Polymerase Chain Reaction: Basis Protocol Plus Problemen oplossen en Optimalisatie Strategieën

Biology
 

Summary

PCR heeft zich ontpopt als een veelgebruikte techniek in veel moleculair-biologische laboratoria. Mits hier is een kort overzicht van enkele conventionele PCR-protocollen. Omdat elk reactie is een uniek experiment optimale voorwaarden te genereren product variëren. Begrijpen van de variabelen in een reactie, zal ook problemen efficiency, waardoor de kans op het gewenste resultaat.

Cite this Article

Copy Citation | Download Citations

Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998, doi:10.3791/3998 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

In de biologische wetenschappen zijn er technologische ontwikkelingen die de discipline katapulteren in de gouden tijden van ontdekking. Zo werd bijvoorbeeld op het gebied van microbiologie getransformeerd met de komst van de microscoop Anton van Leeuwenhoek's, waardoor wetenschappers prokaryoten visualiseren voor de eerste keer. De ontwikkeling van de polymerase chain reaction (PCR) is een van die innovaties die de loop van de moleculaire wetenschap met de impact ervan verspreid over talloze subdisciplines in de biologie veranderd. De theoretische proces werd geschetst door Keppe en collega's in 1971, maar het was nog eens 14 jaar tot de volledige PCR-procedure werd beschreven en experimenteel toegepast door Kary Mullis terwijl Cetus Corporation in 1985. Automatisering en verfijning van deze techniek voortgang geboekt bij de invoering van een thermisch stabiele DNA polymerase van Thermus aquaticus bacterie derhalve de naam Taq DNA polymerase.

PCR is een powerful versterking techniek die een ruim aanbod van een specifiek segment van DNA (dat wil zeggen, een amplicon) van slechts een kleine hoeveelheid van het uitgangsmateriaal (dat wil zeggen, DNA-sjabloon of doelsequentie) kunnen genereren. Terwijl eenvoudig en over het algemeen zonder problemen, er zijn valkuilen die de reactie het produceren van valse resultaten bemoeilijken. Wanneer PCR mislukt, kan dit leiden tot veel niet-specifieke DNA-producten van verschillende grootte die worden weergegeven als een ladder of een uitstrijkje van bands op agarose gels. Soms is er geen producten vormen het geheel. Een ander probleem treedt op als mutaties onbedoeld geïntroduceerd in de amplicons, resulterend in een heterogene populatie van PCR-producten. PCR fouten kunnen worden frustrerend, tenzij geduld en voorzichtig het oplossen van problemen worden gebruikt om uit te zoeken en het probleem (s) op te lossen. Dit protocol beschrijft de grondbeginselen van de PCR, is een methode die zal resulteren in een versterking van de meeste doelsequenties, en presenteert strategieën voor het optimaliseren van een reactie. Door het volgen van deze PCR-gids, students moet in staat zijn om:

  • Stel reacties en thermische cycli voorwaarden voor een conventionele PCR-experiment
  • Begrijpen de functie van verschillende reactiecomponenten en de totale effect op PCR experiment
  • Ontwerp en optimaliseren PCR experiment voor DNA-template
  • Problemen met niet PCR experimenten

Protocol

1. Ontwerpen Primers

Het ontwerpen van geschikte primers is essentieel voor het welslagen van een PCR-experiment. Bij het ontwerpen van een reeks primers om een ​​specifiek gebied van DNA gewenst amplificatie, moet men primer hybridiseren aan de plus-streng, die volgens afspraak is georiënteerd in de 5 '→ 3' (ook bekend als de zin of nontemplate streng) en de andere primer moet een aanvulling zijn op de min streng, dat gericht is in de 3 '→ 5' richting (antisense of template streng). Er zijn een paar die ontstaan ​​bij het ​​ontwerpen van primers: 1) zelf-annealen van de primers resulteert in vorming van secundaire structuren zoals haarspeld lussen (figuur 1a) 2) primer annealing elkaar plaats van de DNA-template, waardoor primer dimeren (figuur 1b), 3) drastisch anders smelttemperatuur (Tm) van elke primer, waardoor het moeilijk om een hybridisatietemperatuur kiezen dat wilow beide primers om efficiënt te binden aan hun doelsequentie tijdens thermaalmeer fietsen (figuur 1c) (zie de secties BEREKENEN smelttemperatuur (T m) en aanpassingen aan CYCLING VOORWAARDEN voor meer informatie over T m s).

  1. Hieronder is een lijst van kenmerken die moeten worden overwogen bij het ontwerpen van primers.
    1. Primer lengte moet 15 tot 30 nucleotide residuen (basen).
    2. Optimale GC inhoud moet liggen tussen 40-60%.
    3. De 3'-uiteinde van primers bevatten G of C om de primer te klemmen en voorkomen "ademen" van uiteinden, waardoor priming efficiëntie. DNA "ademen" doet zich voor wanneer uiteinden blijven niet uitgegloeid, maar rafelen of splijten. De drie waterstofbruggen in GC paren voorkomen ademhaling, maar ook de smelttemperatuur van de primers.
    4. Het 3 'uiteinden van een primerset, die een plus-streng primer en een negatieve streng primer omvat, mag niet c ANVULLENDE elkaar kan het 3 'uiteinde van een primer of complementair zijn met andere sequenties in de primer. Deze twee scenario's resulteren in de vorming van primer dimeren en haarspeld lus-structuren, respectievelijk.
    5. Optimale smelttemperatuur (T m) voor primers liggen tussen 52-58 ° C, hoewel het bereik kan worden uitgebreid tot 45-65 ° C. De laatste Tm voor primers verschillen niet meer dan 5 ° C.
    6. Di-nucleotide herhalingen (bijvoorbeeld GCGCGCGCGC of ATATATATAT) of enkele base runs (bijv. AAAAA of CCCCC) dient te worden vermeden omdat ze kan leiden tot slippen langs de primer segment van DNA en of haarspeld lus-structuren te vormen. Indien noodzakelijk vanwege de aard van de DNA-template, omvatten dan alleen herhaalt of een base loopt met maximaal 4 basen.

Opmerkingen:

  1. Er zijn vele computer programma's om te helpen bij het ontwerpen primerparen. NCBI Primer design toolw.ncbi.nlm.nih.gov / tools / primer-blast / "target =" _blank "> http://www.ncbi.nlm.nih.gov/tools/primer-blast/ en Primer3 http://frodo .wi.mit.edu/primer3 / zijn aanbevolen websites voor dit doel.
  2. Met het oog op versterking van gerelateerde pseudogenen of homologen te voorkomen kan het nuttig zijn om een ​​blast op NCBI om te controleren op het doel specificiteit van de primers uit te voeren.

2. Materialen en reagentia

  1. Bij het opzetten van een PCR experiment is belangrijk om bereid. Draag handschoenen om te voorkomen dat besmetting van het reactiemengsel of reagentia. Neem een ​​negatieve controle en, indien mogelijk een positieve controle.
  2. Schik alle reagentia die nodig zijn voor de PCR-experiment in een vers gevulde ijsemmer, en laat ze volledig ontdooien voordat een reactie (figuur 2). Houd de reagentia op ijs gedurende het experiment.
    • Standaard PCR reagentia omvatten eenset primers geschikt voor het gewenste doel gen of DNA-segment te versterken, DNA polymerase, een buffer voor het specifieke DNA polymerase, deoxynucleotiden (dNTPs), DNA-template, en steriel water.
    • Extra reagentia kunnen magnesiumzout Mg2 + (bij een eindconcentratie van 0,5 tot 5,0 mM) kaliumzout K + (bij een eindconcentratie van 35 tot 100 mM), dimethylsulfoxide (DMSO, met een uiteindelijke concentratie van 1-10% ) formamide (bij een eindconcentratie van 1,25 tot 10%), runderserum albumine (bij een uiteindelijke concentratie van 10-100 ug / ml) en betaïne (bij een eindconcentratie van 0,5 M tot 2,5 M). Additieven worden verder besproken in de trouble shooting sectie.
  3. Organiseer laboratoriumapparatuur op de werkbank.
    • Materialen zijn PCR-buisjes en petten, een PCR-buis rek, een ethanol-resistente marker, en een set van micropipettors die afzien van tussen de 1 - 10 pl (P10), 2 - 20 ui (P20), 20 - 200 pi (P200)en 200 - 1000 pi (P1000), alsmede een thermische cycler.
    • Bij het opzetten van meerdere PCR-experimenten die allemaal gebruik van dezelfde reagentia, kunnen ze op passende wijze worden geschaald en gecombineerd in een master-mengsel (Master Mix). Deze stap kan worden gedaan in een steriele 1,8 ml microcentrifugebuis (zie Nota's).
    • Om amplicons gevolg van een PCR experiment, reagentia en apparatuur voor agarosegelelektroforese analyseren vereist. Om ongeveer de grootte van een PCR-product wordt een geschikte in de handel verkrijgbare molecuulgewicht standaardmaat nodig.

3. Het opzetten van een reactiemengsel

  1. Begin met een tabel van reagentia die worden toegevoegd aan het reactiemengsel (zie tabel 1).
  2. Vervolgens label PCR-buis (en) met de ethanol-resistente marker.
  3. Reactievolume afhankelijk van de concentratie van de voorraad reagentia. De eindconcentraties(CF) voor een typische 50 pi reactiemengsel als volgt.
    • X buffer (gewoonlijk door de fabrikant van het DNA polymerase, kan 15 mM MgCl2). Voeg 5 pi buffer 10X per reactie.
    • 200 uM dNTP's (50 uM van elk van de vier nucleotiden). Voeg 1 pi 10 mM dNTP per reactie (dATP, dCTP, dTTP en dGTP zijn op 2,5 mM elk).
    • 1,5 mM Mg2 +. Voeg toe alleen als het niet in de 10X buffer of zoveel als nodig voor de PCR-optimalisatie. Bijvoorbeeld, de 4,0 mM Mg2 + vereist voor optimale amplicon productie van een geconserveerd 566 bp DNA-segment in een ongekarakteriseerde Mycobacteriophage voeg 8 pi 25 mM MgCl2 aan de reactiezone (figuur 3) te verkrijgen.
    • 20-50 pmol van elke primer. Voeg 1 pi van elk 20 uM primer.
    • Voeg 10 april-10 juli moleculen (of ongeveer 1 tot 1000 ng) DNA-template. Voeg 0,5 pi 2NG / & mu; L genomische Mycobacteriophage DNA.
    • Voeg 0,5 tot 2,5 eenheden DNA polymerase per 50 pi reactie (zie fabrikant aanbevolen) Voeg bijvoorbeeld 0,5 ul van Sigma 0,5 eenheden / ul Taq DNA polymerase.
    • Voeg QS steriel gedestilleerd water tot een 50 ul eindvolume per reactie te verkrijgen als pre-bepaald in de tabel van de reagentia (QS is een Latijnse afkorting voor quantum satis wat betekent dat het bedrag dat nodig is). Aldus wordt 33 pl per reactie nodig om het volume te brengen tot 50 pi. Er moet echter worden opgemerkt dat water werd toegevoegd maar vereist aanvankelijk maken van een tabel van de reagentia en de bepaling van de volumes van andere reagentia aan het reactiemengsel toegevoegd.

4. Basis PCR Protocol

  1. Plaats een plaat met 96 putjes in het ijs emmer als een houder voor de 0,2 ml dunwandige PCR-buisjes. Het toestaan ​​van PCR-reagentia worden toegevoegd aan koude 0,2 ml dunwandige PCR-buisjes zal helpen bij het voorkomen celkerne activiteit en niet-specifieke priming.
  2. Pipetteer de volgende PCR reagentia in de volgende volgorde in een 0,2 ml dunwandige buis PCR (figuur 4) steriel water, 10X PCR buffer, dNTP, MgCl2, primers en template DNA (zie tabel 1). Omdat experimenten moeten ten minste een negatieve controle, en eventueel een positieve controle, is het gunstig voor het opzetten van een Master Mix in een 1,8 ml microcentrifugebuis (uitleg Notes See).
  3. In een afzonderlijke 0,2 ml dunwandige PCR buizen (figuur 4) voeg alle reagentia met uitzondering van template DNA voor een negatieve controle (water verhogen ter compensatie van de ontbrekende volume). Bovendien moet een reactie (als reagentia beschikbaar) bevatten positieve controle met DNA en of primers voorheen aan te vullen onder dezelfde voorwaarden als de experimentele PCR buizen.
  4. Taq DNA-polymerase wordt meestal opgeslagen in een 50% glyceroloplossing en volledige spreiding in het reactiemengsel nodig voorzichtig mengen van de PCR reagentia van en neer te pipetteren minstens 20 maal. De micropipettor moet worden ingesteld op ongeveer de helft van de reactie volume van de master mix bij het mengen, en de zorg moeten worden genomen om te voorkomen dat er bubbels.
  5. Zet doppen op de 0,2 ml dunwandige PCR-buisjes en plaats ze in de PCR-apparaat (figuur 5). Zodra de deksel op de PCR-apparaat goed gesloten is, start het programma (zie tabel 2).
  6. Wanneer het programma klaar is, kan de 0,2 ml dunwandige buizen PCR worden verwijderd en bewaard bij 4 ° C. PCR-producten kunnen worden gedetecteerd door het laden aliquots van elke reactie in putten van een agarosegel dan kleuring DNA dat migreren in het gel na elektroforese met ethidiumbromide. Als een PCR product aanwezig is, zal de ethidium bromide intercaleren tussen de bases van de DNA strengen, waarbij banden worden gevisualiseerd op een UV illuminator. </ Li>

Opmerkingen:

  1. Het instellen van meerdere PCR experimenten is het voordelig te monteren van een mengsel van reagentia voor alle reacties (, Master Mix). Gewoonlijk cocktail bevat een oplossing van DNA polymerase, dNTP, reactiebuffer en water verzameld in een 1,8 ml microcentrifugebuisje. De hoeveelheid van elk reagens toegevoegd Master Mix gelijk is aan het totaal aantal reacties plus 10% afgerond naar de dichtstbijzijnde hele reactie. Bijvoorbeeld, als er 10 x 0,1 = 1 reactie dan (10 + 1) x 5 pi buffer 10X bedraagt ​​55 ul 10X buffer voor de Master Mix. De reagentia in de Master Mix grondig gemengd door voorzichtig pompen van de plunjer van een micropipettor en neer 20 maal zoals hierboven beschreven. Elke PCR buis ontvangt een hoeveelheid Master Mix waarvan de DNA-template, elke gewenste primers en experiment reagentia vervolgens toegevoegd (zie tabel 1 en 7).
  2. De following website biedt een calculator voor het bepalen van het aantal kopieën van een template DNA ( http://www.uri.edu/research/gsc/resources/cndna.html ). Het aantal kopieën van dubbelstrengs DNA kan worden berekend met de volgende vergelijking:
    Aantal kopieën van DNA = (DNA bedrag (ng) x 6.022x10 23) / (lengte van de DNA-x 1x10 9 ng / ml x 650 Dalton)
    Berekening van het aantal kopieën van DNA wordt gebruikt om te bepalen hoeveel template nodig is per reactie.
  3. Valse positieven kan optreden als gevolg van de overdracht van een PCR-reactie die gevisualiseerd met meervoudige ongewenste producten op een agarosegel na elektroforese. Daarom is het verstandig gebruik juiste techniek, onder een negatieve controle (positieve controle en indien mogelijk).
  4. Terwijl ethidiumbromide is de meest voorkomende vlekken fof nucleïnezuren er verschillende veiliger en toxische alternatieven. De volgende website beschrijft een aantal van de alternatieven, waaronder methyleenblauwactieve, Crystal Violet, SYBR Veilig, en Gel Red, samen met beschrijvingen van het gebruik en sporen van het eindproduct ( http://bitesizebio.com/articles/ethidium-bromide-the- alternatieven / ).
  5. Terwijl de meeste moderne PCR-machines te gebruiken 0,2 ml buizen, kunnen sommige modellen vereisen reacties in 0,5 ml buizen. Zie de thermische fietsers handleiding om de juiste grootte buis te bepalen.

5. Berekening smelttemperatuur (Tm)

  1. Kennis van de smelttemperatuur (Tm) van de primers noodzakelijk voor een succesvolle PCR experiment. Hoewel er verschillende T m rekenmachines beschikbaar zijn, is het belangrijk op te merken dat deze berekeningen zijn een schatting van de werkelijke T m door van een gebrek aan specifieke informatie over een bepaalde reactie en aannames in de algoritmen voor de T m rekenmachines zelf. Echter, naaste buren thermodynamische modellen de voorkeur boven de meer conventionele berekening: T m ≈ 4 (GC) + 2 (AT). De eerste zal nauwkeurigere T m schatting, omdat het rekening houdt met de stapeling energie van naburige basenparen. Dit laatste wordt vaker gebruikt omdat de berekeningen zijn eenvoudig en snel met de hand. Zie Problemen oplossen voor informatie over hoe de verschillende PCR-condities en additieven van invloed zijn smelttemperatuur.
    Voor de berekening van de T m waarden door naaste buren thermodynamische modellen, een van de volgende calculators wordt aanbevolen:
    http://www6.appliedbiosystems.com/support/techtools/calc/
    edu / ~ zimmer / oligoTMcalc.html "target =" _blank "> http://www.cnr.berkeley.edu/ ~ zimmer / oligoTMcalc.html
    http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/
    http://www.finnzymes.com/tm_determination.html~~V
    http://mobyle.pasteur.fr/cgi-bin/portal.py? # formulieren :: smelten

6. Instellen Thermische Fietsen Voorwaarden

  1. PCR thermische fietsers snel verwarmen en te koelen het reactiemengsel, waardoor warmte opgewekte denaturatie van duplex DNA (streng scheiden) hybridisatie van primers de plus en min strengen van de DNA-template, en de rek van het PCR-product. Cyclustijden worden berekend op basis van de grootte van de matrijs en de GC-gehalte van het DNA. De algemene formuleen begint met een eerste denaturatiestap bij 94 ° C tot 98 ° C afhankelijk van de optimale temperatuur voor DNA polymerase activiteit en GC-gehalte van het template-DNA. Een typische reactie wordt met een minuut denaturatie start bij 94 ° C. Langer dan 3 minuten kan inactiveren van de DNA-polymerase, het vernietigen van de enzymatische activiteit. Een werkwijze, de zogenaamde hot-start PCR strekt drastisch de initiële denaturatie tijd van 3 minuten tot 9 minuten. Met hot-start PCR wordt het DNA polymerase toegevoegd na de eerste overdreven denaturatiestap is voltooid. Dit protocol modificatie voorkomen kunnen inactivering van het DNA polymerase enzym. Raadpleeg het gedeelte Problemen oplossen van dit protocol voor meer informatie over hot start PCR en andere alternatieve methoden.
  2. De volgende stap is om de thermische cycler op de eerste van 25 tot 35 ronden van drie stappen temperatuurcyclus (tabel 2) leiden. Hoewel het aantal cycli boven 35 resulteert in eengrotere hoeveelheid van PCR-producten te vele rondes resulteert vaak in de verrijking van ongewenste nevenproducten. De drie stappen temperatuur in een cyclus drieledig taken: de eerste stap denatureert de sjabloon (en later cycli de amplicons en), de tweede stap kan een optimale hybridisatie van primers, en de derde stap laat de DNA polymerase te binden aan de DNA-template en synthetiseren het PCR-product. De duur en de temperatuur van elke stap een cyclus worden gewijzigd om de productie van de gewenste amplicon optimaliseren.
    De tijd voor de denaturatiestap zo kort mogelijk. Gewoonlijk 10 tot 60 seconden is voldoende voor de meeste DNA templates. De denaturatie en temperatuur is afhankelijk van de GC-gehalte van het template-DNA, evenals de helling snelheid, de tijd die de thermische cycler veranderen van een temperatuur naar de volgende. De temperatuur voor deze stap is meestal dezelfde als die gebruikt worden voor de initiële denaturatie fase(Stap 1 hierboven wordt vermeld, bijvoorbeeld, 94 ° C).
    Een 30 seconden gloeien stap volgt in de cyclus bij een temperatuur in te stellen op ongeveer 5 ° C beneden de schijnbare Tm van de primers (ideaal tussen 52 ° C tot 58 ° C).
    De cyclus wordt afgesloten met een verlengingsstap. De temperatuur is afhankelijk van de DNA polymerase gekozen voor het experiment. Bijvoorbeeld Taq DNA polymerase heeft een optimale rek van 70 ° C tot 80 ° C en 1 minuut heeft de eerste 2 kb langwerpige, dan vereist een extra minuut per extra versterkt 1 kb. Pfu DNA-polymerase is een thermostabiel enzym dat een optimale rek temperatuur van 75 ° C. Pfu DNA-polymerase wordt aanbevolen voor gebruik in PCR en primer extension reacties high fidelity vereisen en op 2 minuten per 1 kb te amplificeren. Zie aanbevelingen van de fabrikant voor exacte rek temperaturen en rek de tijd die voor elk specifieke DNA-polymerase.
  3. Taq DNA polymerase, maakt de toevoeging van een adenine residu in de 3'-uiteinden van PCR-producten. Deze wijziging wordt bewerkstelligd door de terminal transferase-activiteit van Taq DNA polymerase en bij latere moleculair klonen procedures dat een 3'-overhangende vereisen.
  4. Beëindiging van de reactie wordt bereikt door het koelen van het mengsel tot 4 ° C en / of door toevoeging van EDTA tot een eindconcentratie van 10 mM.

7. Belangrijke overwegingen bij het oplossen PCR

Als standaard PCR-condities niet tot het gewenste amplicon, PCR-optimalisatie is nodig om betere resultaten te bereiken. De stringentie van een reactie kan worden gemoduleerd, dat de specificiteit wordt bijgesteld door variabelen (bijvoorbeeld reagensconcentraties, fietsen voorwaarden) dat de uitkomst van de amplicon profiel beïnvloeden. Als bijvoorbeeld de reactie niet streng genoeg zullen vele valse amplicons gegenereerd met variabele lengten. Als de reactie te streng geen product worden geproduceerd. Problemen met PCR-reacties kan een frustrerende onderneming op keer. Echter, zorgvuldige analyse en een goed begrip van de reagentia in een PCR experiment minder tijd en proeven om de gewenste resultaten te verkrijgen. Van alle overwegingen die van invloed zijn PCR stringentie, titratie van Mg 2 + en / of manipuleren van annealing temperaturen zal waarschijnlijk de meeste problemen. Echter, voordat u wat dan ook, er zeker van zijn dat een foutieve resultaat niet was te wijten aan menselijke fouten. Start de bevestiging van alle reagentia werden toegevoegd aan een bepaalde reactie en de reagentia niet verontreinigd. Let ook op de foutieve resultaat, en de volgende vragen: Zijn primer dimeren zichtbaar op de gel na electrophoweerstand (deze termijn als kleine bands <100 b buurt van de onderkant van de baan)? Zijn er niet-specifieke producten (bands die migreren naar een ander formaat dan het gewenste product)? Was er een gebrek aan een product? Is het doel-DNA op een plasmide of in een genomisch DNA-extract? Ook is het verstandig om het analyseren van de GC-gehalte van de gewenste amplicon.

  1. Bepaal eerst als een van de PCR-reagentia zijn katastrofisch naar uw reactie. Dit kan worden bereikt door het bereiden van nieuwe reagentia (bv. vers werkvoorraad nieuwe verdunningen) en vervolgens toevoeging van een nieuw systematisch reagens voor een aan reactiemengsels. Dit proces zal bepalen welke reagens was de boosdoener voor de mislukte PCR experiment. In het geval van zeer oud DNA, die vaak accumuleert remmers is aangetoond dat toevoeging van runderserumalbumine kan helpen verlichten van het probleem.
  2. Primer dimeren kunnen vormen wanneer primers voorkeur zelf hybridiseren of hybridiseren aan de andere primer in de reactie. Als dit gebeurt, eenproduct van minder dan 100 bp wordt op de agarosegel. Start door verandering van de verhouding van sjabloon primer, indien de primer concentratie in extreme overschrijding van de sjabloon concentratie dan de primers zijn eerder op zichzelf of elkaar gloeien op de DNA-template. Het toevoegen van DMSO en of het gebruik van een warme start thermische cycli methode kan het probleem oplossen. Uiteindelijk kan het nodig zijn om nieuwe primers te ontwerpen.
  3. Niet-specifieke producten worden geproduceerd wanneer PCR stringentie excessief laag resulteert in niet-specifieke PCR banden met variabele lengten. Dit produceert een ladder effect op een agarose gel. Het is dan aan te raden om PCR-condities die te verhogen strengheid te kiezen. Een uitstrijkje van verschillende grootte kunnen ook het gevolg zijn van primers ontworpen om zeer repetitieve sequenties bij het versterken van genomisch DNA. Echter dezelfde primers kunnen een doelsequentie op een plasmide versterken zonder op hetzelfde probleem.
  4. Gebrek aan PCR producten kan door reactieomstandighedendie te streng zijn. Primer dimeren en haarspeld lus structuren vormen met de primers of in de gedenatureerde template DNA kan ook voorkomen amplificatie van PCR producten doordat deze moleculen kan raken basepaar de gewenste DNA tegenhanger.
  5. Indien de GC-gehalte niet is geanalyseerd, is het tijd om dit te doen. PCR van GC rijke regio's (GC-gehalte> 60%) vormen een aantal van de grootste uitdagingen voor PCR. Er zijn echter vele toevoegingen die gebruikt zijn om de problemen te verminderen.

8. Het manipuleren van PCR-reagentia

Begrijpen van de functie van reagentia op conventionele PCR essentieel wanneer de eerste bepalen hoe de reactie wijzigen in het gewenste product te verkrijgen. Succes gewoon een beroep kan doen op het veranderen van de concentratie van MgCl2, KCl, dNTP, primers, template-DNA of DNA-polymerase. Echter, de verkeerde concentratie van deze reagentia tot valse resultaten, waardoor het stringency van de reactie. Bij het oplossen PCR moet slechts een reagens worden gemanipuleerd tegelijk. Het kan echter verstandig zijn om de gemanipuleerde reagens titreren.

  1. Magnesiumzout Mg2 + (uiteindelijke reactieproduct concentratie van 0,5 tot 5,0 mM)
    Thermostable DNA polymerase vereisen de aanwezigheid van magnesium als een cofactor optreden tijdens de reactiewerkwijze. Het wijzigen van de magnesium concentratie is een van de gemakkelijkste reagentia te manipuleren met misschien wel de grootste invloed op de striktheid van PCR. In het algemeen zal het PCR product opbrengst stijgen met de toevoeging van hogere concentraties van Mg 2 +. Verhoogde concentraties Mg2 + eveneens af van de specificiteit en betrouwbaarheid van de DNA polymerase. De fabrikanten van een oplossing van magnesium-chloride (MgCl2) met het DNA polymerase en 10X PCR bufferoplossing. De 10 X PCR buffer oplossingen kunnen 15 mM MgCl2, is voldoende voor een typische PCRreactie, of kan afzonderlijk worden toegevoegd in een concentratie geoptimaliseerd voor een bepaalde reactie. Mg2 + wordt niet verbruikt in de reactie, maar de reactie kan niet verder zonder aanwezig. Wanneer er teveel Mg2 +, kan volledig denaturatie van het template DNA voorkomen stabiliseren duplex streng. Te veel Mg2 + ook stabiliseren parasitaire hybridisatie van primers onjuiste sjabloonsites en afname specificiteit resulterend in ongewenste PCR producten. Als er niet voldoende Mg2 +, zal de reactie niet verder, waardoor er geen PCR product.
  2. Kalium zout K + (laatste reactie concentratie van 35 tot 100 mm)
    Langere PCR-producten (10 tot 40 kb) kunnen baat kaliumzout (KCl) van de normale 50 mM reactie concentratie, vaak samen met de toevoeging van DMSO en / of glycerol. Als de gewenste amplicon minder dan 1000 bp lange niet-specifieke producten vormen, specificity kan worden verbeterd door titreren KCl, verhoging van de concentratie in 10 mM stappen tot 100 mM. Verhoging van de zoutconcentratie maakt korter DNA moleculen voorkeur denatureren langer DNA moleculen.
  3. Deoxynucleotide 5'-trifosfaten (uiteindelijke reactieproduct concentratie van 20 en 200 pM elk)
    Deoxynucleotide 5'-trifosfaten (dNTPs) kan problemen veroorzaken voor de PCR als ze niet op de juiste equivalente concentraties (dat wil zeggen, [A] = [T] = [C] = [G]) en / of als gevolg van hun instabiliteit van herhaalde invriezen en ontdooien. De gebruikelijke dNTP concentratie 50 uM van elk van de vier dNTP's. Echter, PCR verdragen concentraties tussen 20 en 200 pM elk. Lagere concentraties van dNTPs kunnen verhogen zowel het specifieke karakter en de trouw van de reactie terwijl een overmaat aan dNTP concentraties daadwerkelijk kunnen remmen PCR. Voor langere PCR-fragmenten, kan een hogere dNTP concentratie vereist. Een grote verandering in de concentratie dNTP kan het nodig Corresonderdompeling verandering in de concentratie van Mg2 +.
  4. Thermische stabiele DNA-polymerasen
    PCR enzymen en buffers in verband met deze enzymen hebben een lange weg afgelegd sinds de eerste Taq DNA-polymerase werd voor het eerst gebruikt. Zo kan het kiezen van een geschikt enzym nuttig zijn voor het verkrijgen van gewenste amplicon producten. Bijvoorbeeld van het gebruik van Taq DNA polymerase kan worden boven Pfu DNA-polymerase als processivity en / of de toevoeging van een adenine residu uiteinden van de 3 'van het PCR-product wordt gewenst. De toevoeging van een 3 'adenine is een nuttige strategie voor kloneren PCR producten in TA vector whit 3' overhangende thymine. Echter, als trouw is belangrijker een enzym als Pfu kan een betere keuze zijn. Verschillende fabrikanten hebben een scala aan specifieke DNA-polymerase is ontworpen voor speciale doeleinden. Neem een ​​kijkje op de reactie-omstandigheden en kenmerken van de gewenste amplicon en vervolgens overeenkomen met de PCR-experiment met de juiste DNA-polymerase. De meeste fabrikanten hebben tabellen die hulp DNA polymerase selectie door een opsomming van kenmerken zoals trouw, rendement, snelheid, optimale doel lengtes, en of het nuttig is voor GC-rijke-amplificatie of warme start PCR.
  5. Template DNA
    DNA-kwaliteit en zuiverheid zal hebben een substantieel effect op de kans op een succesvolle PCR experiment. DNA en RNA kan worden bepaald met hun optische dichtheidsmetingen bij 260 nm (OD 260). De massa van gezuiverde nucleïnezuren in oplossing wordt berekend op 50 ug / ml van dubbelstrengs DNA of 40 ug / ml voor een RNA of enkelstrengs DNA in een 260 OD = 1,0. DNA-extractie verontreinigingen komen vaak voor-remmers in de PCR en moet zorgvuldig worden vermeden. Gemeenschappelijke DNA-extractie remmers van de PCR onder andere eiwitten, RNA, organische oplosmiddelen, en detergenten. De maximale opname van nucleïnezuren OD 260 vergeleken met die van eiwitten OD280 (OD 260/280), is het mogelijk te bepalen tussene een schatting van de zuiverheid van geëxtraheerde DNA. Idealiter de verhouding OD 260/280 tussen 1,8 en 2,0. Lagere OD 260/280 is kenmerkend voor eiwitten en / of oplosmiddel verontreiniging die in alle waarschijnlijkheid zullen problematisch PCR.
    Naast de kwaliteit van template DNA optimalisatie van de hoeveelheid DNA kan baat het resultaat van een PCR experiment. Hoewel het handig om de hoeveelheid in ng / ul, die vaak de uitgang voor moderne nanospectrophotometers bepalen de betreffende eenheid voor een succesvolle PCR experiment is het aantal moleculen. Dat wil zeggen, hoeveel exemplaren van de DNA-template bevat een sequentie complementair aan de PCR-primers? Optimale doelmoleculen zijn tussen 10 april-10 juli moleculen kan worden berekend zoals beschreven in de toelichting hierboven.

9. Additief Reagentia

Additief reagentia kunnen resultaten opleveren wanneer al het andere faalt. Het begrijpen van de reagentiaen welke ze worden gebruikt voor essentieel te bepalen welke reagentia kan het meest effectief in het verkrijgen van het gewenste PCR-product. Toevoegen reagentia de reactie wordt gecompliceerd door het feit dat het bedienen van een reagens kan de bruikbare concentratie van een reagens beïnvloeden. Naast de reagentia onderstaande eigen handel verkrijgbare additieven zijn beschikbaar bij talloze biotechnologiebedrijven.

10. Additieven die GC Rich Sjablonen Profiteer

  1. Dimethylsulfoxide (finale concentratie reactie van 1-10% DMSO)
    In PCR experimenten waarin de template DNA bijzonder GC rijke (GC gehalte> 60%), toevoegen DMSO kan de reactie door het verstoren baseparing en doeltreffend verlagen Tm verbeteren. Sommige T m rekenmachines met een variabele ingang voor het toevoegen van de concentratie van DMSO in het gewenste PCR experiment. Echter, het toevoegen van meer dan 2% DMSO nodig toevoegen van DNA polymerase zoals is aangetoondtoond met Taq DNA polymerase remmen.
  2. Formamide (uiteindelijke concentratie van reactie 1,25 tot 10%)
    Zoals DMSO, formamide verstoort ook baseparing tegelijk de stringentie van hybridisatie primer, waardoor minder niet-specifieke primer en verhoogde efficiëntie amplificatie. Formamide ook is aangetoond dat een versterker voor GC rijke templates.
  3. 7-deaza-2'-deoxyguanosine 5'-trifosfaat (laatste reactie concentratie van dc 7 GTP; 3 v 7 GTP: 1 dGTP 50 pM)
    Met 3 delen, of 37,5 uM van guanosine base analoge dc 7 GTP samen met een deel of 12,5 uM, dGTP tot vorming van secundaire structuren te destabiliseren het product. Als amplicon of template-DNA wordt gedenatureerd wordt vaak gevormd secundaire structuren zoals haarspeld lussen. Het opnemen van dc 7 GTP in het DNA amplicon zal verbieden vorming van deze afwijkende structuren.

Opmerking:

7 GTP verzwakt het signaal van kleuring met ethidiumbromide dat is waarom het wordt gebruikt in een 3:1 verhouding met dGTP.

  1. Betaïne (laatste reactie concentratie van 0,5 m tot 2,5 MB)
    Betaïne (N, N, N-trimethylglycine) een zwitterionische aminozuur analoge dat vermindert en kan zelfs alle DNA smelttemperatuur afhankelijkheid nucleotide samenstelling. Het wordt gebruikt als een additief voor PCR amplificatie van GC rijke doelen te bevorderen. Betaïne wordt vaak gebruikt in combinatie met DMSO en kan sterk de kans versterkende doel DNA te verbeteren met hoge GC gehalte.

11. Additieven die PCR op Help in de aanwezigheid van remmers

  1. Niet-ionische detergenten functioneren naar secundair structuurvorming te onderdrukken en het stabiliseren van de DNA-polymerase te helpen. Niet ionogene detergenten, zoals Triton X-100, Tween 20 of NP-40 kan worden gebruikt reactie concentraties van 0,1 tot 1% teneinde amplicon verhogen. Echter, Concentreidingen dan 1% kan remmend PCR. De aanwezigheid van niet-ionische detergentia afneemt PCR stringentie, kan leiden tot valse productvorming. Toch zal het gebruik ervan ook neutraliseren van de remmende invloed van de SDS, af en toe een verontreiniging van DNA-extractie protocollen.
  2. Toevoeging van specifieke eiwitten zoals Bovine serum albumine (BSA) gebruikt bij 400 ng / pl en / of gen 32 T4 eiwit 150 ng / ul PCR steun in aanwezigheid van inhibitoren zoals FeCl3, hemine, fulvinezuur, humuszuur, looizuur, of uittreksels uit de ontlasting, zoet water en zeewater. Echter, sommige PCR remmers, zoals galzouten, bilirubine, EDTA, NaCl, SDS, en Triton X-100, niet verminderd door toevoeging van een BSA of T4 gen 32 eiwit.

12. Wijzigingen in Fietsen Voorwaarden

  1. Het optimaliseren van de hybridisatietemperatuur verbetert een PCR reactie en moet worden beschouwd in combinatie met andere toevoegsels en / of samen met andere mo difications fietsen omstandigheden. Dus, om een ​​optimaal hybridisatietemperatuur berekenen volgende vergelijking toegepast:
    T een OPT = 0,3 T m Primer + 0,7 T m Product -14,9
    T m Primer wordt berekend als het T m van het minder stabiele paar met de formule:
    T m Primer = ((DH / (ΔS + R x ln (c / 4))) -273,15 + 16,6 log [K +] Wanneer AH is de som van de dichtstbijzijnde buren enthalpie veranderingen van hybriden ΔS is de som van de dichtstbijzijnde buren entropie veranderingen, R de gasconstante (1,99 cal K-1 mol-1); C de primer concentratie en [K +] de concentratie kalium.
    Deze laatste vergelijking kan worden berekend met behulp van een van de T m rekenmachines vermeld op de volgende website:
    rs / smelt / sup_mat / servers_list.html "target =" _blank "> http://protein.bio.puc.cl/cardex/servers/melting/sup_mat/servers_list.html
    T m product wordt berekend als volgt:
    T m Product = 0,41 (% GC) + 16,6 log [K +] - 675/product lengte
    Voor de meeste PCR reacties de concentratie van kalium ([K +]) gaat 50 mM.
  2. Warme start PCR is veelzijdig modificatie in de oorspronkelijke denaturatie drastisch wordt verhoogd (Tabel 4). Deze wijziging kan worden opgenomen met of zonder andere aanpassingen aan fietsen omstandigheden. Bovendien wordt het vaak gebruikt in combinatie met additieven voor temperamentvolle amplicon vorming. In feite is warme start PCR steeds opgenomen regelmatige aspect van algemene fietsomstandigheden. Hot start is aangetoond dat amplicon opbrengst te verhogen, terwijl het verhogen van de specificiteit en de trouw van de reactie.De reden hete start PCR op te heffen primer-dimeer en niet-specifieke priming die kan leiden als gevolg van het opzetten van de reactie onder de Tm. Een typisch hete start reactie verwarmt het monster op een temperatuur boven de optimale Tm, ten minste 60 ° C voordat amplificatie kunnen plaatsvinden. In het algemeen wordt het DNA polymerase onthouden de reactie in de eerste langwerpige, denaturerende tijd. Hoewel andere componenten van de reactie worden soms plaats weggelaten van de DNA polymerase, hier is gericht op de DNA polymerase. Er zijn verschillende methoden waarmee de DNA polymerase te blijven inactief of fysiek gescheiden tot de eerste denaturatie periode is voltooid, zoals het gebruik van een vaste was barrière anti-DNA-polymerase antilichamen en additionele eiwitten. Alternatief kan de DNA polymerase eenvoudig toegevoegd aan het reactiemengsel na initiële denaturatie voltooid is.
  3. Touchdown PCR (TD-PCR) isbedoeld om een aantal van de gissing uitwerkt van de T m berekening beperkingen van bracketing de berekende gloeien temperaturen. Het concept is het ontwerpen van twee fasen van het fietsen voorwaarden (tabel 5). De eerste fase heeft naastlagere gloeien temperaturen elke seconde (traditioneel 1,0 ° C), vanaf 10 ° C boven en eindigend bij de berekende T m of iets lager. Fase twee gebruik van de standaard drie stappen omstandigheden de hybridisatietemperatuur ingesteld op 5 ° C onder de berekende T m voor andere 20 tot 25 cycli. De functie van de eerste fase te verlichten mispriming, geven een 4-voudige voordeel de juiste product. Zo, na 10 cycli, zou een 410-voudige voordeel opleveren 4096 exemplaren van het juiste product over een valse priming.
    • Stepdown PCR is vergelijkbaar met TD-PCR met minder stappen in de eerste fase van priming. Als voorbeeld, de eerste fase verlaagt gloeien temperaturen elketweede cyclus 3 ° C, te beginnen bij 10 ° C boven en eindigt bij 2 ° C onder de berekende Tm. Zoals TD-PCR fase twee gebruik van de standaard drie stappen omstandigheden de hybridisatietemperatuur ingesteld op 5 ° C onder de berekende T m voor andere 20 tot 25 cycli. Dit zou het juiste product kan een 256-voudige voordeel ten opzichte van valse priming producten.
    • Vertraging PCR is slechts een modificatie van TD-PCR en is succesvol amplificeren zeer GC rijke (boven 83%) sequenties (Tabel 6). Het concept rekening gehouden met een relatief nieuwe functie van een moderne thermische fietsers, waarmede het helling snelheid en de koelsnelheid toelaat. Het protocol maakt ook gebruik van dc 7 GTP te verminderen 2 ° structuurvorming dat de reactie zou kunnen remmen. De helling snelheid wordt verlaagd tot 2,5 ° C is 1 met een afkoelsnelheid van 1,5 ° C en -1 voor het gloeien cycli. De eerste fase begint met een eennealing temperatuur van 70 ° C en vermindert de hybridisatietemperatuur met 1 ° C per drie rondes tot in 58 ° C. De tweede fase gaat dan verder met een hybridisatietemperatuur van 58 ° C tegen 15 cycli.
  4. Geneste PCR is een krachtig instrument dat wordt gebruikt om valse producten te elimineren. Het gebruik van geneste primers is vooral handig als er meerdere paraloog genen in een genoom of wanneer er een laag kopie-aantal van een doelsequentie binnen een heterogene populatie van orthologe sequenties. De basis procedure omvat twee primers die een enkel gebied van DNA amplificeren. De buitenste primers weerszijden het segment van belang en worden gebruikt om PCR-producten die vaak niet-specifieke 20 tot 30 cycli genereren. Een kleine hoeveelheid, gewoonlijk ongeveer 5 ul van de eerste 50 pi reactiemengsel wordt vervolgens gebruikt als de template DNA voor andere 20 tot 30 rondes van amplificatie met behulp van de tweede reeks primers die hybridiseren aan een interne plaats ten opzichtede eerste reeks.

Andere PCR-protocollen zijn meer gespecialiseerd en gaan buiten het bestek van dit artikel. Voorbeelden zijn RACE-PCR, Multiplex-PCR, vectorette PCR-, kwantitatieve PCR-en RT-PCR.

13. Representatieve resultaten

Representatieve PCR resultaten zijn gegenereerd door de basis PCR protocollen zoals hierboven beschreven. De resultaten om diverse problemen strategieën om het effect van verschillende reagentia en voorwaarden blijkt de reactie. Genen van de gist Saccharomyces cerevisiae en uit een ongekarakteriseerde Mycobacteriophage geamplificeerd in deze experimenten. De standaard drie stappen PCR-protocol beschreven in Tabel 2 werd gebruikt voor drie proeven beschreven.

Voor het opzetten van de PCR-experiment, het genomisch DNA van zowel S. cerevisiae en Mycobacteriophage werden gekwantificeerd en verdund tot een concentratie die zou allow tussen 10 en 10 7 4 moleculen per DNA reactie. De werkvoorraad werden als volgt bereid. Een genomische gist DNA bereiding leverde 10 4 ng / pl. Een verdunning tot 10 ng / pl gegenereerd door toevoeging 48 pi in 452 ul van TE-buffer pH 8,0. Aangezien S. cerevisiae genoom is ongeveer 12,5 Mb, 10 ng bevatten 7,41 X 10 5 moleculen. De genomische DNA Mycobacteriophage bereiding leverde 313 ng / pl. Een verdunning 2 ng / ul werd gegenereerd door toevoeging 6,4 pi in 993,6 pi TE-buffer pH 8,0. Deze faag DNA is ongeveer 67 Kb. Aldus 1 ng bevat 2,73 X 10 7 moleculen, die aan de bovengrens van DNA algemeen gebruikt voor een PCR. De werkvoorraad werden vervolgens gebruikt om de Master Mix oplossingen die in Tabel 7 genereren. Experimenten gevarieerd fietsen, zoals hieronder beschreven.

In figuur 3a, genomisch DNA van S. cerevisiae werd gebruikt als template te versterkende GAL3 gen dat een proteïne betrokken bij galactose metabolisme codeert. Het doel van dit experiment was de optimale Mg2 +-concentratie voor deze reeks reagentia bepalen. Nr. MgCl2 aanwezig was in de oorspronkelijke PCR buffer moet worden aangevuld in de aangegeven concentraties een geteste van 0,0 mM tot 5,0 mM. Zoals in de figuur een PCR-product van de verwachte grootte (2098 bp) weergegeven vanaf een Mg2 +-concentratie van 2,5 mM (laan 6) met een optimale concentratie van 4,0 mM (baan 9). De aanbevolen concentraties van de fabrikant was 1,5 mM, dat het bedrag dat in typische PCR buffers. Misschien verrassend, de nodige concentratie die nodig is voor productvorming in dit experiment boven deze waarde.

Een andere DNA-template werd gebruikt voor het experiment in figuur 3b. Genomisch DNA uit Mycobacteriophage werd een geconserveerde 566 bp DNA-segment amplificeren.Net als de vorige experiment, de optimale Mg2 +-concentratie moest worden bepaald. Zoals getoond in figuur 3b, amplificatie van de gewenste PCR-product heeft tenminste 2,0 mM Mg2 + (laantje 5). Hoewel er meer variatie van de hoeveelheid gevormd produkt bij toenemende concentraties van MgCl2, werd de PCR product waargenomen 4 mM Mg2 + (baan 9), dezelfde concentratie waargenomen voor de gist GAL3 gen.

Merk op dat in de experimenten in de figuren 3A en 3B een discrete band verkregen met de cycluscondities vermoedelijk optimaal op primer annealing temperaturen. Met name de denaturatie temperatuur was 95 ° C met een hybridisatietemperatuur van 61 ° C en de toestel is uitgevoerd gedurende 1 minuut bij 72 ° C gedurende 30 cycli. De laatste 5 minuten verlenging werd vervolgens uitgevoerd bij 72 ° C. Voor de derde experiment in figuur 3c figuur 3c, wat een discrete band in figuur 3a, wordt een uitstrijkje van niet-specifieke producten onder deze suboptimale fietsomstandigheden. Bovendien met de algemene stringentie van verminderde de reactie een lagere hoeveelheid Mg2 + nodig is om een amplicon vormen.

Alle drie experimenten blijkt dat bij Mg2 +-concentraties te laag is er geen amplicon productie. Deze resultaten tonen ook aan dat wanneer zowel de fiets-voorwaardencorrect ontworpen en de reagentia bij optimale concentraties van de PCR experiment levert een discreet amplicon die overeenkomt met de verwachte grootte. De resultaten tonen het belang van het uitvoeren van PCR experimenten op een voldoende hoog stringentie (bijv. discrete banden ten opzichte van een uitstrijkje). Bovendien is de experimenten blijkt dat het veranderen van een parameter andere parameter beïnvloeden ten gevolge waarvan de reactie resultaat.

Reagens Concentratie van voorraadoplossingen Volume 13X **
Master Mix
Eindconcentratie
Steriele H 2 O QS 50 pi QS tot 650 ul
PCR-buffer 10X 5 pi 65 pl 1X
dNTP's 10 mM 1 pi 13 pl 200 uM
MgCl2 25 mM 3 pi 39 pl 1,5 mM
De voorwaartse primer 20 uM = 20 pmol / nl 1 pi 13 pl 20 pmol
Omgekeerde primer 20 uM = 20 pmol / nl 1 pi 13 pl 20 pmol
Template DNA Variabele Variabele Variabele ~ 10 5 moleculen
Taq DNA Polymerase 5 eenheden / ul * 0,5 ul 6,5 pl 2,5 eenheden
50 ul / Reactie

Tabel 1. PCR reagentia in volgorde worden toegevoegd.

* Eenheden kunnen variëren tussen fabrikanten

** Voeg alle reagentia aan de Master Mix met uitzondering van die behoefte hebben aan titratie of die variabel zijn naar de reactie. De Master Mix afgebeeld in de bovenstaande tabel is berekend voor 11 reacties plus 2 extra reacties op pipet overdracht verlies te zorgen is er genoeg te hoeveelheid aan elke reageerbuis tegemoet te komen.

Standaard 3-staps PCR Fietsen
Cycle stap Temperatuur Tijd Aantal cycli
Initiële denaturatie 94 ° C tot 98 ° C 1 minuut 1
Denaturatie
Gloeien
Uitbreiding
94 ° C
5 ° C onder Tm
70 ° C tot 80 ° C
10 tot 60 seconden
30 seconden
Amplicon en DNA-polymerase afhankelijk
25-35
Laatste verlenging 70 & dbijvoorbeeld, C tot 80 ° C 5 minuten 1
Houd * 4 ° C 1

Tabel 2. Standaard 3-staps PCR Fietsen.

* De thermische cyclers de mogelijkheid te onderbreken bij 4 ° C onbeperkt eind van de cyclus.

70 ° C tot 80 ° C
2-staps PCR-Cycling
Cycle stap Temperatuur Tijd Aantal cycli
Initiële denaturatie 94 ° C tot 98 ° C 1 minuut 1
Denaturatie
Gloeien / Verlenging
10 tot 60 seconden
Amplicon en DNA-polymerase afhankelijk
25-35
Laatste verlenging 70 ° C tot 80 ° C 5 minuten 1

Tabel 3. 2-staps PCR Fietsen.

Hot Start PCR Fietsen
Cycle stap Temperatuur Tijd Cycles
Initiële denaturatie 60 ° C tot 95 ° C 5 minuten en voeg dan DNA-polymerase 1
Denaturatie
Gloeien
Uitbreiding
94 ° C
5 ° C onder Tm
70 ° C tot 80 ° C
10 tot 60 seconden
30 seconden
Amplicon en DNA-polymerase afhankelijk
25-35
Laatste verlenging 70 ° C tot 80 ° C 5 minuten 1

Tabel 4. Hot Start PCR Fietsen.

Touchdown PCR Fietsen
Cycle stap Temperatuur Tijd Cycles
Initiële denaturatie 94 ° C tot 98 ° C 1
Denaturatie
Gloeien
Uitbreiding
94 ° C
X = 10 ° C boven Tm
70 ° C tot 80 ° C
10 tot 60 seconden
30 seconden
Amplicon en DNA-polymerase afhankelijk
2
Denaturatie
Gloeien


Uitbreiding
94 ° C
X-1 ° C te verlagen 1 ° C om de andere cyclus
70 ° C tot 80 ° C
10 tot 60 seconden
30 seconden
Amplicon en polymerase afhankelijk
28
Denaturatie
Gloeien
Uitbreiding 94 ° C
5 ° C onder Tm
70 ° C tot 80 ° C
10 tot 60 seconden
30 seconden
Amplicon en DNA-polymerase afhankelijk
20-25
Laatste verlenging 70 ° C tot 80 ° C 5 minuten 1

Tabel 5. Touchdown PCR Fietsen.

Vertraging PCR Fietsen
Cycle stap Temperatuur Tijd Cycles
Initiële denaturatie 94 ° C tot 98 ° C 1 minuut 1
Denaturatie
Gloeien
Uitbreiding
94 ° C
X ° C = 10 ° C boven Tm
70 ° C tot 80 ° C
10 tot 60 seconden
30 seconden
Amplicon en polymerase afhankelijk
2
Denaturatie
Gloeien


Uitbreiding
94 ° C
X-1 ° C te verlagen 1 ° C om de andere cyclus
70 ° C tot 80 ° C *
10 tot 60 seconden
30 seconden
Eenmplicon en polymerase afhankelijk
28
Denaturatie
Gloeien
Uitbreiding
94 ° C
5 ° C onder Tm
70 ° C tot 80 ° C
10 tot 60 seconden
30 seconden
Amplicon en polymerase afhankelijk
20-25
Laatste verlenging 70 ° C tot 80 ° C 5 minuten 1

Tabel 6. Vertraging PCR Fietsen.

* Voor PCR vertraging wordt de helling snelheid verlaagd tot 2,5 ° C is 1 met een afkoelsnelheid van 1,5 ° C en -1 voor het gloeien cycli.

Stock Solution Volume toegevoegd aan 50 pi reactiemengsel 13 X Gist Master Mix 13 X Faag Master Mix Eindconcentratie
Steriele H 2 O qs tot 50 pi = 31 ul of 30,5 qs tot 650 pi = 396,5 qs tot 520 ul = 403 ul
PCR-buffer 10X 5 pi 65 pl 65 pl 1X
10 mM 1 pi 13 pl 13 pl 200 uM
MgCl2 Titratie Toegevoegd aan elk reactievat Toegevoegd aan elk reactievat Toegevoegd aan elk reactievat Variabele te bekijken titratie
De voorwaartse primer 20 uM = 20 pmol / nl 1 pi 13 pl 13 pl 20 pmol
Omgekeerde primer 20 uM = 20 pmol / nl 1 pi 13 pl 13 pl 20 pmol
Template DNA 2 ng / pl faag of 10 ng / pl Gist 0,5 ul fage of Yeast 1 pi 6,5 pl 13 pl ~ 7 10 moleculen fage of ~ 10 5 moleculen Gist
Polymerase 0,5 eenheden / pl ** 0,5 ul 6,5 pl 6,5 pl 0,5 eenheden / Reactie
40 pi + 10 (titratie) ul / Reactie TITRATIE
[MgCl2] 0.00 mm 0,5 mM 1,0 mM 1,5 mm 2,0 mM 2,5 mM 3,0 mM 3,5 mM 4,0 mM 4,5 mM 5,0 mM
MgCl2 0,00 ul 1,00 ul 2,00 ul 3,0 pl 4,00 ul 5,00 ul 6,00 ul 7,00 ul 8,00 ul 9,00 ul 10,00 pl
H2O 10,00 pl 9,00 ul 8,00 ul 7,00 ul 6,00 ul 5,00 ul 4,00 ul 3,00 ul 2,00 ul 1,00 ul 0,00 ul

<strong> Tabel 7. Titratie van Mg2 + in figuur 3.

Figuur 1
Figuur 1. Voorkomende problemen die ontstaan ​​door primers en 3-staps PCR amplificatie van doel-DNA. (A) Self-aanhechten van de primers als gevolg de vorming van secundaire haarspeld lus structuur. Merk op dat primers niet altijd gloeien aan de uiteinden zijn en is minder lus-structuren. (B) Primer hybridiseren met elkaar in plaats van de DNA-template, waardoor primer dimeren. Zodra de primers hybridiseren aan elkaar zullen langwerpige de primer uiteinden. (C) PCR cycli genereren specifieke amplicon. Standaard 3-staps PCR fietsen zijn denaturatie van het template-DNA, gloeien van primers, en uitbreiding van de doel-DNA (amplicon) door een DNA polymerase.

Figuur 2
Figuur 2. Ice emmer met Reagouders, pipetten, en racks nodig is voor een PCR. (1.) P-200 pipet (2.) P-1000 pipet (3.) P-20 pipet (4). P-10 pipet (5). Plaat met 96 putjes en 0,2 ml dunwandige buizen PCR (6). Reagentia met Taq-polymerase 10X PCR buffer, MgCl2, steriel water, dNTP, primers en template DNA (7.) 1,8 ml buizen en rek.

Figuur 3
Figuur 3. Voorbeeld van een Mg2 + titraties gebruikt voor PCR experiment met een standaard 3-staps PCR-protocol optimaliseren. (A) S. cerevisiae Gist genomisch DNA werd gebruikt als template voor een 2098 bp GAL3 gen te amplificeren. In lanen 1 - 6, waarbij de Mg2 +-concentratie te laag is, er ofwel geen gevormd (lanen 1-5) of weinig gevormde produkt (laan 6). Lanen 7-11 vertegenwoordigen optimale concentraties van Mg 2 + deze PCR experiment zoals aangegeven door de aanwezigheid van 2098 bp amplicon. (B) Een uncharacterized mycobacteriophage genomische DNA-template werd gebruikt om een ​​566 bp amplicon versterken. Lanen 1 - 4, de Mg2 +-concentratie te laag is, zoals aangegeven door de afwezigheid van product. Lanen 5-11 vertegenwoordigen optimale concentraties van Mg 2 + deze PCR zoals aangegeven door de aanwezigheid van 566 kb amplicon. (C). S. cerevisiae Gist genomisch DNA werd gebruikt als template voor een 2098 bp GAL3 gen te amplificeren zoals in paneel A. De hybridisatietemperatuur is teruggebracht van 61 ° C tot 58 ° C, waardoor een niet-specifieke PCR banden met variabele lengten produceren vegen effect op de agarosegel. Lanen 1 - 4, waarbij de Mg2 +-concentratie te laag is, er geen product gevormd. Lanen 5-8 geven optimale concentraties van Mg 2 + deze PCR gezien door de aanwezigheid van een uitstrijk en band rond de 2098 kb amplicon grootte. Lanes 9 tot 11 zijn een indicatie van een te strikte voorwaarden vormde geen product. (Ac) Lanes 12 is een negative controle die niet bevat geen template DNA. Lane M (marker) werd geladen met de nationale handhavingsinstanties 1kb Ladder.

Figuur 4
Figuur 4. Steriele buizen gebruikt voor PCR. (1.) 1,8 ml buis (2.) 0,2 ml individuele dunwandige PCR buis, (3.) 0,2 ml strip dunwandige PCR-buisjes en petten.

Figuur 5
Figuur 5. Thermal cycler. Gesloten PCR-apparaat linker afbeelding. Beeld rechts bevat 0,2 ml dunwandige PCR-buisjes geplaatst in de verwarmings-blok van een open thermal cycler.

Discussion

PCR is uitgegroeid tot een onmisbaar instrument in de biologische wetenschap arsenaal. PCR is veranderd tijdens wetenschap waardoor biologen stroom leveren dan genomen en hybride genen maken met nieuwe functies, die specifieke en nauwkeurig klinische testen inzicht te krijgen in het genoom en diversiteit en eenvoudig klonen genen voor verdere biochemische analyse. PCR-applicatie wordt alleen beperkt door de fantasie van de wetenschapper die de macht uitoefent. Er zijn vele boeken en papieren die nieuwe gespecialiseerde toepassingen van PCR te beschrijven, en nog veel meer zullen worden ontwikkeld in de komende generatie van de biologische wetenschap. Ongeacht de verwachte benaderingen is het basiskader gebleven. PCR, in de grootheid, een in vitro toepassing van grote hoeveelheden specifieke DNA-segment genereren.

Het ontwerpen van een PCR-experiment vereist denken en geduld. De resultaten weergegeven in figuur 3 illustreren een van de belangrijkste lallenges bij het ontwerpen van een optimalisatie strategie voor de PCR. Dat wil zeggen, als een parameter van PCR wordt veranderd, kan beïnvloeden andere. Als bijvoorbeeld de eerste PCR werd uitgevoerd bij de suboptimale hybridisatietemperatuur (58 ° C) met een optimale Mg2 +-concentratie van 2,0 mM, dan zal het resultaat zou een uitstrijk zoals in figuur 3c. Een poging om het uitstrijkje te lossen zou kunnen zijn het opzetten van PCR-condities met reacties met 2,0 mM MgCl2 en het aanpassen van de annealing temperatuur tot 61 ° C. Echter, zoals in figuur 3a, is dit niet leveren een product. Bijgevolg is het raadzaam om reagentia titratie, dan het toevoegen van een concentratie aan een reactie bij het oplossen valse resultaten. Ook de meest aanpassingen nodig zijn voor het optimaliseren van een PCR experiment zijn de Mg2 +-concentratie te veranderen en het gloeien temperaturen corrigeren. Echter, als deze veranderingen niet minimaliseren of intrekking van afwijkende resultaten, titratie van additiVES en / of het veranderen van de fietsen staat protocollen, zoals beschreven in de tabellen 2-6 mei verlichten het probleem. Als al het andere faalt, herontwerp van de primers en probeer het, probeer het opnieuw.

Disclosures

Ik heb niets te onthullen.

Acknowledgments

Met dank aan Kris Reddi aan de UCLA voor het opzetten van reagentia en gieten gels en Erin Sanders aan de UCLA voor inspiratie, begeleiding en ondersteuning en corrigeren van het manuscript. Ik wil ook dank Giancarlo Costaguta en Gregory S. Payne voor het leveren van de gist genomische DNA en primers aan de GAL3 gen te amplificeren. Ik wil ook Bhairav ​​Shah bedanken voor het nemen van foto's van de laboratoriumapparatuur en reagentia die worden gebruikt om figuren 2 te maken - 4. De financiering voor dit project werd verzorgd door HHMI (HHMI Grant nr. 52006944).

Materials

Name Company Catalog Number Comments
Taq Polymeras Sigma-Aldrich D4545-25UN
dNTPs Qiagen 201225
0.2 ml Thin Wall Tubes PCR tubes Bio-Rad 223-9469
0.2 ml Thin Wall Tube caps Bio-Rad 223-9472
EDTA disodium salt dihydrate Sigma-Aldrich E5134
Trizma-HCl Sigma-Aldrich T-3253
Custom Phage Primer Invitrogen 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG
Custom Phage Primer Invitrogen 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT
Custom Yeast Primer Integrated DNA Technologies SacI-Gal3(-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG
Custom Yeast Primer Integrated DNA Technologies Gal3(1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG
Thermal Cycler Bio-Rad 170-9703 My Cycler
Agarose ISC BioExpress E-3120-500
Gel electrophoresis Hoeffer Scientific Instruments Model HE33
1 kb DNA Ladder New England Biolabs N3232S
Bio Rad Power Pack Bio-Rad 164-5050 PowerPac Basic
Gel Doc system Fotodyne Incorporated FOTO/Analyst Investigator FX Workstation

DOWNLOAD MATERIALS LIST

References

  1. Albert, J., Fenyo, E. M. Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers. J. Clin. Microbiol. 28, 1560-1564 (1990).
  2. Baskaran, N., et al. Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content. Genome Res. 6, 633-638 (1996).
  3. Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. PCR buffer optimization with uniform temperature regimen to facilitate automation. PCR Methods Appl. 2, 234-240 (1993).
  4. Borer, P. N., Dengler, B., Tinoco, I. Jr, Uhlenbeck, O. C. Stability of ribonucleic acid double-stranded helices. J. Mol. Biol. 86, 843-853 (1974).
  5. Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. Predicting DNA duplex stability from the base sequence. Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).
  6. Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications. Nucleic Acids Res. 20, 1717-1723 (1992).
  7. Coleman, W. B., Tsongalis, G. J. Diagnostics for the clinical laboration. Humana Press. (2005).
  8. D'Aquila, R. T., et al. Maximizing sensitivity and specificity of PCR by pre-amplification heating. Nucleic Acids Res. 19, 3749 (1991).
  9. Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. General concepts for PCR primer design. PCR Methods Appl. 3, S30-S37 (1993).
  10. Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. 'Touchdown' PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res. 19, 4008 (1991).
  11. Erlich, H. A., Gelfand, D., Sninsky, J. J. Recent advances in the polymerase chain reaction. Science. 252, 1643-1651 (1991).
  12. Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. PCR-amplification of GC-rich regions: 'slowdown PCR. Nat. Protoc. 3, 1312-1317 (2008).
  13. Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. Specific amplification with PCR of a refractory segment of genomic DNA. Nucleic Acids Res. 16, 11844 (1988).
  14. Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. Betaine improves the PCR amplification of GC-rich DNA sequences. Nucleic Acids Res. 25, 3957-3958 (1997).
  15. Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. PCR Protocols: A guide to methods and applications. Academic Press, Inc. San Diego. (1990).
  16. King, N. Methods in Molecular Biology. 630, Humana Press. (2010).
  17. Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases. J. Mol. Biol. 56, 341-361 (1971).
  18. Korbie, D. J., Mattick, J. S. Touchdown PCR for increased specificity and sensitivity in PCR amplification. Nat. Protoc. 3, 1452-1456 (2008).
  19. Kramer, M. F., Coen, D. M. Enzymatic amplification of DNA by PCR: standard procedures and optimization. Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).
  20. Kramer, M. F., Coen, D. M. The polymerase chain reaction. Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).
  21. Kreader, C. A. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl. Environ. Microbiol. 62, 1102-1106 (1996).
  22. Kwok, S., et al. Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection. J. Virol. 61, 1690-1694 (1987).
  23. McConlogue, L., Brow, M. A., Innis, M. A. Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine. Nucleic Acids Res. 16, 9869 (1988).
  24. Mullis, K. B. The unusual origin of the polymerase chain reaction. Sci. Am. 262, 56-65 (1990).
  25. Mullis, K. B. Target amplification for DNA analysis by the polymerase chain reaction. Ann. Biol. Clin. (Paris). 48, 579-582 (1990).
  26. Mullis, K. B. The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion). PCR Methods Appl. 1, 1-4 (1991).
  27. Mullis, K. B., Faloona, F. A. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155, 335-350 (1987).
  28. Paabo, S., Gifford, J. A., Wilson, A. C. Mitochondrial DNA sequences from a 7000-year old brain. Nucleic Acids Res. 16, 9775-9787 (1988).
  29. Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. Betaine can eliminate the base pair composition dependence of DNA melting. Biochemistry. 32, 137-144 (1993).
  30. Roux, K. H., Hecker, K. H. One-step optimization using touchdown and stepdown PCR. Methods Mol. Biol. 67, 39-45 (1997).
  31. Rychlik, W., Spencer, W. J., Rhoads, R. E. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Saiki, R. K., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, 487-491 (1988).
  33. Saiki, R. K., et al. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 230, 1350-1354 (1985).
  34. Sambrook, J. A. R., David, W. Molecular Cloning A Laboratory Manual. 2, 3, Cold Spring Harbor Laboratory Press. (2001).
  35. Sarkar, G., Kapelner, S., Sommer, S. S. Formamide can dramatically improve the specificity of PCR. Nucleic Acids Res. 18, 7465 (1990).
  36. Smit, V. T., et al. KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas. Nucleic Acids Res. 16, 7773-7782 (1988).
  37. Wilson, I. G. Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol. 63, 3741-3751 (1997).
  38. Wu, R. Methods in Enzymology. 218, Academic Press, Inc. San Diego. (1993).

Comments

1 Comment

  1. Thanks for the great overview of the all-important PCR procedure. I will no doubt reference it often in the future.

    I have a PCR troubleshooting question...what do to about streaking on the gel after a successful amplification? My bands are nice and bright and where they are supposed to be, but there is a heavily-streaked "path" starting at the wells and following until the end where my bands are. Is there something I can do about my PCR conditions, or the thermocycler settings? Any comments would be appreciated.

    Reply
    Posted by: Doug E.
    September 8, 2013 - 1:23 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics