות שלהם חזר הקפאה להפשרה. ריכוז dNTP המקובל הוא 50 מיקרומטר של כל אחד מארבעת dNTPs. עם זאת, PCR יכולים לסבול ריכוזי בין 20 ל 200 מיקרומטר אחד. ריכוזים נמוכים יותר של dNTPs עלול להגביר הן את הספציפיות ונאמנות של תגובה תוך ריכוז dNTP מוגזמות ממש יכול לעכב PCR. עם זאת, למשך זמן ארוך יותר PCR פירורי, ריכוז גבוה יותר dNTP ייתכן שיהיה צורך. שינוי גדול בריכוז dNTP עשוי להצריך תכתובותponding שינוי בריכוז של Mg 2 +.
  4. תרמית ה-DNA polymerases יציבים
    אנזימי ה-PCR ו חוצצי הקשורים אנזימים אלה עשו דרך ארוכה מאז פולימראז ה-DNA הראשונית Taq הועסק 1. לכן, בחירת האנזים המתאים יכול להיות מועיל עבור קבלת מוצרי amplicon הרצויות. לדוגמה שימוש פולימראז ה-DNA Taq עשוי להיות מועדף על פני ה-DNA פולימראז Pfu אם processivity ו / או תוספת של שאריות אדנין אל הקצוות "3 של מוצר ה-PCR היא הרצוי. תוספת של 3 'אדנין הפך אסטרטגיה שימושי עבור מוצרי ה-PCR שיבוט לתוך וקטורים ת"א ויט 3 "המסוכך על תימין. עם זאת, אם נאמנות חשובה יותר אנזים כגון Pfu עשוי להיות בחירה טובה יותר. כמה מייצרת יש מערך של polymerases DNA ספציפיים המותאמים לצרכים מיוחדים. תסתכל על התנאים התגובה והמאפיינים של amplicon הרצוי, ולאחר מכן להתאים את ניסוי ה-PCR עם ה-DNA המתאים עמ 'olymerase. רוב מייצרת יש טבלאות הסיוע DNA פולימרז הבחירה לפי תכונות הרישום כגון נאמנות, תשואה, מהירות, אורך יעד אופטימלי, והאם הוא שימושי הגברה עשיר GC או תחילת PCR חם.
  5. תבנית ה-DNA
    איכות ה-DNA וטוהר תהיה השפעה משמעותית על הסיכוי של ניסוי מוצלח PCR. DNA ו-RNA בריכוזים ניתן לקבוע באמצעות מדידות אופטיות שלהם צפיפות ב 260 ננומטר (OD 260). המסה של מטוהרים חומצות גרעין בתמיסה מחושב על 50 מיקרוגרם / מ"ל של גדילי הדנ"א הכפול או 40 מיקרוגרם / מ"ל של או RNA או DNA גדילי יחיד OD 260 = 1.0. מיצוי מזהמים דנ"א הם מעכבי נפוצות PCR יש להימנע בזהירות. הנפוצים החילוץ דנ"א מעכבי PCR כוללים חלבון, RNA, ממסים אורגניים, חומרי ניקוי ו. באמצעות ספיגה מקסימלית של חומצות גרעין OD 260 בהשוואה לזו של חלבונים OD280 (OD 260/280), ניתן determinאומדן הדואר של טוהר של ה-DNA חילוץ. באופן אידיאלי, היחס בין OD 260/280 הוא בין 1.8 לבין 2.0. OD נמוך 260/280 מעיד על חלבון ו / או זיהום ממס אשר, ככל הנראה, יהיה בעייתי עבור ה-PCR.
    בנוסף לאיכות של ה-DNA תבנית, אופטימיזציה של כמות ה-DNA עשויה תועלת רבה תוצאה של ניסוי ה-PCR. למרות זאת הוא נוח כדי לקבוע את כמות μl ng /, אשר לעיתים קרובות פלט עבור nanospectrophotometers מודרניים, יחידת רלוונטי לניסוי PCR מוצלח הוא מספר מולקולות. כלומר, כמה עותקים של תבנית ה-DNA מכיל רצף משלים את primers ה-PCR? מולקולות מטרה הם אופטימליים בין אפריל 10 - יולי 10 מולקולות ועשוי להיות מחושב כפי שמתואר ההערות הנ"ל.

9. תוסף ריאגנטים

ריאגנטים תוסף עשוי להניב תוצאות, כאשר כל השאר נכשל. הבנת ריאגנטיםומה הם משמשים הוא קריטי בקביעת ריאגנטים עשוי להיות יעיל ביותר לרכישת המוצר PCR הרצוי. הוספת חומרים כימיים התגובה היא מסובכת בשל העובדה כי מניפולציה של מגיב 1 עשוי להשפיע על ריכוז שמיש של מגיב אחר. בנוסף חומרים כימיים המפורטים להלן, תוספים זמינים מסחרית קניינית זמינים חברות ביוטכנולוגיה רבות.

10. תוספים כי לטובת תבניות-GC עשירים

  1. Dimethylsulfoxide (ריכוז התגובה האחרון של DMSO% 1-10)
    בניסויים ה-PCR שבו ה-DNA תבנית במיוחד GC עשיר (תוכן GC> 60%), והוסיף DMSO יכול לשפר את התגובה ע"י שיבוש זיווג בסיס וביעילות הורדת מ-T. כמה מחשבונים מ-T כוללים כניסה משתנה להוספת ריכוז DMSO הרצוי בניסוי ה-PCR. עם זאת, מוסיף יותר מ -2% DMSO עשוי לדרוש הוספת פולימראז ה-DNA יותר כפי שהיה השד strated לעכב Taq פולימראז ה-DNA.
  2. לפוראמיד (ריכוז התגובה הסופית של% 1.25-10)
    כמו DMSO, לפוראמיד גם משבש את ההתאמה תוך הגדלת בסיס החומרה של פריימר חישול, שתוצאתה תחול הלא ספציפית פחות יעילות הגברה מוגברת. לפוראמיד גם הוכח להיות משפר עבור תבניות-GC עשירים.
  3. 7-deaza-2'-deoxyguanosine 5'-טריפוספט (ריכוז התגובה האחרון של DC 7 GTP, 3 DC 7 GTP: 1 dGTP 50 מיקרומטר)
    באמצעות 3 חלקים, או 37.5 מיקרומטר, של בסיס guanosine אנלוגי DC 7 GTP יחד עם חלק 1, או 12.5 מיקרומטר, dGTP יערער היווצרות של מבנים משניים במוצר. כמו ה-DNA amplicon או תבנית הוא מפוגל, זה בדרך כלל ליצור מבנים משניים כגון לולאות חדים. שילוב של DC 7 GTP אל amplicon DNA יהיה לאסור הקמת מבנים אלה חריגים.

הערה:

התחת = "jove_content"> DC 7 GTP פוחתת האות של מכתים ברומיד ethidium ולכן נעשה בו שימוש ביחס 3:01 עם dGTP.

  1. Betaine (ריכוז התגובה האחרון של 0.5m ל 2.5M)
    Betaine (N, N, N-trimethylglycine) הוא אנלוגי zwitterionic חומצת אמינו מפחיתה ואף עלול לחסל את טמפרטורת ההתכה DNA התלות הרכב נוקלאוטיד. הוא משמש כתוסף לסייע הגברה PCR של מטרות עשירים-GC. Betaine מועסק לעתים קרובות בשילוב עם DMSO ויכול לשפר מאוד את סיכויי ה-DNA היעד הגברה עם תוכן GC גבוה.

11. תוספים המסייעים PCR בנוכחות מעכבי

  1. דטרגנטים יוניים שאינם מתפקדים לדכא היווצרות מבנה משני ולסייע לייצב את פולימראז ה-DNA. דטרגנטים יוניים שאינם כגון טריטון X-100, Tween 20, או NP-40 ניתן להשתמש בריכוזים התגובה של% 0.1-1 על מנת להגביר את ייצור amplicon. עם זאת, concentrations מעל 1% עשוי להיות מעכבות את ה-PCR. נוכחות של חומרי ניקוי שאינם יוניים מקטין להחמיר PCR, באופן פוטנציאלי המוביל להיווצרות מוצר מזויף. עם זאת, השימוש בהם יהיה גם לנטרל השפעות מעכבות SDS, מזהמים מדי פעם פרוטוקולים מיצוי DNA.
  2. תוספת של חלבונים ספציפיים כגון אלבומין בסרום שור (BSA) משתמשים ב 400 חלבון ng / μl ו / או T4 גן 32 ב 150 ng / μl סיוע PCR בנוכחות מעכבי כגון 3 FeCl, hemin, fulvic חומצה, חומצה humic, חומצות טאנינים, או תמציות של צואה, מים מתוקים, מים ימיים. עם זאת, כמה מעכבי ה-PCR, כולל מלחי מרה, בילירובין, EDTA, NaCl, SDS, או טריטון X-100, לא להקל על ידי תוספת של חלבון או BSA או T4 32 גנים.

12. שינויים בתנאי רכיבה

  1. אופטימיזציה של חישול בטמפרטורה ישפר כל תגובה PCR יש לשקול בשילוב עם תוספים אחרים ו / או יחד עם אחרים מו difications לתנאי רכיבה על אופניים. לכן, על מנת לחשב את הטמפרטורה האופטימלית חישול המשוואה הבאה הוא מועסק:
    T = הכבושים 0.3 T תחל מ '+ 0.7 מ' T מוצר -14.9
    פריימר T מ 'מחושב מ T של זוג יציב פחות באמצעות המשוואה:
    פריימר T M = ((ΔH / (ΔS + R x ln (ג / 4))) -273,15 + 16,6 יומן [K +] איפה ΔH הוא סכום האנתלפיה את השינויים הקרובים ביותר השכן עבור מכוניות היברידיות, ΔS הוא סכום אנטרופיה השכן הקרוב שינויים, R הוא גז קבוע (1.99 cal K-1 mol-1), C הוא ריכוז פריימר, ו [K +] הוא ריכוז אשלגן.
    המשוואה האחרונה ניתן לחשב באמצעות מחשבונים אחד מ-T המפורטים באתר האינטרנט הבאה:
    RS / נמס / sup_mat / servers_list.html "target =" _blank "> http://protein.bio.puc.cl/cardex/servers/melting/sup_mat/servers_list.html
    מוצר T מ 'מחושב כדלקמן:
    מוצר T = 0.41 מ '(% GC) + 16.6 יומן [K +] - 675/product אורך
    עבור רוב PCR תגובות ריכוז של אשלגן ([K +]) יהיה 50 מ"מ.
  2. חם תחילת PCR הוא שינוי צדדי שבו הזמן denaturation הראשוני הוא גדל באופן משמעותי (טבלה 4). שינוי זה יכול להיות משולב עם או בלי שינויים אחרים בתנאי רכיבה על אופניים. יתר על כן, הוא משמש לעיתים קרובות בשילוב עם תוספים עבור היווצרות amplicon הפכפך. למעשה, חם תחילת PCR נכלל יותר ויותר היבט קבוע של תנאי רכיבה על אופניים בכלל. התחל חם הוכח להגדיל את התשואה amplicon, תוך הגברת הספציפיות ונאמנות של התגובה.הרציונל מאחורי חם תחילת PCR היא לחסל פריימר-dimer ולא ספציפית תחול שעלולים לגרום כתוצאה של הקמת התגובה להלן מ 'טי. לכן, תגובה אופיינית בתחילת חם מחממת את המדגם לטמפרטורה מעל אופטימלי T מ ', לפחות עד 60 ° C לפני הגברה כל יכול להתרחש. באופן כללי, פולימראז ה-DNA הוא נמנע מתגובה במהלך הזמן הראשוני, מוארך denaturing. אף מרכיבים אחרים של התגובה מושמטים לפעמים במקום פולימראז ה-DNA, כאן נתמקד פולימראז ה-DNA. ישנן מספר שיטות המאפשרות פולימראז ה-DNA להישאר פעיל או מופרדים פיזית עד תקופת denaturation הראשונית השלימה, כולל שימוש המכשול שעווה מוצק, אנטי-DNA פולימראז נוגדנים, חלבונים אביזר. לחלופין, פולימראז ה-DNA יכול פשוט להוסיף תגובה לאחר מחזור denaturation הראשונית תושלם.
  3. הנחיתה PCR (TD-PCR) היאמתכוון לקחת חלק ניחוש להבין את המגבלות של מ טי חישוב ידי למסגר את הטמפרטורות חישול מחושבים. הרעיון הוא לעצב שני שלבי תנאי רכיבה (לוח 5). השלב הראשון מעסיקה ברציפות בטמפרטורות נמוכות חישול בכל מחזור 2 (באופן מסורתי 1.0 ° C), החל מהשעה 10 ° C מעל ואת הגמר ב חישוב T m או מעט מתחת. שלב 2 מנצל את תקן 3-צעד תנאים עם טמפרטורה חישול נקבע על 5 מעלות צלזיוס מתחת מ T מחושב עוד 20 עד 25 מחזורים. פונקציה של השלב הראשון צריך להקל mispriming, המקנה יתרון של פי 4 על המוצר הנכון. כך, לאחר 10 מחזורים, יתרון של פי 410 תניב 4096 עותקים של המוצר הנכון על תחול בכל מזויף.
    • Stepdown PCR דומה TD-PCR עם במרווחים של פחות בשלב הראשון של תחול. כדוגמה, את השלב הראשון מוריד את הטמפרטורה חישול בכלמחזור 2 של 3 מעלות צלזיוס, החל מ 10 ° C מעל ואת הגמר ב 2 מעלות צלזיוס מתחת מחושב T מ '. כמו TD-PCR, שלב 2 מנצל את תקן 3-צעד תנאים עם טמפרטורה חישול נקבע על 5 מעלות צלזיוס מתחת מחושב T מ 'למשך 20 עד 25 מחזורים. יכולת זו תאפשר המוצר הנכון יתרון של פי 256 על מוצרים הייזום שווא.
    • ההאטה PCR הוא פשוט שינוי של TD ו-PCR היה מוצלח מאוד עבור הגברה GC עשיר (מעל 83%) רצפים (לוח 6). הרעיון לוקח בחשבון תכונה חדשה יחסית קשורה cyclers תרמית מודרניים, המאפשר התאמת מהירות כבש, כמו גם את קצב הקירור. הפרוטוקול עושה שימוש גם DC 7 GTP להפחית 2 מבנה ° היווצרות שיכול לעכב את התגובה. מהירות הרמפה יורדת עד 2.5 מעלות צלזיוס s -1 עם קצב הקירור של 1.5 מעלות צלזיוס של -1 על מחזורי חישול. השלב הראשון מתחילnealing טמפרטורה של 70 מעלות צלזיוס, מפחית את הטמפרטורה על ידי חישול 1 מעלות צלזיוס כל 3 סיבובים עד שהוא מגיע 58 מעלות ג השלב השני ואז ממשיך עם הטמפרטורה חישול של 58 מעלות צלזיוס למשך 15 מחזורים נוספים.
  4. PCR מקונן הוא כלי רב עוצמה המשמש לחסל מוצרים מזויפים. השימוש primers מקוננות מועיל במיוחד כאשר ישנם מספר גנים paralogous בגנום יחיד או כאשר יש מספר נמוך עותק של רצף מטרה בתוך אוכלוסיה הטרוגנית של רצפים orthologous. ההליך הבסיסי כולל שני סטים של primers כי להגביר באזור אחד של DNA. את primers החיצוניים לרכוב קטע עניין ומשמשים להפקת מוצרי ה-PCR, כי הם בדרך כלל לא ספציפי 20 עד 30 מחזורים. Aliquot קטן, בדרך כלל כ - 5 μl מתגובה 50 μl 1, לאחר מכן נעשה שימוש רק בעוד 20 עד 30 סיבובים של הגברה באמצעות סט שני של primers כי לחשל לקרוב מיקום פנימי כמו ה-DNA תבניתכדי במערכה הראשונה.

אחרים פרוטוקולי ה-PCR מתמחים יותר וללכת מעבר להיקף של מאמר זה. דוגמאות כוללות RACE-PCR, Multiplex-PCR, Vectorette-PCR, כמותי-PCR, ו - RT-PCR.

13. נציג תוצאות

נציג תוצאות ה-PCR נוצרו על ידי ביצוע הפרוטוקולים הבסיסיים ה-PCR המתוארים לעיל. התוצאות לשלב אסטרטגיות לפתרון בעיות מספר כדי להדגים את ההשפעה של חומרים כימיים ותנאים שונים על התגובה. גנים של השמרים Saccharomyces cerevisiae ניצני ומ Mycobacteriophage uncharacterized היו מוגבר בניסויים אלה. תקן 3-PCR צעד פרוטוקול המפורטים בטבלה מס '2 הועסק במשך כל שלושת הניסויים המתוארים להלן.

לפני התקנת ניסוי ה-PCR, דנ"א גנומי משני ס cerevisiae ו Mycobacteriophage היו לכמת ו מדולל לריכוז כי היה Allow בין 10 4 ו 10 7 מולקולות של DNA לכל תגובה. מניות הפועלים היו מוכנים כדלקמן. הכנת ה-DNA הגנומי שמרים הניב 10 4 ng / μl. דילול עד 10 ng / μl נוצר על ידי הוספת 48 μl אל μl 452 של מאגר ה-pH 8.0 TE. מאז ש ' cerevisiae הגנום הוא כ 12.5 מגה בייט, 10 ng להכיל 7.41 x 10 5 מולקולות. הכנת ה-DNA הגנומי Mycobacteriophage הניב 313 ng / μl. דילול ל 2 ng / μl נוצר על ידי הוספת 6.4 μl אל μl 993.6 מאגר ה-pH 8.0 TE. זה ה-DNA הפאג הוא כ 67 KB. לפיכך, מכיל 1 ננוגרם 2.73 x 10 -7 מולקולות, שהוא הגבול העליון של ה-DNA משמש בדרך כלל עבור ה-PCR. מניות הפועלים שימשו לאחר מכן ליצור את מיקס מאסטר פתרונות המפורטים בטבלה 7. ניסויים מגוונים תנאים אופניים כמתואר להלן.

בסעיף 3 איור, הדנ"א הגנומי מ ס cerevisiae שימש כתבנית כדי להגבירהגן GAL3, המקודד חלבון המעורב במטבוליזם גלקטוז. המטרה של הניסוי הייתה לקבוע אופטימלית Mg 2 + ריכוז עבור קבוצה זו של חומרים כימיים. לא MgCl 2 היה נוכח למאגר PCR המקורי והיה צריך להשלים את ריכוזי המצוינים עם מגוון בדיקות של mM 0.0 מ"מ 5.0. כפי שמוצג בתרשים, תוצר PCR בגודל הצפוי (2098 BP) מופיע החל Mg 2 + בריכוז של 2.5 mM (מסלול 6) עם ריכוז אופטימלי של 4.0 מ"מ (מסלול 9). הריכוז המומלץ המסופק על ידי היצרן היה 1.5 מ"מ, המהווה את הסכום שנקבע טיפוסי מאגרי ה-PCR. אולי במפתיע, ריכוז הנדרשים ליצירת המוצר בניסוי זה עלה על סכום זה.

תבנית ה-DNA שונה שימש הניסוי המוצג באיור 3 ב. הדנ"א הגנומי של Mycobacteriophage נעשה שימוש כדי להגביר קטע משומר 566 BP-DNA.כמו בניסוי הקודם, ריכוז אופטימלי Mg 2 + צריך להיקבע. כפי שניתן לראות באיור 3 ב, הגברה של מוצר ה-PCR הרצוי דורש לפחות 2.0 mM Mg 2 + (מסלול 5). אמנם לא היה השתנות יותר בסך של המוצר שנוצר להגדיל ריכוזים של MgCl 2, מוצר ה-PCR ביותר נצפתה ב 4 מ"מ Mg 2 + (מסלול 9), אותו ריכוז שנצפה על הגן שמרים GAL3.

שימו לב כי בניסויים שהוצגו 3 א ו 3 ב ומספרים, הלהקה בדידה הושג באמצעות התנאים אופניים חשב להיות אופטימלית על טמפרטורות פריימר חישול. באופן ספציפי, את הטמפרטורה denaturation היה 95 מעלות צלזיוס עם הטמפרטורה חישול של 61 מעלות צלזיוס, והרחבה בוצע דקה 1 על 72 מעלות צלזיוס במשך 30 מחזורים. הארכת סופית 5 דקות לאחר מכן נעשה ב 72 ° C. לצורך ניסוי 3 שהוצג באיור 3 ג בתרשים 3 ג, מה היתה הלהקה בדידה באיור 3 א, הופך כתם שאינם ספציפיים מוצרים אלה תחת תת תנאים אופטימליים אופניים. יתר על כן, עם ההחמרה הכוללת של תגובה מופחתת, כמות נמוכה יותר של Mg 2 + נדרש כדי ליצור amplicon.

כל שלושת הניסויים מדגימים כי כאשר מ"ג 2 + ריכוזים נמוכים מדי, אין ייצור amplicon. תוצאות אלו מראות כי גם כאשר שני התנאים אופנייםמתוכננים בצורה נכונה ריאגנטים הם בריכוזים אופטימליים, ניסוי ה-PCR מייצרת amplicon דיסקרטי המתאים לגודל הצפוי. התוצאות מראות את החשיבות של ביצוע ניסויים על ה-PCR חומרה גבוהה מספיק (למשל, להקות דיסקרטיות מול כתם). יתרה מכך, ניסויים מראים כי שינוי פרמטר אחד יכול להשפיע על פרמטר נוסף, ובכך להשפיע על תוצאות התגובה.

מגיב ריכוז של פתרונות מניות נפח 13x **
מיקס מאסטר
ריכוז סופי
סטרילית H 2 O QS ל μl 50 QS ל μl 650
מאגר ה-PCR 10X 5 μl 65 μl 1X
dNTP של 10 mM 1 μl 13 μl 200 מיקרומטר
MgCl 2 25 מ"מ 3 μl 39 μl 1.5 מ"מ
קדימה פריימר 20 מיקרומטר = 20 pmol / μl 1 μl 13 μl 20 pmol
הפוך פריימר 20 מיקרומטר = 20 pmol / μl 1 μl 13 μl 20 pmol
תבנית ה-DNA משתנה משתנה משתנה ~~~HEAD=NNS 10 5 מולקולות
Taq פולימראז ה-DNA 5 יחידות / * μl 0.5 μl Μl 6.5 2.5 יחידות
50 μl / תגובה

1. לוח ריאגנטים ה-PCR, לפי סדר שהם צריכים להוסיף.

יחידות * עשוי להשתנות בין יצרנים

הוסף ** כל ריאגנטים לתערובת הורים ללא כל צורך של טיטרציה או אולי משתנה התגובה. מיקס מאסטר מתואר בטבלה לעיל מחושב עבור 11 תגובות פלוס 2 תגובות נוספות כדי להתאים אובדן פיפטה העברת להבטיח שיש מספיק aliquot לצינור כל תגובה.

סטנדרט 3-PCR צעד אופניים
מחזור צעד טמפרטורה זמן מספר מחזורי
ראשוני denaturation 94 ° C עד 98 ° C 1 דקות 1
Denaturation
רכוך
הארכה
94 ° C
5 מעלות צלזיוס מתחת T מ '
70 ° C עד 80 ° C
10 עד 60 שניות
30 שניות
Amplicon ו-DNA פולימראז תלוי
25-35
סופי הרחבה 70 & Dלמשל: C עד 80 ° C 5 דקות 1
החזק * 4 ° C 1

2. שולחן רגיל 3-PCR צעד אופניים.

* Quick cyclers תרמית ביותר יש את היכולת לעצור ב 4 ° C ללא הגבלת זמן בסוף המעגלים.

70 ° C עד 80 ° C
צעד 2-PCR אופניים
מחזור צעד טמפרטורה זמן מספר מחזורי
ראשוני denaturation 94 ° C עד 98 ° C 1 דקות 1
Denaturation
חישול / הרחבה
10 עד 60 שניות
Amplicon ו-DNA פולימראז תלוי
25-35
סופי הרחבה 70 ° C עד 80 ° C 5 דקות 1

לוח 3. 2 שלבים אופניים PCR.

חם התחל PCR אופניים
מחזור צעד טמפרטורה זמן מחזורי
ראשוני denaturation 60 ° C עד 95 ° C 5 דקות ואז להוסיף את ה-DNA פולימראז 1
Denaturation
רכוך
הארכה
94 ° C
5 מעלות צלזיוס מתחת T מ '
70 ° C עד 80 ° C
10 עד 60 שניות
30 שניות
Amplicon ו-DNA פולימראז תלוי
25-35
סופי הרחבה 70 ° C עד 80 ° C 5 דקות 1

לוח 4. חם אופניים התחל PCR.

הנחיתה PCR אופניים
מחזור צעד טמפרטורה זמן מחזורי
ראשוני denaturation 94 ° C עד 98 ° C 1
Denaturation
רכוך
הארכה
94 ° C
X = 10 ° C מעל T מ '
70 ° C עד 80 ° C
10 עד 60 שניות
30 שניות
Amplicon ו-DNA פולימראז תלוי
2
Denaturation
רכוך


הארכה
94 ° C
X-1 ° C להפחית 1 ° C בכל מחזור שני
70 ° C עד 80 ° C
10 עד 60 שניות
30 שניות
Amplicon ו פולימראז תלוי
28
Denaturation
רכוך
הארכה 94 ° C
5 מעלות צלזיוס מתחת T מ '
70 ° C עד 80 ° C
10 עד 60 שניות
30 שניות
Amplicon ו-DNA פולימראז תלוי
20-25
סופי הרחבה 70 ° C עד 80 ° C 5 דקות 1

לוח 5. טאצ' דאון PCR אופניים.

ההאטה PCR אופניים
מחזור צעד TEMperature זמן מחזורי
ראשוני denaturation 94 ° C עד 98 ° C 1 דקות 1
Denaturation
רכוך
הארכה
94 ° C
X ° C = 10 ° C מעל T מ '
70 ° C עד 80 ° C
10 עד 60 שניות
30 שניות
Amplicon ו פולימראז תלוי
2
Denaturation
רכוך


הארכה
94 ° C
X-1 ° C להפחית 1 ° C בכל מחזור שני
70 ° C עד 80 ° C *
10 עד 60 שניות
30 שניות
mplicon ו פולימראז תלוי
28
Denaturation
רכוך
הארכה
94 ° C
5 מעלות צלזיוס מתחת T מ '
70 ° C עד 80 ° C
10 עד 60 שניות
30 שניות
Amplicon ו פולימראז תלוי
20-25
סופי הרחבה 70 ° C עד 80 ° C 5 דקות 1

לוח 6. האטה PCR אופניים.

* לקבלת ההאטה PCR, מהירות הרמפה יורדת עד 2.5 מעלות צלזיוס s -1 עם קצב הקירור של 1.5 מעלות צלזיוס של -1 על מחזורי חישול.

המניות פתרון נפח להוסיף תגובה 50 μl 13 הורים X שמרים Mix 13 X מיקס מאסטר הפאג ריכוז סופי
סטרילית H 2 O QS ל μl 50 = 31 μl או 30.5 QS ל μl 650 = 396.5 QS ל μl = 520 μl 403
מאגר ה-PCR 10X 5 μl 65 μl 65 μl 1X
10 mM 1 μl 13 μl 13 μl 200 מיקרומטר
MgCl 2 כיול הוסיפו התגובה של כל הוסיפו התגובה של כל הוסיפו התגובה של כל במשתנה לראות טיטרציה
קדימה פריימר 20 מיקרומטר = 20 pmol / μl 1 μl 13 μl 13 μl 20 pmol
הפוך פריימר 20 מיקרומטר = 20 pmol / μl 1 μl 13 μl 13 μl 20 pmol
תבנית ה-DNA 2 ng / μl הפאג או 10 ng / μl שמרים הפאג μl 0.5 או 1 שמרים μl Μl 6.5 13 μl ~~~HEAD=NNS 10 7 מולקולות הפאג או ~ 10 שמרים 5 מולקולות
פולימראז 0.5 יחידות / ** μl 0.5 μl Μl 6.5 Μl 6.5 0.5 יחידות / תגובה
Μl 40 + 10 (טיטרציה) μl / תגובה כיול
[MgCl 2] 0.00 mM 0.5 מ"מ 1.0 מ"מ 1.5mm 2.0 mM 2.5 מ"מ 3.0 mM 3.5 מ"מ 4.0 mM 4.5 מ"מ 5.0 מ"מ
MgCl 2 0.00 μl 1.00 μl 2.00 μl 3.0 μl 4.00 μl 5.00 μl 6.00 μl 7.00 μl 8.00 μl 9.00 μl 10.00 μl
H 2 O 10.00 μl 9.00 μl 8.00 μl 7.00 μl 6.00 μl 5.00 μl 4.00 μl 3.00 μl 2.00 μl 1.00 μl 0.00 μl

<strong> לוח 7. טיטרציה של Mg 2 + שימוש באיור 3.

איור 1
באיור 1. בעיות נפוצות המתעוררות עם primers ו 3 שלבים הגברה PCR של DNA היעד. (א) עצמית של חישול primers וכתוצאה מכך היווצרות של מבנה סיכת ראש משני הלולאה. שים לב primers לא תמיד לחשל בקצוות הקיצוניים ועלול ליצור מבנים קטנים יותר לולאה. (ב) פריימר חישול זה לזה, ולא תבנית ה-DNA, יצירת הדימרים פריימר. לאחר primers את לחשל זה לזה הם להאריך עד קצה צבע יסוד. (ג) מחזורי ה-PCR יצירת amplicon ספציפי. סטנדרט 3-PCR צעד אופניים כוללים denaturation של ה-DNA תבנית, חישול של פריימרים, והרחבה של ה-DNA היעד (amplicon) על ידי ה-DNA פולימרז.

איור 2
2. איור קרח בדלי עם reagלהורים, טפטפות, והמדפים נדרש PCR. (1). P-200 פיפטה, (2). P-1000, פיפטה (3). P-20, פיפטה (4). P-10 פיפטה, (5). 96 צלחת יפה 0.2 מ"ל דקים חומה צינורות ה-PCR , (6). ריאגנטים כולל פולימראז Taq, 10X חיץ PCR, MgCl 2, מים סטריליים, dNTPs, primers, ו-DNA תבנית, (7). 1.8 צינורות מ"ל ו המדף.

איור 3
איור 3. דוגמה של 2 מ"ג + titrations בשימוש כדי לייעל את ניסוי ה-PCR באמצעות פרוטוקול סטנדרטי 3 שלבים PCR. (א) ס שמרים cerevisiae הדנ"א הגנומי שימש כתבנית כדי להגביר גן 2098 BP GAL3. במסלולים 1 - 6, שבו ריכוז 2 מ"ג + נמוך מדי, גם שם הוא לא מוצר שנוצר (מסלולים 1-5) או מעט מאוד מוצר שנוצר (מסלול 6). נתיבי 7 - 11 מייצגים ריכוזים אופטימליים של Mg 2 + עבור ניסוי זה PCR כמצוין על ידי נוכחות של המוצר BP 2098 amplicon. (ב) uncharacterimycobacteriophage Zed הגנומי תבנית ה-DNA נעשה שימוש כדי להגביר amplicon 566 נ"ב. נתיבים 1 - 4, ריכוז 2 מ"ג + נמוכה מדי, כפי שניתן בהעדר מוצר. נתיבי 5 - 11 מייצגים ריכוזים אופטימליים של Mg 2 + לכך PCR כפי שצוין על ידי נוכחות של המוצר KB 566 amplicon. (ג). ש ' שמרים cerevisiae הדנ"א הגנומי שימש כתבנית כדי להגביר 2098 BP GAL3 הגן כפי שמצוין בלוח. עם זאת, הטמפרטורה חישול ירד מ 61 ° C עד 58 ° C, וכתוצאה מכך שאינם ספציפיים להקות ה-PCR עם אורכים משתנים לייצר אפקט מריחה על ג'ל agarose. נתיבים 1 - 4, שבו ריכוז 2 מ"ג + נמוך מדי, אין מוצר שנוצר. נתיבי 5 - 8 מייצגים ריכוזים אופטימליים של Mg 2 + עבור זה PCR כפי שהוא נראה על ידי נוכחות של משטח ולהקה סביב גודל 2098 KB amplicon המוצר. מסלולים 9 - 11 מעידים על תנאים מחמירים יתר על המידה עם מוצר לא נוצר. (AC) Lanes 12 הוא negatiיש ביקורת שלא מכילה כל תבנית ה-DNA. ליין M (סמן) היתה עמוסה סולם 1KB חוד.

איור 4
באיור 4. צינורות מעוקרות המשמשים PCR. (1). 1.8 צינור מ"ל (2). 0.2 מ"ל הפרט צינור דק חומה PCR, (3). 0.2 מ"ל דקים רצועת צינורות קירות ה-PCR וכובעים.

איור 5
איור 5. Cycler תרמי. סגור תמונת Cycler תרמית שמאל. התמונה הימנית מכילה 0.2 מ"ל צינורות דקים קירות ה-PCR להציב בלוק חימום של Cycler תרמית פתוח.

Discussion

PCR הפך לכלי הכרחית בארסנל מדע הביולוגיה. PCR שינתה את מהלך המדע המאפשר ביולוגים להניב כוח על הגנום, ולהפוך גנים היברידית עם פונקציות חדשות, המאפשר ניסויים קליניים ספציפי ומדויק, צובר תובנות לתוך הגנום לבין גיוון, כמו גם שיבוט גנים פשוט לניתוח ביוכימי נוסף. יישום ה-PCR מוגבל רק על ידי הדמיון של המדען אשר מפעיל את כוחו. יש הרבה ספרים וניירות מיוחדים המתארים את השימושים החדשים של ה-PCR, ועוד רבים יפותח על הדור הבא של מדע הביולוגיה. עם זאת, ללא קשר הגישות הצפויות, את המסגרת הבסיסית נשארה זהה. PCR, בתוך כל הפאר שלה, הוא יישום במבחנה כדי לייצר כמויות גדולות של קטע מסוים של דנ"א.

תכנון הניסוי PCR דורש מחשבה וסבלנות. התוצאות המוצגות באיור 3 מדגימים אחד פרק מרכזיallenges בעת תכנון אסטרטגיית אופטימיזציה של ה-PCR. כלומר, כאשר פרמטר אחד של PCR משתנה, זה יכול להשפיע אחרת. לדוגמה, אם ה-PCR הראשוני בוצע בטמפרטורה תת אופטימלית חישול (58 ° C) עם Mg 2 + ריכוז אופטימלי של mM 2.0, אז התוצאה היתה לייצר כתם כפי שניתן לראות באיור 3 ג. ניסיון לפתור את משטח עשוי לכלול הגדרת תנאי ה-PCR עם תגובות המכילות 2.0 mM MgCl 2 והתאמת הטמפרטורה חישול 61 ° C. עם זאת, כפי שניתן לראות באיור 3 א, זו לא תניב כל מוצר. כתוצאה מכך, רצוי לכיל ריאגנטים, במקום להוסיף 1 ריכוז לתגובה אחת, כאשר פתרון בעיות תוצאות מזויפות. כמו כן, את ההתאמות הנפוצות ביותר הדרושות לייעול ניסוי ה-PCR הם לשנות את ריכוז 2 מ"ג + ולתקן הטמפרטורות חישול. עם זאת, אם שינויים אלה אינם לצמצם או לבטל תוצאות חריגים, טיטרציה של additiVes ו / או לשנות את מצבו אופניים פרוטוקולים כמתואר טבלאות 2-6 עשוי להקל על הבעיה. אם כל השאר נכשל, לעצב מחדש את primers ונסה, ונסה שוב.

Disclosures

אין לי מה לחשוף.

Acknowledgments

תודה מיוחדת קריס Reddi ב-UCLA להגדרת ריאגנטים לשפוך ג'ל וכדי ארין סנדרס באוניברסיטת קליפורניה השראה, הדרכה, תמיכה והגהה את כתב היד. אני רוצה גם תודה ג'אנקרלו Costaguta וגרגורי ס פיין לאספקת הגנומי שמרים דנ"א primers כדי להגביר את הגן GAL3. אני רוצה גם להודות שאה Bhairav ​​לצילום תמונות של ציוד מעבדה חומרים כימיים המשמשים לייצור דמויות 2 - 4. המימון לפרויקט זה סופק על ידי HHMI (HHMI גרנט מס '52006944).

Materials

Name Company Catalog Number Comments
Taq Polymeras Sigma-Aldrich D4545-25UN
dNTPs Qiagen 201225
0.2 ml Thin Wall Tubes PCR tubes Bio-Rad 223-9469
0.2 ml Thin Wall Tube caps Bio-Rad 223-9472
EDTA disodium salt dihydrate Sigma-Aldrich E5134
Trizma-HCl Sigma-Aldrich T-3253
Custom Phage Primer Invitrogen 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG
Custom Phage Primer Invitrogen 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT
Custom Yeast Primer Integrated DNA Technologies SacI-Gal3(-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG
Custom Yeast Primer Integrated DNA Technologies Gal3(1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG
Thermal Cycler Bio-Rad 170-9703 My Cycler
Agarose ISC BioExpress E-3120-500
Gel electrophoresis Hoeffer Scientific Instruments Model HE33
1 kb DNA Ladder New England Biolabs N3232S
Bio Rad Power Pack Bio-Rad 164-5050 PowerPac Basic
Gel Doc system Fotodyne Incorporated FOTO/Analyst Investigator FX Workstation

DOWNLOAD MATERIALS LIST

References

  1. Albert, J., Fenyo, E. M. Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers. J. Clin. Microbiol. 28, 1560-1564 (1990).
  2. Baskaran, N., et al. Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content. Genome Res. 6, 633-638 (1996).
  3. Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. PCR buffer optimization with uniform temperature regimen to facilitate automation. PCR Methods Appl. 2, 234-240 (1993).
  4. Borer, P. N., Dengler, B., Tinoco, I. Jr, Uhlenbeck, O. C. Stability of ribonucleic acid double-stranded helices. J. Mol. Biol. 86, 843-853 (1974).
  5. Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. Predicting DNA duplex stability from the base sequence. Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).
  6. Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications. Nucleic Acids Res. 20, 1717-1723 (1992).
  7. Coleman, W. B., Tsongalis, G. J. Diagnostics for the clinical laboration. Humana Press. (2005).
  8. D'Aquila, R. T., et al. Maximizing sensitivity and specificity of PCR by pre-amplification heating. Nucleic Acids Res. 19, 3749 (1991).
  9. Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. General concepts for PCR primer design. PCR Methods Appl. 3, S30-S37 (1993).
  10. Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. 'Touchdown' PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res. 19, 4008 (1991).
  11. Erlich, H. A., Gelfand, D., Sninsky, J. J. Recent advances in the polymerase chain reaction. Science. 252, 1643-1651 (1991).
  12. Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. PCR-amplification of GC-rich regions: 'slowdown PCR. Nat. Protoc. 3, 1312-1317 (2008).
  13. Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. Specific amplification with PCR of a refractory segment of genomic DNA. Nucleic Acids Res. 16, 11844 (1988).
  14. Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. Betaine improves the PCR amplification of GC-rich DNA sequences. Nucleic Acids Res. 25, 3957-3958 (1997).
  15. Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. PCR Protocols: A guide to methods and applications. Academic Press, Inc. San Diego. (1990).
  16. King, N. Methods in Molecular Biology. 630, Humana Press. (2010).
  17. Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases. J. Mol. Biol. 56, 341-361 (1971).
  18. Korbie, D. J., Mattick, J. S. Touchdown PCR for increased specificity and sensitivity in PCR amplification. Nat. Protoc. 3, 1452-1456 (2008).
  19. Kramer, M. F., Coen, D. M. Enzymatic amplification of DNA by PCR: standard procedures and optimization. Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).
  20. Kramer, M. F., Coen, D. M. The polymerase chain reaction. Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).
  21. Kreader, C. A. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl. Environ. Microbiol. 62, 1102-1106 (1996).
  22. Kwok, S., et al. Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection. J. Virol. 61, 1690-1694 (1987).
  23. McConlogue, L., Brow, M. A., Innis, M. A. Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine. Nucleic Acids Res. 16, 9869 (1988).
  24. Mullis, K. B. The unusual origin of the polymerase chain reaction. Sci. Am. 262, 56-65 (1990).
  25. Mullis, K. B. Target amplification for DNA analysis by the polymerase chain reaction. Ann. Biol. Clin. (Paris). 48, 579-582 (1990).
  26. Mullis, K. B. The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion). PCR Methods Appl. 1, 1-4 (1991).
  27. Mullis, K. B., Faloona, F. A. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155, 335-350 (1987).
  28. Paabo, S., Gifford, J. A., Wilson, A. C. Mitochondrial DNA sequences from a 7000-year old brain. Nucleic Acids Res. 16, 9775-9787 (1988).
  29. Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. Betaine can eliminate the base pair composition dependence of DNA melting. Biochemistry. 32, 137-144 (1993).
  30. Roux, K. H., Hecker, K. H. One-step optimization using touchdown and stepdown PCR. Methods Mol. Biol. 67, 39-45 (1997).
  31. Rychlik, W., Spencer, W. J., Rhoads, R. E. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Saiki, R. K., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, 487-491 (1988).
  33. Saiki, R. K., et al. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 230, 1350-1354 (1985).
  34. Sambrook, J. A. R., David, W. Molecular Cloning A Laboratory Manual. 2, 3, Cold Spring Harbor Laboratory Press. (2001).
  35. Sarkar, G., Kapelner, S., Sommer, S. S. Formamide can dramatically improve the specificity of PCR. Nucleic Acids Res. 18, 7465 (1990).
  36. Smit, V. T., et al. KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas. Nucleic Acids Res. 16, 7773-7782 (1988).
  37. Wilson, I. G. Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol. 63, 3741-3751 (1997).
  38. Wu, R. Methods in Enzymology. 218, Academic Press, Inc. San Diego. (1993).

Comments

1 Comment

  1. Thanks for the great overview of the all-important PCR procedure. I will no doubt reference it often in the future.

    I have a PCR troubleshooting question...what do to about streaking on the gel after a successful amplification? My bands are nice and bright and where they are supposed to be, but there is a heavily-streaked "path" starting at the wells and following until the end where my bands are. Is there something I can do about my PCR conditions, or the thermocycler settings? Any comments would be appreciated.

    Reply
    Posted by: Doug E.
    September 8, 2013 - 1:23 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics