Reacción en cadena: Protocolo Básico Plus Estrategias de resolución de problemas y optimización

Biology
 

Summary

PCR se ha convertido en una técnica común en muchos laboratorios de biología molecular. Siempre que aquí hay una guía rápida de varios protocolos de PCR convencionales. Debido a que cada reacción es un experimento único, las condiciones óptimas requeridas para generar un producto variar. La comprensión de las variables en una reacción en gran medida mejorar la eficiencia de la solución de problemas, lo que aumenta la posibilidad de obtener el resultado deseado.

Cite this Article

Copy Citation | Download Citations

Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998, doi:10.3791/3998 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

En las ciencias biológicas se han producido avances tecnológicos que catapultan a la disciplina en las edades de oro del descubrimiento. Por ejemplo, el campo de la microbiología se transformó con el advenimiento de microscopio Anton van Leeuwenhoek, que permitió a los científicos visualizar procariotas, por primera vez. El desarrollo de la reacción en cadena de la polimerasa (PCR) es una de las innovaciones que cambiaron el curso de la ciencia molecular, con el impacto que abarca un sinnúmero de subdisciplinas de la biología. El proceso teórico fue esbozada por Keppe y compañeros de trabajo en 1971, sin embargo, fue otro de 14 años hasta que el procedimiento completo de PCR se describe y se aplica experimentalmente por Kary Mullis, mientras que en la Cetus Corporation en 1985. Automatización y refinamiento de esta técnica progresó con la introducción de una ADN polimerasa térmica estable a partir de la bacteria Thermus aquaticus, en consecuencia, el nombre de la ADN polimerasa Taq.

La PCR es una Powetécnica de amplificación rful que puede generar un amplio suministro de un segmento específico de ADN (es decir, una amplificación) a partir de sólo una pequeña cantidad de material de partida (es decir, molde de ADN o secuencia diana). Si bien sencilla y, en general sin problemas, hay dificultades que complican la reacción que produce resultados falsos. Cuando la PCR no se puede llevar a muchos productos no específicos de ADN de diferentes tamaños que aparecen como una escalera o un frotis de bandas en geles de agarosa. A veces hay productos forman en absoluto. Otro problema potencial se produce cuando las mutaciones se introdujeron involuntariamente en los amplicones, resultando en una población heterogénea de productos de PCR. Los fallos de la PCR puede ser frustrante no ser la paciencia y la solución de problemas de cuidado se emplean para resolver y solucionar el problema (s). Este protocolo describe los principios básicos de la PCR, proporciona una metodología que se traducirá en la amplificación de secuencias de la mayoría de objetivo, y presenta estrategias para la optimización de una reacción. Siguiendo esta guía de PCR, víaudents debe ser capaz de:

  • Establecer las reacciones y las condiciones de ciclos térmicos convencionales para un experimento de PCR
  • Comprender la función de varios componentes de la reacción y su efecto global sobre un experimento de PCR
  • Diseñar y optimizar un experimento de PCR para cualquier molde de DNA
  • Solucionar problemas de fallidos experimentos de PCR

Protocol

1. El diseño de cebadores

Diseño de cebadores apropiados es esencial para el éxito de un experimento de PCR. Al diseñar un conjunto de cebadores a una región específica de DNA deseado para la amplificación, un cebador debe recocer a la cadena positiva, que por convención está orientado en la dirección 5 '→ 3' (también conocido como el sentido o hebra nontemplate) y el otro cebador debe complementar la cadena negativa, que está orientada en el 3 '→ 5' (antisentido o filamento de la plantilla). Hay algunos problemas comunes que surgen en el diseño de los cebadores: 1) auto-hibridación de los cebadores que resultan en la formación de estructuras secundarias, tales como los bucles de horquilla (Figura 1a), 2) la hibridación del cebador el uno al otro, en vez de la plantilla de la DNA, la creación de imprimación dímeros (Figura 1b), 3) radicalmente diferentes temperaturas de fusión (Tm) de cada cebador, por lo que es difícil seleccionar una temperatura de hibridación que todosómo los dos primers para enlazar de manera eficiente a su secuencia diana durante la Térmica (véase la figura 1c) (Vea las secciones de calcular la temperatura de fusión (T m) y modificaciones a las condiciones del ciclo para obtener más información acerca de T m s).

  1. A continuación se muestra una lista de características que deben ser considerados en el diseño de los cebadores.
    1. Primer longitud debe ser de 15-30 residuos de nucleótidos (bases).
    2. Óptimo contenido de GC debe variar entre 40-60%.
    3. El extremo 3 'de los cebadores deben contener una T o C con el fin de sujetar el cebador y prevenir la "respiración" de los extremos, aumentando la eficiencia de cebado. ADN "respirar" se produce cuando los fines no se queden recocidos, pero deshilache o se separaron. Los tres enlaces de hidrógeno en pares GC ayudar a prevenir la respiración, sino también aumentar la temperatura de fusión de los cebadores.
    4. Extremos 3 'de un conjunto de cebadores, que incluye un cebador cadena positiva y un cebador cadena negativa, no deben ser c omplementary el uno al otro, ni puede el extremo 3 'de un único cebador ser complementaria a otras secuencias en el cebador. Estos dos escenarios resultar en la formación de dímeros de cebadores y las estructuras de bucle de horquilla, respectivamente.
    5. Las temperaturas óptimas de fusión (T m) para el rango entre los cebadores 52-58 ° C, aunque el rango puede ser ampliado a 45-65 ° C. El final de Tm de dos primers deben diferir en no más de 5 ° C.
    6. Di-nucleótidos se repite (por ejemplo, o GCGCGCGCGC ATATATATAT) o de la aplicación de una sola base (por ejemplo, AAAAA o CCCCC), se debe evitar ya que pueden causar el deslizamiento a lo largo del segmento de cebado de las estructuras de bucle de ADN y la horquilla, o de forma. Si es inevitable debido a la naturaleza del molde de ADN, a continuación, sólo se incluyen repeticiones o de una sola base se ejecuta con un máximo de 4 bases.

Notas:

  1. Hay muchos programas informáticos diseñados para ayudar en el diseño de parejas de cebadores. Primer NCBI diseño de la herramientaw.ncbi.nlm.nih.gov / herramientas / hornos de imprimación / "target =" _blank "> http://www.ncbi.nlm.nih.gov/tools/primer-blast/ y Primer3 http://frodo .wi.mit.edu/primer3 / sitios web recomendados para este propósito.
  2. Con el fin de evitar la amplificación de pseudogenes relacionados u homólogos que podría ser útil para ejecutar una explosión en NCBI para comprobar la especificidad de la diana de los cebadores.

2. Materiales y reactivos

  1. Al configurar un experimento de PCR, es importante estar preparado. Use guantes para evitar la contaminación de la mezcla de reacción o de los reactivos. Incluir un control negativo, y si es posible un control positivo.
  2. Organizar todos los reactivos necesarios para el experimento de PCR en un cubo lleno de hielo recién, y dejar que se descongelen por completo antes de la creación de una reacción (Figura 2). Mantener los reactivos en hielo durante todo el experimento.
    • Standard reactivos de PCR incluyen unaun conjunto de cebadores apropiados para el gen diana deseada o segmento de ADN a amplificar, ADN polimerasa, un tampón para la ADN polimerasa específica, desoxinucleótidos (dNTPs), molde de ADN, y agua estéril.
    • Reactivos adicionales pueden incluir sal de magnesio Mg 2 + (a una concentración final de 0,5 a 5,0 mM), K sal de potasio + (a una concentración final de 35 a 100 mM), dimetilsulfóxido (DMSO; a una concentración final de 1-10% ), formamida (a una concentración final de 1,25-10%), albúmina de suero bovino (a una concentración final de 10-100 g / ml), y betaína (a una concentración final de 0,5 M a 2,5 M). Los aditivos se discute en la sección de solución de problemas.
  3. Organizar equipos de laboratorio en el banco de trabajo.
    • Los materiales incluyen los tubos de PCR y las tapas, un estante de tubo de PCR, un marcador de etanol-resistente, y un conjunto de Micropipetas que dispensan entre 1 a 10 l (P10), 2 a 20 l (P20), desde 20 hasta 200 l (P200)y 200 - 1000 l (P1000), así como un termociclador.
    • Cuando la creación de varios experimentos de PCR que todos utilizan los mismos reactivos, se pueden escalar correctamente y se combinan en una mezcla maestra (Master Mix). Este paso puede realizarse en un tubo de microcentrífuga estéril 1,8 ml (véase Notas).
    • Para analizar los amplicones resultantes de un experimento de PCR, los reactivos y el equipo para electroforesis en gel de agarosa se requiere. Para aproximar el tamaño de un producto de PCR, un apropiado, disponible comercialmente estándar molecular tamaño peso que se necesita.

3. Configuración de una mezcla de reacción

  1. Empieza haciendo una tabla de los reactivos que se añaden a la mezcla de reacción (ver Tabla 1).
  2. A continuación, la etiqueta de PCR tubo (s) con el marcador de etanol-resistente.
  3. Volúmenes de reacción variará dependiendo de las concentraciones de los reactivos de stock. Las concentraciones finales(CF) para un típico 50 l de reacción son como sigue.
    • X tampón (generalmente suministrado por el fabricante de la ADN polimerasa; puede contener 15 mM de MgCl 2). Añadir 5 l de tampón 10X por reacción.
    • 200 micras (dNTPs 50 mM de cada uno de los cuatro nucleótidos). Añadir 1 l de 10 mM dNTPs por reacción (dATP, dCTP, dTTP y dGTP son menos 2,5 mM de cada uno).
    • 1,5 mM de Mg 2 +. Añadir sólo si no está presente en el tampón 10X o según sea necesario para la optimización de la PCR. Por ejemplo, para obtener el 4,0 mM de Mg 2 + necesaria para la producción óptima de amplificación de un segmento de ADN conservado 566 pb se encuentra en una mycobacteriophage uncharacterized añadir 8 l de 25 mM de MgCl 2 a la reacción (Figura 3).
    • 20 a 50 pmol de cada cebador. Añadir 1 l de cada cebador 20 mM.
    • Añadir 10 4 a 10 7 moléculas (o aproximadamente 1 a 1000 ng) de la plantilla de ADN. Añadir 0,5 l de 2NG / y mu; Genómico l mycobacteriophage ADN.
    • Añadir 0,5 a 2,5 unidades de polimerasa de ADN por reacción de 50 l (Ver las recomendaciones del fabricante), por ejemplo, añadir 0,5 l de Sigma 0,5 unidades / l de polimerasa de ADN Taq.
    • Añadir QS de agua destilada estéril para obtener un volumen de 50 l final por la reacción como predeterminado en la tabla de los reactivos (QS es una abreviatura latina para quantum satis significa que la cantidad que se necesita). Por lo tanto, 33 l por reacción se requiere para llevar el volumen hasta 50 l. Sin embargo, debe señalarse que el agua se añade primero pero requiere inicialmente hacer una tabla de los reactivos y la determinación de los volúmenes de todos los demás reactivos añadidos a la reacción.

4. PCR Protocolo Básico

  1. Colocar una placa de 96 pocillos en el cubo de hielo como un soporte para los 0,2 ml tubos de paredes delgadas de PCR. Permitir que los reactivos de PCR para ser agregado en frío de 0,2 ml tubos de paredes delgadas de PCR ayuda a prevenir nuclease actividad y cebado inespecífica.
  2. Pipetear los siguientes reactivos de PCR en el siguiente orden en un tubo de 0,2 ml de pared delgada PCR (Figura 4): agua estéril, 10X PCR buffer, dNTPs, MgCl 2, cebadores y el ADN de plantilla (ver Tabla 1). Dado que los experimentos deben tener al menos un control negativo, y, posiblemente, un control positivo, es beneficioso para establecer una Master Mix en un tubo de microcentrífuga de 1,8 ml (ver explicación en las notas).
  3. En otro de 0,2 ml tubos de paredes delgadas de PCR (Figura 4) añadir todos los reactivos con la excepción del molde de ADN para un control negativo (aumentar el agua para compensar la falta de volumen). Además, otra reacción (si están disponibles reactivos) debe contener un control positivo utilizando ADN molde y cebadores o previamente conocidos para amplificar bajo las mismas condiciones que los tubos de PCR experimentales.
  4. Taq DNA polimerasa se ​​almacena normalmente en un 50% de glicerolsolución y para la dispersión completa en la mezcla de reacción requiere suave mezcla de los reactivos de PCR pipeteando arriba y hacia abajo al menos 20 veces. La micropipeta se debe establecer en la mitad del volumen de reacción de la mezcla maestra cuando se mezclan, y se debe tener cuidado para evitar la introducción de burbujas.
  5. Poner límites a los 0,2 ml tubos de paredes delgadas de PCR y los situará en el termociclador (Figura 5). Una vez que la tapa para el termociclador está firmemente cerrado iniciar el programa (ver Tabla 2).
  6. Cuando el programa haya terminado, los 0,2 ml tubos de paredes delgadas de la PCR puede ser removido y almacenado a 4 ° C. Los productos PCR se puede detectar mediante la carga de partes alícuotas de cada reacción en los pocillos de un gel de agarosa después tinción de ADN que ha migrado a la electroforesis en gel siguiente con bromuro de etidio. Si un producto de PCR está presente, el bromuro de etidio se intercalan entre las bases de las hebras de ADN, permitiendo bandas para ser visualizada con un iluminador UV. </ Li>

Notas:

  1. Al configurar múltiples experimentos de PCR, es ventajoso para ensamblar una mezcla de reactivos comunes a todas las reacciones (es decir, mezcla maestra). Por lo general, el cóctel contiene una solución de ADN polimerasa, dNTPs, tampón de reacción, y el agua montado en un tubo de microcentrífuga de 1,8 ml. La cantidad de cada reactivo añadido a la mezcla maestra es equivalente al número total de reacciones más un 10% redondeado al alza hasta el total de reacción. Por ejemplo, si hay 10 x 0,1 = 1 reacción, entonces (10 + 1) x 5 l tampón 10X es igual a 55 l de tampón 10X para la mezcla maestra. Los reactivos de la mezcla maestra se mezclan a fondo por suavemente el émbolo de bombeo de una micropipeta arriba y hacia abajo alrededor de 20 veces como se ha descrito anteriormente. Cada tubo de PCR recibe una parte alícuota de la mezcla maestra para que luego el molde de ADN, los cebadores necesarios, y el experimento de los reactivos específicos añadido (ver cuadros 1 y 7).
  2. El following web ofrece una calculadora para determinar el número de copias de un ADN molde ( http://www.uri.edu/research/gsc/resources/cndna.html ). El número total de copias de ADN de doble cadena puede ser calculada mediante la ecuación siguiente:
    Número de copias de ADN = (cantidad de ADN (ng) x 6.022x10 23) / (longitud de ADN x 1x10 9 ng / ml x 650 Daltons)
    Calculando el número de copias de ADN se utiliza para determinar la cantidad de plantilla se necesita por reacción.
  3. Los falsos positivos pueden ocurrir como consecuencia de traspaso de otra reacción de PCR que es visualizada como múltiples productos indeseados en un gel de agarosa después de electroforesis. Por lo tanto, es prudente utilizar una técnica adecuada, incluyen un control negativo (control positivo y cuando sea posible).
  4. Si bien es el bromuro de etidio f mancha más comúno ácidos nucleicos hay varias alternativas más seguras y menos tóxicas. El sitio web A continuación se describen algunas de las alternativas, incluyendo azul de metileno, cristal violeta, seguro SYBR, y gel de color rojo junto con descripciones de cómo utilizar y detectar el producto final ( http://bitesizebio.com/articles/ethidium-bromide-the- otros medios o productos ).
  5. Aunque la mayoría de las modernas máquinas de PCR utilizar tubos de 0,2 ml, algunos modelos pueden requerir reacciones en tubos de 0,5 ml. Consulte el manual de termocicladores para determinar el tamaño apropiado del tubo.

5. Cálculo de fusión Temperatura (Tm)

  1. Conociendo la temperatura de fusión (Tm) de los cebadores es imprescindible para el éxito de experimento de PCR. Aunque hay varios T calculadoras m disponible, es importante señalar que estos cálculos son una estimación real de la T m debido a la falta de información específica acerca de una reacción en particular y los supuestos de los algoritmos para las calculadoras Tm mismos. Sin embargo, la más cercana al vecino modelos termodinámicos son preferibles a los cálculos más convencional: T m ≈ 4 (GC) + 2 (AT). El primero le dará la estimación más precisa T m, ya que toma en cuenta la energía de apilamiento de pares de bases vecinos. Este último se utiliza con mayor frecuencia debido a que los cálculos son simples y pueden hacerse rápidamente con la mano. Consulte la sección Solución de problemas para obtener información sobre cómo las diferentes condiciones de la PCR y los aditivos afectan la temperatura de fusión.
    Para el cálculo de los valores de Tm por los modelos termodinámicos del vecino más próximo, una de las calculadoras se recomienda lo siguiente:
    http://www6.appliedbiosystems.com/support/techtools/calc/
    edu / ~ Zimmer / oligoTMcalc.html "target =" _blank "> ~ http://www.cnr.berkeley.edu/ Zimmer / oligoTMcalc.html
    http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/
    http://www.finnzymes.com/tm_determination.html~~V
    http://mobyle.pasteur.fr/cgi-bin/portal.py? Número de Título de las formas de fusión

6. Establecer las condiciones térmicas Ciclismo

  1. Cicladores PCR térmicas rápidamente el calor y enfriar la mezcla de reacción, permitiendo de calor inducido por desnaturalización de ADN dúplex (separación de las cadenas), hibridación de los cebadores a las hebras positivo y negativo de la plantilla de ADN, y el alargamiento del producto de PCR. Ciclismo veces se calculan basándose en el tamaño de la plantilla y el contenido de GC del ADN. El general, formuluna comienza con una etapa inicial de desnaturalización a 94 ° C a 98 ° C dependiendo de la temperatura óptima para la actividad de ADN polimerasa y el contenido de GC de la plantilla de ADN. Una reacción típica se iniciará con una desnaturalización minutos una a 94 ° C. Cualquier más de 3 minutos puede inactivar la DNA polimerasa, destruyendo su actividad enzimática. Un método, conocido como de arranque en caliente de PCR, drásticamente extiende el tiempo de desnaturalización inicial de 3 minutos hasta 9 minutos. Con la PCR de arranque en caliente, la DNA polimerasa se añade después de la etapa inicial de desnaturalización exagerada está terminado. Esta modificación protocolo evita la inactivación probable de la enzima ADN polimerasa. Consulte la sección Solución de problemas de este protocolo para obtener más información acerca de la PCR en caliente de inicio y otros métodos alternativos.
  2. El siguiente paso es establecer el termociclador para iniciar la primera de 25 a 35 rondas de un ciclo de temperatura de tres pasos (Tabla 2). Al aumentar el número de ciclos por encima de 35 se traducirá en unamayor cantidad de productos de la PCR, las rondas demasiados a menudo resulta en el enriquecimiento de los productos secundarios no deseados. Los tres pasos de temperatura en un solo ciclo lograr tres tareas: el primer paso desnaturaliza la plantilla (y en los ciclos posteriores, los amplicones así), el segundo paso permite óptima hibridación de los cebadores, y el tercer paso permite que la DNA polimerasa para unirse a el molde de ADN y sintetizar el producto de PCR. La duración y la temperatura de cada paso dentro de un ciclo puede ser alterado para optimizar la producción de la amplificación deseada.
    El tiempo para la etapa de desnaturalización se mantiene lo más corto posible. Por lo general, 10 a 60 segundos es suficiente para la mayoría de las plantillas de ADN. El tiempo de desnaturalización y la temperatura puede variar dependiendo del contenido de GC de la plantilla de ADN, así como la velocidad de rampa, que es el tiempo que tarda el termociclador para cambiar de una temperatura a la siguiente. La temperatura para esta etapa es generalmente la misma que la utilizada para la fase inicial de desnaturalización(Paso 1 anterior; por ejemplo, 94 ° C).
    Un segundo paso de recocido 30 sigue en el ciclo a una temperatura establecida alrededor de 5 ° C por debajo de la aparente Tm de los cebadores (lo ideal es entre 52 ° C a 58 ° C).
    El ciclo concluye con un paso de elongación. La temperatura depende de la polimerasa del ADN seleccionado para el experimento. Por ejemplo, la polimerasa Taq ADN tiene una temperatura óptima alargamiento de 70 ° C a 80 ° C y requiere un minuto para alargar los primeros 2 kb, a continuación, requiere un minuto adicional para cada 1 kb amplificados. Pfu ADN polimerasa es otra enzima termoestable que tiene una temperatura de alargamiento óptimo de 75 ° C. Pfu ADN polimerasa está recomendado para uso en la PCR y las reacciones de extensión de cebador que requieren alta fidelidad y requiere 2 minutos por cada 1 kb a ser amplificadas. Ver las recomendaciones del fabricante para temperaturas de elongación y la hora exacta elongación indicados para cada ADN polimerasa específica.
  3. Taq, permite la adición de un residuo de adenina a los extremos 3 'de todos los productos de PCR. Esta modificación es mediada por la actividad transferasa terminal de la ADN polimerasa Taq y es útil para posteriores procedimientos de clonación molecular que requieren un voladizo 3'-.
  4. La terminación de la reacción se consigue enfriando la mezcla a 4 ° C y / o mediante la adición de EDTA hasta una concentración final de 10 mM.

7. Consideraciones importantes al Solucionar problemas de PCR

Si las condiciones estándar de PCR no producen la amplificación deseada, Optimización de la PCR es necesario para alcanzar mejores resultados. La rigurosidad de una reacción puede ser modulada de manera que la especificidad se ajusta por variables que alteran (por ejemplo, reactivoconcentraciones, las condiciones de ciclismo) que afectan el resultado del perfil de amplificación. Por ejemplo, si la reacción no es lo suficientemente estrictas, muchos amplicones espurias se generará con longitudes variables. Si la reacción es demasiado riguroso, ningún producto será producido. Solución de problemas de las reacciones de PCR puede ser una tarea frustrante a veces. Sin embargo, un análisis cuidadoso y una buena comprensión de los reactivos utilizados en un experimento de PCR puede reducir la cantidad de tiempo y los ensayos necesarios para obtener los resultados deseados. De todas las consideraciones que afectan PCR rigor, la titulación de Mg 2 + y / o la manipulación de temperaturas de recocido es probable que la mayoría de resolver problemas. Sin embargo, antes de cambiar nada, estar seguro de que un resultado erróneo no era debido a un error humano. Para empezar, confirmando todos los reactivos se añadieron a una reacción dada y que los reactivos no estaban contaminadas. Asimismo, tomamos nota del resultado erróneo, y las siguientes preguntas: ¿Son dímeros de primers visibles en el gel después de electroforesisresistencia (éstos funcionan como pequeñas bandas <100 b en la parte inferior de la calle)? ¿Existen productos no específicos (bandas que migran en un tamaño diferente al producto deseado)? ¿Hubo una falta de producto? Es el objetivo de ADN en un plásmido o en un extracto de ADN genómico? Además, es conveniente analizar el contenido de GC de la amplificación deseada.

  1. En primer lugar determinar si alguno de los reactivos de PCR son catastróficos a su reacción. Esto puede lograrse mediante la preparación de nuevos reactivos (por ejemplo, frescas existencias de trabajo, diluciones nuevos), y luego sistemáticamente añadiendo un reactivo de nuevo a la vez a las mezclas de reacción. Este proceso va a determinar qué reactivo fue el culpable del fallido experimento de PCR. En el caso de ADN muy antiguo, que a menudo se acumula inhibidores, se ha demostrado que la adición de albúmina de suero bovino puede ayudar a aliviar el problema.
  2. Dímeros cebador puede formar cuando cebadores preferentemente auto recocido o recocido para el otro cebador en la reacción. Si esto ocurre, un pequeñoproducto de menos de 100 pb aparecerá en el gel de agarosa. Para empezar, alterando la relación de plantilla para cartilla; si la concentración de cebador está en exceso sobre la concentración extrema plantilla, a continuación, los cebadores será más probable para recocer a sí mismos o entre sí sobre el molde de ADN. Adición de DMSO y o el uso de un método de arranque en caliente ciclo térmico puede resolver el problema. En el extremo, puede ser necesario para diseñar nuevos cebadores.
  3. Productos no específicos se producen cuando rigor PCR es excesivamente baja resultante en bandas no específicos de PCR con longitudes variables. Esto produce un efecto escalera en un gel de agarosa. A continuación, es aconsejable elegir las condiciones de PCR que aumentan rigurosidad. Un frotis de diversos tamaños también pueden resultar de cebadores diseñados para secuencias altamente repetitivas cuando amplificar ADN genómico. Sin embargo, los mismos cebadores pueden amplificar una secuencia diana en un plásmido sin encontrar el mismo problema.
  4. La falta de productos de PCR es probablemente debido a las condiciones de reacciónque son demasiado rigurosos. Primer dímeros y estructuras de bucle de horquilla que forman con los cebadores o en la plantilla de ADN desnaturalizado también puede impedir la amplificación de productos de PCR debido a que estas moléculas ya no podrán par de bases con la contraparte ADN deseado.
  5. Si el contenido de GC no se ha analizado, es el momento para hacerlo. PCR de las regiones ricas GC (GC contenido> 60%) presentan algunos de los mayores desafíos a la PCR. Sin embargo, hay muchos aditivos que han sido utilizados para ayudar a aliviar los problemas.

8. La manipulación de los reactivos de PCR

Descripción de la función de los reactivos utilizados en PCR convencional es crítico cuando primero decidir la mejor forma para alterar las condiciones de reacción para obtener el producto deseado. El éxito sólo puede basarse en el cambio de la concentración de MgCl2, KCl, dNTPs, primers, la plantilla de ADN, o DNA polimerasa. Sin embargo, la concentración incorrecta de estos reactivos puede dar lugar a falsos resultados, la disminución de la stringencY de la reacción. Al intentar solucionar PCR, sólo un reactivo debe ser manipulado a la vez. Sin embargo, puede ser prudente para valorar el reactivo manipulado.

  1. Sal de magnesio Mg 2 + (concentración final de reacción de 0,5 a 5,0 mM)
    ADN polimerasas termoestables requieren la presencia de magnesio para actuar como un cofactor durante el proceso de reacción. Cambio de la concentración de magnesio es uno de los más fáciles de manipular los reactivos con quizás el mayor impacto en la severidad de la PCR. En general, el rendimiento del producto de PCR aumentará con la adición de mayores concentraciones de Mg 2 +. Sin embargo, el aumento de las concentraciones de Mg 2 + también disminuirá la especificidad y la fidelidad de la DNA polimerasa. La mayoría de los fabricantes incluyen una solución de cloruro de magnesio (MgCl 2) junto con la ADN polimerasa y una solución tampón de PCR 10X. Los 10 X PCR soluciones tampón puede contener 15 mM MgCl 2, lo cual es suficiente para un típico PCRreacción, o se puede añadir por separado a una concentración optimizado para una reacción particular. Mg 2 + no se consume en la reacción, pero la reacción no puede proceder sin que esté presente. Cuando hay demasiado Mg 2 +, puede impedir la desnaturalización completa del molde de ADN mediante la estabilización de la hebra dúplex. El exceso de Mg 2 + también puede estabilizar espuria hibridación de los cebadores a los sitios de plantilla incorrectos y la especificidad de disminución en los productos de PCR no deseados. Cuando no hay suficiente Mg 2 +, la reacción no procederá, resultando en ningún producto de PCR.
  2. Sal de potasio K + (concentración final de reacción de 35 a 100 mM)
    Productos de PCR más largo (10 a 40 kb) se benefician de la reducción de la sal de potasio (KCl) a partir de su concentración normal de reacción 50 mM, a menudo junto con la adición de DMSO y / o glicerol. Si la amplificación deseada está por debajo de 1000 pb y productos largos no específicos se están formando, especificiTy puede mejorarse mediante titulación de KCl, aumentando la concentración en incrementos de 10 mM hasta 100 mM. El aumento de la concentración de sal más cortos permite moléculas de ADN para desnaturalizar preferentemente a moléculas de ADN más largos.
  3. Desoxinucleótido 5'-trifosfatos (concentración final de reacción de 20 y 200 mM cada uno)
    Desoxinucleótido 5'-trifosfatos (dNTPs) puede causar problemas para PCR si no están en las concentraciones apropiadas equivalente (es decir, [A] = [E] = [C] = [G]) y / o debido a su inestabilidad de repetirse congelación y descongelación. La concentración de dNTP habitual es de 50 mM de cada uno de los cuatro dNTPs. Sin embargo, la PCR puede tolerar concentraciones de entre 20 y 200 mM de cada uno. Las concentraciones más bajas de dNTPs puede aumentar tanto la especificidad y la fidelidad de la reacción, mientras que las concentraciones excesivas dNTP en realidad pueden inhibir la PCR. Sin embargo, durante largos PCR-fragmentos, una mayor concentración de dNTP puede ser requerido. Un gran cambio en la concentración de dNTP puede requerir una corresponencharcamiento cambio en la concentración de Mg 2 +.
  4. Thermal ADN polimerasas estables
    Las enzimas y tampones de PCR relacionadas con las enzimas han recorrido un largo camino desde la primera Taq polimerasa de ADN se empleó por primera vez. Por lo tanto, la elección de una enzima apropiada puede ser útil para la obtención de productos de amplificación esperados. Por ejemplo el uso de la ADN polimerasa Taq puede ser preferible a la ADN polimerasa Pfu si procesividad y / o la adición de un residuo de adenina a los extremos 3 'del producto de PCR se desea. La adición de un 3 'adenina se ha convertido en una estrategia útil para la clonación de los productos de PCR en vectores TA whit 3' salientes de timina. Sin embargo, si la fidelidad es más importante una enzima tal como Pfu puede ser una mejor opción. Varios fabricantes tienen una gran variedad de ADN polimerasas específicas diseñadas para necesidades específicas. Echa un vistazo a las condiciones de reacción y las características de la amplificación deseada, y luego coincide con el experimento de PCR con el ADN proceda polymerase. La mayoría de fabricantes tienen tablas que el ADN polimerasa la ayuda de selección por las características de inclusión como la fidelidad, rendimiento, velocidad, longitudes óptimas de destino y, si es útil para GC amplificación de ricos o con inicio caliente PCR.
  5. Patrón de ADN
    La calidad y la pureza del ADN tendrá un efecto sustancial en la probabilidad de un éxito experimento de PCR. ADN y las concentraciones de ARN se puede determinar utilizando sus mediciones de densidad óptica a 260 nm (OD 260). La masa de los ácidos nucleicos purificados en solución se calcula a 50 mg / ml de ADN de cadena doble o 40 mg / ml para ARN o ADN de una sola hebra en una DO 260 = 1,0. Contaminantes de extracción de ADN son inhibidores de la PCR en común y se debe evitar cuidadosamente. Comunes inhibidores de extracción de ADN de la PCR incluyen proteínas, ARN, disolventes orgánicos y detergentes. Uso de la máxima absorción de los ácidos nucleicos OD 260 en comparación con la de las proteínas OD280 (OD 260/280), es posible determine una estimación de la pureza del ADN extraído. Idealmente, la relación de la OD 260/280 es de entre 1,8 y 2,0. Bajo OD 260/280 es indicativa de la proteína y / o contaminación disolvente que, con toda probabilidad, será problemático para la PCR.
    Además de la calidad del molde de ADN, la optimización de la cantidad de ADN en gran medida se pueden beneficiar de los resultados de un experimento de PCR. Aunque es conveniente para determinar la cantidad en l ng /, que a menudo es la salida para nanospectrophotometers modernos, la unidad pertinente para un experimento de PCR éxito es el número de moléculas. Es decir, el número de copias de plantilla de ADN contiene una secuencia complementaria a los cebadores de PCR? Moléculas diana son óptimas entre abril 10 a julio 10 moléculas y puede ser calculada como se describe en las notas anteriores.

9. Los reactivos de aditivos

Reactivos de aditivos puede dar resultados, cuando todo lo demás falla. La comprensión de los reactivosy lo que se utilizan para es crítico en la determinación de que los reactivos pueden ser más eficaces en la adquisición de la deseada producto de PCR. Adición de reactivos para la reacción se complica por el hecho de que la manipulación de un reactivo puede afectar a la concentración utilizable de otro reactivo. Además de los reactivos mencionados a continuación, de propiedad aditivos disponibles comercialmente están disponibles de compañías de biotecnología muchos.

10. Los aditivos que benefician plantillas ricas en GC

  1. Dimetilsulfóxido (concentración final de reacción de DMSO% 1-10)
    En experimentos de PCR en el que la plantilla de ADN es particularmente rico en GC (GC contenido> 60%), añadiendo DMSO puede mejorar la reacción mediante la interrupción de apareamiento de bases y reduciendo efectivamente la Tm. Algunas calculadoras T m incluyen una entrada variable para la adición de la concentración de DMSO deseado en el experimento de PCR. Sin embargo, la adición de más de un 2% de DMSO puede requerir la adición de más de la polimerasa del ADN, que se ha demostradotrado para inhibir la polimerasa Taq ADN.
  2. Formamida (concentración final de reacción de 1.25-10%)
    Al igual que el DMSO, formamida también interrumpe el apareamiento de bases, mientras que el aumento de la rigurosidad de la hibridación del cebador, que se traduce en menos hibridación no específica y la eficiencia de amplificación mayor. Formamida también ha demostrado ser un potenciador de las plantillas de GC ricos.
  3. 7-desaza-2'-desoxiguanosina 5'-trifosfato (concentración final de reacción de CC 7 GTP; 3 cc 7 GTP: 1 dGTP 50 mM)
    Utilizando 3 partes, o uM 37.5, de la guanosina base analógica CC 7 GTP en conjunción con una parte, o 12,5 mM, dGTP desestabilizará formación de estructuras secundarias en el producto. Como el ADN amplificado se desnaturaliza o plantilla, que a menudo se forman estructuras secundarias tales como los bucles de horquilla. Incorporación de CC 7 GTP en la amplificación de ADN se prohíbe la formación de estas estructuras aberrantes.

Nota:

7 GTP atenúa la señal de tinción con bromuro de etidio por lo que se utiliza en una proporción de 3:1 con dGTP.

  1. La betaína (concentración final de reacción de 0,5 M a 2,5 M)
    La betaína (N, N, N-trimetilglicina) es un análogo de zwitteriónico aminoácido que reduce e incluso puede eliminar la dependencia de la temperatura de fusión del ADN en la composición de nucleótidos. Se utiliza como un aditivo para ayudar a la amplificación por PCR de GC blancos ricos. La betaína se emplea a menudo en combinación con DMSO y puede mejorar enormemente la probabilidad de ADN diana de amplificación con alto contenido de GC.

11. Los aditivos que ayudan a la PCR en la presencia de inhibidores

  1. Detergentes no iónicos funcionan para suprimir la formación de estructura secundaria y ayudar a estabilizar la DNA polimerasa. Detergentes no iónicos tales como Triton X-100, Tween 20, o NP-40 puede ser utilizado en concentraciones de reacción de 0,1 a 1% con el fin de aumentar la producción de amplificación. Sin embargo, Concentrciones superiores a 1% puede ser inhibitoria para la PCR. La presencia de detergentes no iónicos disminuye el rigor de PCR, que puede conducir a la formación de productos falsos. Sin embargo, su uso también neutralizar el inhibidor afecta de SDS, un contaminante ocasional de protocolos de extracción de ADN.
  2. La adición de proteínas específicas, tales como albúmina de suero bovino (BSA) utilizado en 400 gen ng / l, y / o T4 32 a 150 proteína ayuda PCR ng / l en presencia de inhibidores como FeCl 3, la hemina, ácido fúlvico, ácido húmico, Los ácidos tánicos, o extractos de las heces, el agua dulce y agua marina. Sin embargo, algunos inhibidores de la PCR, incluyendo sales biliares, bilirrubina, EDTA, NaCl, SDS, o Triton X-100, no están aliviados mediante la adición de cualquiera de BSA o proteína T4 gen 32.

12. Las modificaciones de las condiciones del ciclo

  1. La optimización de la temperatura de recocido mejorará cualquier reacción de PCR y debe ser considerada en combinación con otros aditivos y / o junto con otros MO dificaciones a las condiciones del ciclo. Así, con el fin de calcular la temperatura óptima de la siguiente ecuación se emplea:
    T a T OPT = 0,3 + 0,7 m Primer T Producto -14,9 m
    T imprimación m se calcula como la Tm del par menos estable mediante la ecuación:
    Primer T m = ((ΔH / (ΔS + R x ln (c / 4))) -273,15 + 16.6 log [K +] ¿Dónde ΔH es la suma de las variaciones de entalpía más cercanos vecinos de los híbridos, S es la suma de la más cercanos los cambios de entropía vecinos, R es la constante del gas (1,99 cal K-1 mol-1), C es la concentración de cebador, y [K +] es la concentración de potasio.
    La última ecuación se puede calcular utilizando una de las calculadoras T m enumerados en la siguiente dirección:
    rs / fusión / sup_mat / servers_list.html "target =" _blank "> http://protein.bio.puc.cl/cardex/servers/melting/sup_mat/servers_list.html
    T producto m se calcula como sigue:
    T = 0,41 m del producto (% GC) + 16.6 log [K +] - longitud 675/product
    Para la mayoría de las reacciones de PCR de la concentración de potasio ([K +]) va a ser de 50 mm.
  2. Caliente PCR de inicio es una modificación versátil en el que se aumenta el tiempo de desnaturalización inicial dramáticamente (Tabla 4). Esta modificación se puede incorporar con o sin otras modificaciones a las condiciones del ciclo. Además, a menudo se utiliza junto con aditivos para la formación de amplificación temperamental. De hecho, con inicio caliente PCR se incluye cada vez más como un aspecto periódico de las condiciones generales de ciclismo. De arranque en caliente se ha demostrado para aumentar el rendimiento de amplificación, mientras que el aumento de la especificidad y la fidelidad de la reacción.La razón detrás de calor PCR comienzo es eliminar de dímeros y el cebado no específico, que puedan resultar como consecuencia de la creación de la reacción por debajo de la Tm. Por lo tanto, una reacción típica de arranque en caliente se calienta la muestra a una temperatura por encima del óptimo T m, al menos a 60 ° C antes de cualquier amplificación es capaz de producir. En general, la DNA polimerasa se retiene de la reacción durante el período inicial, el tiempo alargado, desnaturalización. Aunque otros componentes de la reacción a veces se omite en lugar de la ADN polimerasa, aquí nos concentraremos en la DNA polimerasa. Hay varios métodos que permiten la ADN polimerasa a permanecer inactivo o físicamente separados hasta que el período inicial de desnaturalización se ha completado, incluyendo el uso de una barrera de cera sólida, anticuerpos anti-ADN polimerasa, y proteínas accesorias. Alternativamente, el ADN polimerasa simplemente se puede añadir a la reacción después del ciclo inicial de desnaturalización es completa.
  3. Momento del aterrizaje PCR (TD-PCR) esla intención de tomar algunas de las conjeturas de las limitaciones de cálculo T m con corchetes las temperaturas calculadas de recocido. El concepto es diseñar dos fases de ciclismo condiciones (Tabla 5). La primera fase cuenta con cada vez menor la temperatura de recocido cada segundo ciclo (tradicionalmente 1,0 ° C), a partir de 10 ° C por encima y terminando en la calculada m T o ligeramente por debajo. La segunda fase utiliza el estándar de 3 pasos con las condiciones de la temperatura de hibridación fijado en el 5 ° C inferior a la calculada T m por 20 a 25 ciclos. La función de la primera fase debe aliviar mispriming, confiere una ventaja 4-veces para el producto correcto. Así, después de 10 ciclos, una ventaja 410-veces daría 4096 copias del producto correcto sobre cualquier cebado espuria.
    • Stepdown PCR es similar a TD-PCR con un menor número de incrementos en la primera fase de cebado. Como un ejemplo, la primera fase reduce la temperatura de recocido cadasegundo ciclo de 3 ° C, a partir de 10 ° C por encima y terminando a 2 ° C por debajo del calculado T m. Como TD-PCR, la fase dos utiliza el estándar de 3-pasos condiciones con la temperatura de recocido fijado en 5 ° C por debajo de la T m calculado por otros 20 a 25 ciclos. Esto permitiría que el producto correcto una ventaja 256-veces sobre los productos de imprimación falsos.
    • Desaceleración del PCR es simplemente una modificación de TD-PCR y ha sido un éxito para amplificar extremadamente rico en GC (por encima de 83%) secuencias (Tabla 6). El concepto tiene en cuenta una característica relativamente nueva asociada con modernos termocicladores, lo que permite el ajuste de la velocidad de rampa, así como la velocidad de enfriamiento. El protocolo también utiliza CC 7 GTP para reducir la formación de estructura 2 ° que podría inhibir la reacción. La rampa de velocidad se reduce a 2,5 ° C s -1 con una velocidad de enfriamiento de 1,5 ° C s -1 para los ciclos de recocido. La primera fase se inicia con un unnealing temperatura de 70 ° C y reduce la temperatura de recocido por 1 ° C cada 3 rondas hasta que alcanza 58 ° C. La segunda fase continúa entonces con una temperatura de hibridación de 58 ° C durante un período adicional de 15 ciclos.
  4. PCR es una poderosa herramienta para eliminar los productos falsos. El uso de cebadores anidados es particularmente útil cuando hay varios genes paralogous en un único genoma o cuando hay bajo número de copias de una secuencia diana dentro de una población heterogénea de secuencias orthologous. El procedimiento básico consiste en dos juegos de cebadores que amplifican una región del ADN. Los cebadores externos horcajadas sobre el segmento de interés y se utilizan para generar productos de PCR que son a menudo no específica en 20 a 30 ciclos. Una pequeña alícuota, generalmente alrededor de 5 l de la primera reacción de 50 l, se utiliza entonces como la plantilla de ADN por otros 20 a 30 rondas de amplificación utilizando el segundo conjunto de cebadores que se reasocian a una ubicación relativa internaa la primera serie.

Otros protocolos de PCR son más especializados y van más allá del alcance de este documento. Los ejemplos incluyen RACE-PCR, PCR multiplex, vectorette-PCR, PCR cuantitativa, y RT-PCR.

13. Los resultados representativos

Representativos resultados de la PCR se generaron siguiendo los protocolos básicos de PCR descrito anteriormente. Los resultados incorporar varias estrategias de solución de problemas para demostrar el efecto de diversos reactivos y condiciones de la reacción. Los genes de la levadura de gemación Saccharomyces cerevisiae y de un mycobacteriophage uncharacterized fueron amplificados en estos experimentos. El estándar 3-paso de PCR protocolo descrito en la Tabla 2 se empleó para los tres experimentos descritos a continuación.

Antes de establecer el experimento de PCR, el ADN genómico de S. tanto cerevisiae y el mycobacteriophage se cuantificaron y se diluyó a una concentración que alloW entre 10 4 y 10 7 moléculas de ADN por reacción. Las existencias de trabajo se prepararon como sigue. Una preparación de ADN genómico de levadura dio 10 4 ng / l. Una dilución a 10 ng / l fue generado mediante la adición de 48 l en 452 l de pH 8,0 tampón TE. Dado que el S. cerevisiae genoma es de aproximadamente 12,5 MB, 10 ng contiene 7.41 x 10 5 moléculas. La preparación mycobacteriophage ADN genómico dio 313 ng / l. Una dilución de 2 ng / l fue generado mediante la adición de 6,4 l en 993,6 l de pH 8,0 tampón TE. Este ADN del fago es de aproximadamente 67 kb. Así, 1 ng contiene 2,73 X 10 7 moléculas, que se encuentra en el límite superior de ADN utilizado generalmente para una PCR. Las existencias de trabajo fueron utilizados para generar las soluciones Mix Master descritas en la Tabla 7. Los experimentos variaba ciclismo condiciones como se describe a continuación.

En la Figura 3a, el ADN genómico de S. cerevisiae se utiliza como una plantilla para amplificarel gen GAL3, que codifica una proteína implicada en el metabolismo de la galactosa. El objetivo de este experimento fue determinar la óptima concentración de Mg 2 + para este conjunto de reactivos. N MgCl 2 estaba presente en el original de tampón de PCR y tuvo que ser complementado a las concentraciones indicadas con una gama probada de 0,0 mM a 5,0 mM. Como se muestra en la figura, un producto de PCR del tamaño esperado (2098 pb) aparece a partir de una Mg 2 + concentración de 2,5 mM (calle 6) con una concentración óptima a 4,0 mM (calle 9). La concentración recomendada proporcionado por el fabricante fue de 1,5 mM, que es la cantidad prevista en tampones típicos de PCR. Tal vez sorprendentemente, la concentración necesaria necesaria para la formación de productos en este experimento superó esta cantidad.

Una plantilla de ADN diferente se utilizó para el experimento se presenta en la Figura 3b. ADN genómico de una mycobacteriophage fue utilizado para amplificar un segmento de ADN conservado 566 pb.Al igual que el experimento anterior, el óptimo de Mg 2 + concentración tenía que ser determinada. Como se muestra en la Figura 3b, la amplificación del deseado producto de PCR requiere al menos 2,0 mM de Mg 2 + (carril 5). Aunque hubo una mayor variabilidad en la cantidad de producto formado en concentraciones crecientes de MgCl 2, el producto más PCR se observó a 4 mM de Mg 2 + (carril 9), la misma concentración observada para la levadura GAL3 gen.

Nótese que en los experimentos presentados en las Figuras 3A y 3B, una banda discreta se obtuvo usando las condiciones de ciclismo que se consideran óptimas basadas en la hibridación del cebador temperaturas. Específicamente, la temperatura de desnaturalización fue de 95 ° C con una temperatura de hibridación de 61 ° C, y la extensión se llevó a cabo durante 1 minuto a 72 ° C durante 30 ciclos. El final de 5 minutos de extensión se realizó a continuación a 72 ° C. Para el tercer experimento presenta en la Figura 3c Figura 3c, lo que era una banda discreto en la Figura 3a, se convierte en un frotis de productos no específicos en estas condiciones de ciclismo sub-óptimas. Además, con el rigor de la reacción global reducido, una menor cantidad de Mg 2 + se requiere para formar una amplificación.

Los tres experimentos muestran que cuando las concentraciones de Mg 2 + son demasiado bajos, no hay producción de amplificación. Estos resultados también demuestran que cuando las dos condiciones de ciclismoestán correctamente diseñado y los reactivos están en concentraciones óptimas, el experimento de PCR produce una amplificación discreta correspondiente al tamaño esperado. Los resultados muestran la importancia de realizar experimentos de PCR en una rigurosidad suficientemente alto (por ejemplo, bandas discretas en comparación con una prueba). Por otra parte, los experimentos indican que el cambio de un parámetro puede influir en otro parámetro, lo que afecta el resultado de reacción.

Reactivo Concentración de las soluciones madre Volumen 13X **
Master Mix
La concentración final
Estéril H 2 O QS a 50 l QS a 650 l
PCR Buffer 10 veces 5 l 65 l 1X
dNTPs 10 mM 1 l 13 l 200 mM
MgCl 2 25 mM 3 l 39 l 1,5 mM
Primer avance 20 mM = 20 pmol / l 1 l 13 l 20 pmol
Cebador inverso 20 mM = 20 pmol / l 1 l 13 l 20 pmol
Patrón de ADN Variable Variable Variable ~ 10 5 moléculas
Taq DNA Polimerasa 5 unidades / * l 0,5 l L 6,5 2.5 Unidades
50 l / reacción

Tabla 1. Los reactivos de la PCR en el orden en que deben ser agregados.

* Las unidades pueden variar entre los fabricantes

** Añadir todos los reactivos a la mezcla maestra con exclusión de cualquier necesidad de titulación o que puede ser variable para la reacción. La mezcla maestra se muestra en la tabla anterior se calcula para 11 reacciones más 2 reacciones adicionales para acomodar la pérdida de pipeta de transferencia garantizar que haya suficiente para alícuota de cada tubo de reacción.

Norma 3-PCR paso Ciclismo
Ciclo de paso Temperatura Tiempo Número de ciclos de
Desnaturalización inicial 94 ° C a 98 ° C 1 minuto 1
Desnaturalización
Recocido
Extensión
94 ° C
5 ° C por debajo de T m
70 ° C a 80 ° C
10 a 60 segundos
30 segundos
Amplificación de ADN y polimerasa dependiente de
25-35
Extensión Final 70 & dpor ejemplo; C a 80 ° C 5 minutos 1
Mantenga * 4 ° C 1

Tabla 2. Estándar de 3 pasos PCR Ciclismo.

* La mayoría de cicladores térmicos tienen la posibilidad de detener a 4 ° C indefinidamente al final de los ciclos.

70 ° C a 80 ° C
2-step PCR Ciclismo
Ciclo de paso Temperatura Tiempo Número de ciclos de
Desnaturalización inicial 94 ° C a 98 ° C 1 minuto 1
Desnaturalización
Annealing / Extensión
10 a 60 segundos
Amplificación de ADN y polimerasa dependiente de
25-35
Extensión Final 70 ° C a 80 ° C 5 minutos 1

Tabla 3. 2-paso Ciclismo PCR.

Hot Start PCR Ciclismo
Ciclo de paso Temperatura Tiempo Ciclos
Desnaturalización inicial 60 ° C a 95 ° C 5 minutos después añadir la ADN polimerasa 1
Desnaturalización
Recocido
Extensión
94 ° C
5 ° C por debajo de T m
70 ° C a 80 ° C
10 a 60 segundos
30 segundos
Amplificación de ADN y polimerasa dependiente de
25-35
Extensión Final 70 ° C a 80 ° C 5 minutos 1

Tabla 4. Hot Start PCR Ciclismo.

Momento del aterrizaje PCR Ciclismo
Ciclo de paso Temperatura Tiempo Ciclos
Desnaturalización inicial 94 ° C a 98 ° C 1
Desnaturalización
Recocido
Extensión
94 ° C
X = 10 ° C por encima de Tm
70 ° C a 80 ° C
10 a 60 segundos
30 segundos
Amplificación de ADN y polimerasa dependiente de
2
Desnaturalización
Recocido


Extensión
94 ° C
X-1 ° C reducir la 1 ° C cada ciclo de otra
70 ° C a 80 ° C
10 a 60 segundos
30 segundos
Amplificación de la polimerasa dependiente de
28
Desnaturalización
Recocido
Extensión 94 ° C
5 ° C por debajo de T m
70 ° C a 80 ° C
10 a 60 segundos
30 segundos
Amplificación de ADN y polimerasa dependiente de
20-25
Extensión Final 70 ° C a 80 ° C 5 minutos 1

Tabla 5. Touchdown PCR Ciclismo.

Desaceleración PCR Ciclismo
Ciclo de paso Temperatura Tiempo Ciclos
Desnaturalización inicial 94 ° C a 98 ° C 1 minuto 1
Desnaturalización
Recocido
Extensión
94 ° C
X ° C = 10 ° C por encima de Tm
70 ° C a 80 ° C
10 a 60 segundos
30 segundos
Amplificación de la polimerasa dependiente de
2
Desnaturalización
Recocido


Extensión
94 ° C
X-1 ° C reducir la 1 ° C cada ciclo de otra
70 ° C a 80 ° C *
10 a 60 segundos
30 segundos
Amplicon y polimerasa dependiente
28
Desnaturalización
Recocido
Extensión
94 ° C
5 ° C por debajo de T m
70 ° C a 80 ° C
10 a 60 segundos
30 segundos
Amplificación de la polimerasa dependiente de
20-25
Extensión Final 70 ° C a 80 ° C 5 minutos 1

Tabla 6. Desaceleración PCR Ciclismo.

* Para la desaceleración de PCR, la velocidad de la rampa se reduce a 2,5 ° C s -1 con una velocidad de enfriamiento de 1,5 ° C s -1 para los ciclos de recocido.

Solución de archivo Volumen añadido a 50 reacción l 13 de levadura X Master Mix 13 X Fago Master Mix La concentración final
Estéril H 2 O cs hasta 50 l = 31 l o 30,5 cs hasta 650 l = 396,5 cantidad suficiente para 520 l = 403 l
PCR Buffer 10 veces 5 l 65 l 65 l 1X
10 mM 1 l 13 l 13 l 200 mM
MgCl 2 Valoración Añadido a cada reacción Añadido a cada reacción Añadido a cada reacción Variable de valoración
Primer avance 20 mM = 20 pmol / l 1 l 13 l 13 l 20 pmol
Cebador inverso 20 mM = 20 pmol / l 1 l 13 l 13 l 20 pmol
Patrón de ADN 2 ng / l fago o 10 levadura ng / l 0,5 fago l o 1 l de levadura L 6,5 13 l ~ 10 7 Moléculas Fago o ~ 10 levadura 5 Moléculas
Polimerasa 0,5 unidades / l ** 0,5 l L 6,5 L 6,5 0,5 unidades / reacción
L 40 + 10 (titulación) l / reacción TITULACIÓN
[MgCl 2] 0,00 mM 0,5 mM 1,0 mM 1,5 mM 2,0 mM 2,5 mM 3,0 mM 3,5 mM 4,0 mM 4,5 mM 5,0 mM
MgCl 2 0,00 l 1,00 l 2,00 l 3,0 l 4,00 l 5,00 l 6,00 l 7,00 l 8,00 l 9,00 l 10,00 l
H 2 O 10,00 l 9,00 l 8,00 l 7,00 l 6,00 l 5,00 l 4,00 l 3,00 l 2,00 l 1,00 l 0,00 l

<fuerte> Tabla 7. Titulación de Mg 2 + utilizada en la figura 3.

Figura 1
Figura 1. Problemas comunes que surgen con los cebadores y 3-paso de amplificación por PCR de DNA diana. (A) auto-hibridación de los cebadores resultantes en la formación de estructura secundaria bucle de horquilla. Nótese que los cebadores no siempre recocido en los extremos y se pueden formar pequeñas estructuras de bucle. (B) la hibridación del cebador a la otra, en lugar de la plantilla de ADN, la creación de dímeros de cebadores. Una vez que los cebadores hibridan con la otra que se alargará hasta los confines de cebadores. (C) ciclos de PCR generar una amplificación específica. Norma 3-paso de PCR ciclismo incluyen desnaturalización de la plantilla de ADN, hibridación de los cebadores, y la extensión del ADN diana (amplicón) por la DNA polimerasa.

Figura 2
Figura 2. Cubo de hielo con Reagpadres, pipetas, y los estantes se requiere para una PCR. (1). P-200 de pipeta, (2). P-1000 de pipeta, (3). P-20 de pipeta, (4). P-10 pipeta, (5). Placa de 96 pocillos y 0,2 ml de tubos de pared delgada de PCR , (6). Reactivos incluyendo Taq polimerasa, tampón 10X de PCR, MgCl 2, agua estéril, dNTPs, cebadores, y ADN molde, (7). 1,8 ml tubos y la cremallera.

Figura 3
Figura 3. Ejemplo de una Mg 2 + titulaciones utilizados para optimizar un experimento de PCR utilizando un estándar de 3-paso protocolo de PCR. (A) S. La levadura Saccharomyces ADN genómico se utiliza como una plantilla para amplificar un gen 2098 pb GAL3. En los carriles 1 a 6, donde el Mg 2 + concentración es demasiado baja, o bien hay ningún producto formado (carriles 1-5) o muy poco producto formado (carril 6). Carriles 7 a 11 representan las concentraciones óptimas de Mg 2 + para este experimento de PCR como se indica por la presencia del producto amplificado 2098 pb. (B) Un uncharacterigenómica zed mycobacteriophage plantilla de ADN se utilizó para amplificar una amplificación de 566 pb. Los carriles 1 a 4, el Mg 2 + concentración es demasiado baja, como se indica por la ausencia de producto. Carriles 5 a 11 representan las concentraciones óptimas de Mg 2 + para esta PCR como se indica por la presencia del producto de amplificación 566 kb. (C). S. La levadura Saccharomyces ADN genómico se utiliza como una plantilla para amplificar un 2098 pb GAL3 gen como se indica en un panel. Sin embargo, la temperatura de recocido se redujo de 61 ° C a 58 ° C, resultando en algunas bandas no específicos de PCR con longitudes variables que producen un efecto manchas en el gel de agarosa. Las calles 1 a 4, donde el Mg 2 + concentración es demasiado baja, no hay producto que se forma. Carriles 5 a 8 representan las concentraciones óptimas de Mg 2 + para esta PCR como se ve por la presencia de un frotis y la banda alrededor del tamaño de 2098 kb producto de amplificación. Los carriles 9 a 11 son indicativos de condiciones excesivamente estrictas con ningún producto formado. (Ac) carriles 12 es una negatiVe de control que no contenía ningún ADN molde. Carril M (marcador) fue cargado con NEB Ladder 1kb.

Figura 4
Figura 4. Tubos estériles utilizados para la PCR. (1.) 1,8 ml tubo (2). 0,2 ml persona tubo delgado PCR, (3.) De 0,2 ml tubos de paredes delgadas tiras de PCR y las tapas.

Figura 5
Figura 5. Termociclador. Cierra la imagen izquierda ciclador térmico. Imagen derecha contiene 0,2 ml tubos de pared delgada de PCR colocados en el bloque de calentamiento de un termociclador abierto.

Discussion

PCR se ha convertido en una herramienta indispensable en el arsenal de la ciencia biológica. PCR ha alterado el curso de la ciencia que permite a los biólogos a ceder el poder sobre los genomas, y hacer que los genes híbridos con nuevas funciones, permitiendo que las pruebas clínicas específicas y precisas, obteniendo conocimientos sobre los genomas y la diversidad, así como los genes simplemente de clonación para el análisis bioquímico más. Aplicación de la PCR está limitado sólo por la imaginación de los científicos que ejerce su poder. Hay muchos libros y artículos que describen los nuevos usos especializados de la PCR, y muchos más que se desarrollará en la próxima generación de la ciencia biológica. Sin embargo, independientemente de los enfoques previstos, el marco fundamental se ha mantenido el mismo. PCR, en toda su grandeza, es una aplicación in vitro para generar grandes cantidades de un segmento específico de ADN.

El diseño de un experimento de PCR requiere de pensamiento y de paciencia. Los resultados mostrados en la Figura 3 ejemplifican uno de los canales principalesallenges la hora de diseñar una estrategia de optimización para la PCR. Es decir, como un parámetro de la PCR se cambia, puede afectar a otra. Como un ejemplo, si la PCR inicial se llevó a cabo a la temperatura sub-óptima de recocido (58 ° C) con un óptimo de Mg 2 + concentración de 2,0 mM, a continuación, el resultado sería producir un frotis como se ve en la Figura 3c. Un intento de resolver el frotis puede implicar la creación de las condiciones de PCR con las reacciones que contienen 2,0 mM MgCl 2 y el ajuste de la temperatura de templado a 61 ° C. Sin embargo, como se ve en la Figura 3a, esto no produciría ningún producto. En consecuencia, es aconsejable titular reactivos, en lugar de añadir una concentración a una sola reacción, cuando reparación resultados falsos. Además, los ajustes más comunes que se requieren para la optimización de un experimento de PCR son para cambiar el Mg 2 + concentración y para corregir las temperaturas de recocido. Sin embargo, si estos cambios no minimizar o anular los resultados aberrantes, la valoración de additiVES y / o cambiar los protocolos de la condición de ciclismo que se describen en las Tablas 2-6 puede aliviar el problema. Si todo esto falla, rediseñar los cebadores y de intentar, intentar de nuevo.

Disclosures

No tengo nada que revelar.

Acknowledgments

Un agradecimiento especial a Kris Reddi en la UCLA para la creación de reactivos y verter los geles y Erin Sanders en la UCLA en busca de inspiración, guía y apoyo y la corrección del manuscrito. También me gustaría que gracias Giancarlo Costaguta y Gregory S. Payne para suministrar el ADN genómico de la levadura y los cebadores para amplificar el gen GAL3. También me gustaría dar las gracias a Shah Bhairav ​​para tomar fotografías de los equipos de laboratorio y los reactivos utilizados para hacer las figuras 2 a 4. Los fondos para este proyecto fue proporcionado por el HHMI (HHMI Grant N º 52.006.944).

Materials

Name Company Catalog Number Comments
Taq Polymeras Sigma-Aldrich D4545-25UN
dNTPs Qiagen 201225
0.2 ml Thin Wall Tubes PCR tubes Bio-Rad 223-9469
0.2 ml Thin Wall Tube caps Bio-Rad 223-9472
EDTA disodium salt dihydrate Sigma-Aldrich E5134
Trizma-HCl Sigma-Aldrich T-3253
Custom Phage Primer Invitrogen 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG
Custom Phage Primer Invitrogen 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT
Custom Yeast Primer Integrated DNA Technologies SacI-Gal3(-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG
Custom Yeast Primer Integrated DNA Technologies Gal3(1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG
Thermal Cycler Bio-Rad 170-9703 My Cycler
Agarose ISC BioExpress E-3120-500
Gel electrophoresis Hoeffer Scientific Instruments Model HE33
1 kb DNA Ladder New England Biolabs N3232S
Bio Rad Power Pack Bio-Rad 164-5050 PowerPac Basic
Gel Doc system Fotodyne Incorporated FOTO/Analyst Investigator FX Workstation

DOWNLOAD MATERIALS LIST

References

  1. Albert, J., Fenyo, E. M. Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers. J. Clin. Microbiol. 28, 1560-1564 (1990).
  2. Baskaran, N., et al. Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content. Genome Res. 6, 633-638 (1996).
  3. Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. PCR buffer optimization with uniform temperature regimen to facilitate automation. PCR Methods Appl. 2, 234-240 (1993).
  4. Borer, P. N., Dengler, B., Tinoco, I. Jr, Uhlenbeck, O. C. Stability of ribonucleic acid double-stranded helices. J. Mol. Biol. 86, 843-853 (1974).
  5. Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. Predicting DNA duplex stability from the base sequence. Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).
  6. Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications. Nucleic Acids Res. 20, 1717-1723 (1992).
  7. Coleman, W. B., Tsongalis, G. J. Diagnostics for the clinical laboration. Humana Press. (2005).
  8. D'Aquila, R. T., et al. Maximizing sensitivity and specificity of PCR by pre-amplification heating. Nucleic Acids Res. 19, 3749 (1991).
  9. Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. General concepts for PCR primer design. PCR Methods Appl. 3, S30-S37 (1993).
  10. Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. 'Touchdown' PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res. 19, 4008 (1991).
  11. Erlich, H. A., Gelfand, D., Sninsky, J. J. Recent advances in the polymerase chain reaction. Science. 252, 1643-1651 (1991).
  12. Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. PCR-amplification of GC-rich regions: 'slowdown PCR. Nat. Protoc. 3, 1312-1317 (2008).
  13. Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. Specific amplification with PCR of a refractory segment of genomic DNA. Nucleic Acids Res. 16, 11844 (1988).
  14. Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. Betaine improves the PCR amplification of GC-rich DNA sequences. Nucleic Acids Res. 25, 3957-3958 (1997).
  15. Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. PCR Protocols: A guide to methods and applications. Academic Press, Inc. San Diego. (1990).
  16. King, N. Methods in Molecular Biology. 630, Humana Press. (2010).
  17. Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases. J. Mol. Biol. 56, 341-361 (1971).
  18. Korbie, D. J., Mattick, J. S. Touchdown PCR for increased specificity and sensitivity in PCR amplification. Nat. Protoc. 3, 1452-1456 (2008).
  19. Kramer, M. F., Coen, D. M. Enzymatic amplification of DNA by PCR: standard procedures and optimization. Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).
  20. Kramer, M. F., Coen, D. M. The polymerase chain reaction. Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).
  21. Kreader, C. A. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl. Environ. Microbiol. 62, 1102-1106 (1996).
  22. Kwok, S., et al. Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection. J. Virol. 61, 1690-1694 (1987).
  23. McConlogue, L., Brow, M. A., Innis, M. A. Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine. Nucleic Acids Res. 16, 9869 (1988).
  24. Mullis, K. B. The unusual origin of the polymerase chain reaction. Sci. Am. 262, 56-65 (1990).
  25. Mullis, K. B. Target amplification for DNA analysis by the polymerase chain reaction. Ann. Biol. Clin. (Paris). 48, 579-582 (1990).
  26. Mullis, K. B. The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion). PCR Methods Appl. 1, 1-4 (1991).
  27. Mullis, K. B., Faloona, F. A. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155, 335-350 (1987).
  28. Paabo, S., Gifford, J. A., Wilson, A. C. Mitochondrial DNA sequences from a 7000-year old brain. Nucleic Acids Res. 16, 9775-9787 (1988).
  29. Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. Betaine can eliminate the base pair composition dependence of DNA melting. Biochemistry. 32, 137-144 (1993).
  30. Roux, K. H., Hecker, K. H. One-step optimization using touchdown and stepdown PCR. Methods Mol. Biol. 67, 39-45 (1997).
  31. Rychlik, W., Spencer, W. J., Rhoads, R. E. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Saiki, R. K., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, 487-491 (1988).
  33. Saiki, R. K., et al. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 230, 1350-1354 (1985).
  34. Sambrook, J. A. R., David, W. Molecular Cloning A Laboratory Manual. 2, 3, Cold Spring Harbor Laboratory Press. (2001).
  35. Sarkar, G., Kapelner, S., Sommer, S. S. Formamide can dramatically improve the specificity of PCR. Nucleic Acids Res. 18, 7465 (1990).
  36. Smit, V. T., et al. KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas. Nucleic Acids Res. 16, 7773-7782 (1988).
  37. Wilson, I. G. Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol. 63, 3741-3751 (1997).
  38. Wu, R. Methods in Enzymology. 218, Academic Press, Inc. San Diego. (1993).

Comments

1 Comment

  1. Thanks for the great overview of the all-important PCR procedure. I will no doubt reference it often in the future.

    I have a PCR troubleshooting question...what do to about streaking on the gel after a successful amplification? My bands are nice and bright and where they are supposed to be, but there is a heavily-streaked "path" starting at the wells and following until the end where my bands are. Is there something I can do about my PCR conditions, or the thermocycler settings? Any comments would be appreciated.

    Reply
    Posted by: Doug E.
    September 8, 2013 - 1:23 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics