खमीर एकाधिक जीन विलोपन ले उपभेदों की पीढ़ी के लिए ग्रीन दानव प्रक्रिया

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

ग्रीन दानव विधि एकाधिक एक संवाददाता जीन एन्कोडिंग हरे फ्लोरोसेंट प्रोटीन के साथ चिह्नित विलोपन के तेजी से विधानसभा के लिए सक्षम बनाता है. इस विधि खमीर उपभेदों विलोपन के यौन वर्गीकरण के दोहराया चक्र और अधिक विलोपन कोशिकाओं को ले जाने की प्रतिदीप्ति आधारित संवर्धन के माध्यम से ड्राइविंग पर आधारित है.

Cite this Article

Copy Citation | Download Citations

Suzuki, Y., Stam, J., Novotny, M., Yachie, N., Lasken, R. S., Roth, F. P. The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions. J. Vis. Exp. (70), e4072, doi:10.3791/4072 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Protocol

1. ProMonsters का सृजन

  1. एक 2-GFP मार्कर teto और प्लाज्मिड (एम्पीसिलीन प्रतिरोध) pYOGM012 दृश्यों के साथ प्राइमरों का उपयोग करने से URA3 मार्कर amplifying द्वारा सार्वभौमिक GFP प्रतिस्थापन कैसेट तैयार:
    GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCC CAAGCTCCTCGAGTAATTCG और GGCGTTAGTATCGAATCGACAGCAGTATAGCGACCAGCATTCAC GTACCGGGTAATAACTGATATAAT (bolded क्षेत्रों लक्षित प्रतिस्थापन की अनुमति KanMX4 कैसेट की flanking क्षेत्रों अनुरूपता प्रदान). पीसीआर प्रतिक्रिया Phusion पोलीमरेज़, HF बफर, और 3% डाइमिथाइल sulfoxide (न्यू इंग्लैंड Biolabs) 0.5 एनजी / μl टेम्पलेट डीएनए एकाग्रता के साथ शुरू से बाहर किया जाना चाहिए. पीसीआर कार्यक्रम 98 ° 30 सेकंड और 98 डिग्री सेल्सियस के 35 चक्रों के लिए 10 सेकंड के लिए सी, 49 ° 30 सेकंड के लिए सी, और 1.5 मिनट के लिए सी ° 72 है. प्रतिक्रिया मात्रा> 50 μl प्रत्येक परिवर्तन के प्रयोग के लिए पर्याप्त डीएनए प्रदान करना चाहिए. हम को शुद्ध~ 50 μl पीसीआर स्तंभ प्रति संसाधित प्रतिक्रिया के साथ एक QIAquick पीसीआर शुद्धि किट (Qiagen) का उपयोग कर रहे हैं, लेकिन शोधन कदम लंघन उत्पाद transformants की उपज में वृद्धि हो सकती है.
    वैकल्पिक रूप से, एक टुकड़ा युक्त 2 GFP teto और URA3 मार्करों, के रूप में के रूप में अच्छी तरह से KanMX4 लिए मुताबिक़ क्षेत्रों प्लाज्मिड pYOGM057 (एम्पीसिलीन प्रतिरोध) को पचाने प्रतिबंध एंजाइम EcoRI (न्यू इंग्लैंड Biolabs) का उपयोग करके लक्षित जारी. इस प्रतिक्रिया में डीएनए एकाग्रता ~ 30 एनजी / μl होना चाहिए. प्रतिक्रिया मात्रा> 34 μl होना चाहिए.
    KanMX4 के अलावा अन्य क्षेत्र में GFP कैसेट को एकीकृत करने के लिए, उपयुक्त मुताबिक़ दृश्यों के लिए ऊपर पीसीआर प्राइमरों समरूपता के क्षेत्र समायोजित करें.
  2. सार्वभौमिक GFP विलोपन कैसेट के साथ एक एक अगुणित KanMX4 खमीर पीटकर संग्रह 12 से तनाव रूपांतरण. वुड्स और GIETZ 13 .34 μl द्वारा प्रोटोकॉल के बादडीएनए नमूने (शुद्ध पीसीआर उत्पाद या गैर - शुद्ध प्रतिबंध डाइजेस्ट) प्रत्येक परिवर्तन के प्रयोग के लिए इस्तेमाल किया जाना चाहिए. प्लेट प्लेट CAA Ura पर परिवर्तन मिश्रण के 5 एक (0.67% नाइट्रोजन खमीर बेस के साथ, 2% ग्लूकोज, 0.6% casamino एसिड, 0.0025% adenine hemisulfate, tryptophan 0,005%, और 2% अगर).
  3. बाहर एक ताजा CAA Ura प्लेट पर अलग कालोनियों प्राप्त transformants स्ट्रीक.
  4. एक YPDA 200 छ / मिलीलीटर G418 युक्त करने के लिए विकास की कमी की पुष्टि की थाली पर एक कॉलोनी से कोशिकाओं स्थानांतरण. (1.9) कॉलोनी पीसीआर प्रदर्शन करने के लिए सफल GFP एकीकरण की पुष्टि करने के लिए, (1.5) चरणों का पालन करें.
  5. Lysis बफर के 2 μl (0.1 एम सोडियम फास्फेट, पीएच 7.4, 1 ZymoResearch से इकाई zymolyase) में 0.2 मिलीलीटर पीसीआर ट्यूब या एक 96 अच्छी तरह से थाली की एक अच्छी तरह से में एक कॉलोनी से ली गई कोशिकाओं को जोड़ें. में और बाहर एक विंदुक टिप के समाधान pipetting द्वारा मिक्स.
  6. खनिज तेल के एक ड्रॉप (लगभग 20 μl) एक P200 Pipetman (Gilson) का उपयोग करने के साथ ओवरले.
  7. 37 पर मिश्रण सेते °20 मिनट और 95 में तो ° 10 मिनट के लिए सी सी.
  8. 50 μl पानी के साथ lysate पतला. और दस बार के बाहर समाधान pipetting द्वारा मिक्स.
  9. 1 (ए) एक आगे प्राइमर है कि अपस्ट्रीम flanking क्षेत्र anneals अनुक्रम CCTGAGAAAGCAACCTGACC (कैसेट की शुरुआत से 285 बीपी) की एक किताब के साथ रखा के साथ 10 μl पीसीआर प्रतिक्रियाओं का उपयोग lysate के μl, (बी) एक रिवर्स का विश्लेषण किताब है कि बहाव के क्षेत्र अनुक्रम GCATTGGGTCAACAGTATAG (अंत से 375 बीपी) की एक किताब के साथ जोड़ा, anneals (सी) दो प्राइमरों है है कि दृश्यों CGTACTCCTGATGATGCATG और GACGAAATACGCGATCGCTG (181 बीपी) के साथ KanMX4 के लिए पानी रखना, और (डी) दो प्राइमरों कि लक्षित जीन (4 चित्रा) जंगली प्रकार के अनुक्रम के लिए पानी रखना. (डी) महत्वपूर्ण है क्योंकि विलोपन संग्रह में तनाव के बारे में 8% 14 aneuploidy शामिल जाना जाता है. एक सही transformant साथ सकारात्मक होना चाहिए (ए) और (बी) और नकारात्मक (सी) और (डी).
  10. एक परिचयGMToolkit transformant में, एक 1.6 मिलीलीटर Eppendorf ट्यूब में बदल तनाव से लगभग 250.000 कोशिकाओं और या तो (GMToolkit युक्त) RY0146 या RY0148 (GMToolkit α युक्त) के 250,000 कोशिकाओं को जोड़ने. भंवर. RY0146 और RY0148 की जीनोटाइप MATα lyp1Δ his3Δ1 ura3Δ0 met15Δ0 leu2Δ0 can1Δ :: GMToolkit - एक [KanMX4 CMVpr - rtTA STE2pr-SP-his5] और MATα lyp1Δ his3Δ1 ura3Δ0 met15Δ0 leu2Δ0 can1Δ :: GMToolkit-α [CMVpr rtTA NatMX4 STE3pr- LEU2 क्रमशः]. जनसंपर्क प्रमोटर अर्थ. सेल संख्या पूर्ववर्ती संस्कृति के ऑप्टिकल घनत्व से आकलन किया जाना चाहिए.
  11. 2 मिनट के लिए 800 XG अपकेंद्रित्र.
  12. तैरनेवाला निकालें.
  13. हवा आदान प्रदान के लिए अनुमति देने के लिए, एक 70% इथेनॉल के साथ इलाज के नक़्शे की पिन का उपयोग ढक्कन पर एक छेद बना.
  14. 50 YPDA मध्यम (1% खमीर निकालने, peptone 2%, 2% ग्लूकोज, और 0.003% adenine hemisulfat μl जोड़ेंई). भंवर.
  15. 5 मिनट के लिए 800 XG अपकेंद्रित्र.
  16. एक नम बॉक्स में ट्यूब रखें. यह एक खाली टिप बॉक्स, एक छोटी सी टिप स्टैंड, और एक गीला कागज तौलिया के साथ बनाया जा सकता है.
  17. बॉक्स 30 पर रातोंरात सेते डिग्री सेल्सियस
  18. 1 बाहर एक थाली CAA-Ura कोशिकाओं पर streaking द्वारा diploids mated का चयन करें. 30 डिग्री सेल्सियस से कम एक दिन के लिए थाली सेते हैं.
  19. थोक क्षेत्र लकीर से कोशिकाओं लेना उन्हें बाहर करने के लिए YPDA प्लेटों पर अलग कालोनियों (1% खमीर निकालने, peptone 2%, 2% ग्लूकोज, 0.003% adenine hemisulfate, और 2% अगर) diploids का चयन करने के लिए 200 ग्राम / मिलीलीटर G418 युक्त बनाने युक्त GMToolkit एक या 100 ग्राम / एमएल (नेट) nourseothricin युक्त GMToolkit-α diploids का चयन करने के लिए 15.
  20. 3 दिनों के लिए 30 डिग्री सेल्सियस पर थाली सेते हैं.
  21. एक अलग कॉलोनी से शुरू, अगर बिना GNA माध्यम के 500 μl कोशिकाओं के अधिकांश हस्तांतरण (1% खमीर निकालने, 3% DIFCO पोषक तत्व शोरबा, और 5% ग्लूकोज, आटोक्लेव ग्लूकोज और टी के बाकीवह घटकों को अलग रूप में 2 × caramelization से बचने के लिए एक 5 मिलीग्राम ढक्कन के साथ संस्कृति ट्यूब में समाधान) ढीला.
  22. ट्यूब क्षैतिज में पाँच घंटे के लिए बारी बारी से 30 डिग्री सेल्सियस रोटेशन की धुरी ट्यूब के अनुदैर्ध्य अक्ष के समानांतर होने की जरूरत है.
  23. पुष्टि करें कि कालोनियों में प्रयोग किया जाता है (1.21) ura उन्हें एक थाली CAA-Ura पर बाहर streaking द्वारा + हैं.
  24. 2 मिनट के लिए 800 XG पर ट्यूब अपकेंद्रित्र. तैरनेवाला त्यागें.
  25. न्यूनतम sporulation मध्यम (फिल्टर बाँझ बनाना 1% पोटेशियम एसीटेट, 0,005% जस्ता एसीटेट) के 500 μl जोड़ें. भंवर.
  26. 2 मिनट के लिए 800 XG पर ट्यूब अपकेंद्रित्र. तैरनेवाला त्यागें.
  27. (1.25) दोहराएँ (1.26) में दो बार.
  28. न्यूनतम sporulation 7.5 छ / मिलीलीटर lysine, 7.5 ग्राम / एमएल leucine, 5 / छ एमएल हिस्टडीन, 5 ग्राम / मिलीलीटर methionine, और 1.25 uracil छ / मिलीलीटर (sporulation auxotrophic उपभेदों की दर में वृद्धि करने के लिए) के साथ पूरक मध्यम के 1 मिलीलीटर जोड़ें . भंवर.
  29. कमरे के तापमान पर एक दिन के लिए ट्यूब घुमाएँ.
  30. 2 दिनों के लिए 30 डिग्री सेल्सियस पर ट्यूब घुमाएँ.
  31. 2 मिनट के लिए 800 XG में 1.6 मिलीलीटर Eppendorf ट्यूब में इस मिश्रण के 125 μl अपकेंद्रित्र. तैरनेवाला त्यागें.
  32. Zymolyase समाधान (100 मिमी सोडियम फॉस्फेट बफर, पीएच 7.4, 1 sorbitol एम, और 2 ZymoResearch से इकाइयों zymolyase) के 50 μl जोड़ें. में और बाहर एक विंदुक टिप के समाधान pipetting द्वारा मिक्स.
  33. 1 घंटा के लिए 30 डिग्री सेल्सियस पर सेते हैं.
  34. 0.02% NP-40 के 50 μl जोड़ें. में और बाहर एक विंदुक टिप के समाधान pipetting द्वारा मिक्स.
  35. पांच मिनट के लिए कमरे के तापमान पर ट्यूब छोड़ दें.
  36. पानी की 500 μl जोड़ें.
  37. बर्फ पर ट्यूब रखें.
  38. इस मिश्रण में दो बार 15 सेकंड के लिए 1 के उत्पादन सेटिंग (सबसे कमजोर सेटिंग) का उपयोग कर Sonifier 450 (Branson) के साथ एक 3.2 मिमी microtip में Sonicate. Sonication के दो दौर के बीच बर्फ ट्यूब पर डाल ~ 0 डिग्री सेल्सियस तापमान वापसी
  39. 5 मिनट के लिए 800 XG ट्यूबों अपकेंद्रित्र. तैरनेवाला त्यागें.
  40. SC-Ura उनका 200 μl जोड़ें(क) या अनुसूचित जाति Ura-Leu (α) मध्यम, चाहे पार GMToolkit एक या GMToolkit α को शामिल करने के लिए है पर निर्भर करता है. मीडिया तैयार करते हैं, SC-Ura उसकी Leu मध्यम (0.67% नाइट्रोजन खमीर बेस के साथ, 2% ग्लूकोज, 0.01% arginine, 0.01% एसपारटिक एसिड, 0.01% glutamic एसिड, 0.01% isoleucine, 0.01% lysine, 0.01 methionine% , 0.01% फेनिलएलनिन सेरीन 0.08%, 0.04% threonine, 0.002% tyrosine, valine 0.03%, एडेनाइन ०.०,०२५%, 0,005% tryptophan, 0.003% adenine, और 0,005% tryptophan) और यह बाँझ हिस्टडीन या leucine के साथ पूरक करने के लिए उपयोग करने से पहले 0.01% की अंतिम एकाग्रता.
  41. एक 70% इथेनॉल के साथ इलाज के नक़्शे की पिन का उपयोग ढक्कन पर एक छेद बनाओ.
  42. ट्यूब क्षैतिज 2 दिनों के लिए 30 डिग्री सेल्सियस पर घुमाएँ. रोटेशन की धुरी ट्यूब के अनुदैर्ध्य अक्ष के समानांतर होने की जरूरत है.
  43. अगर अनुसूचित जाति Ura उसके या अनुसूचित जाति Ura-Leu प्लेट (ऊपर के रूप में एक ही सामग्री प्लस 2% अगर कोशिकाओं पर बाहर स्ट्रीक, threonine और एसपारटिक एसिड के बाद जोड़ा जाना चाहिएहिस्टडीन या leucine utoclaving, गिरने से पहले जोड़) ProMonster उपभेदों के लिए अलग - अलग कालोनियों.

2. लैंगिक साइकल चलाना

  1. अनुसूचित जाति उनका 100 μl (एक) या (α) अनुसूचित जाति-Leu 30 में संभोग के प्रकार पर निर्भर करता है में एक स्थापित GFP विलोपन तनाव का एक संस्कृति घुमाएँ ° C रातोंरात एक 1.6 मिलीलीटर Eppendorf ट्यूब का इस्तेमाल करते हैं. हवा आदान प्रदान के लिए एक छेद करने के एक 70% इथेनॉल के साथ इलाज के नक़्शे की पिन का उपयोग. ट्यूब क्षैतिज घुमाएँ. रोटेशन की धुरी ट्यूब के अनुदैर्ध्य अक्ष के समानांतर होने की जरूरत है. यह संभव है करने के लिए सामूहिक रूप से संभोग के माध्यम से कई उपभेदों के पार. जब एक नमूना क्रमबद्ध सीधे 200 μl में इस उद्देश्य, संस्कृति कोशिकाओं के लिए 2 दिनों के लिए 30 डिग्री सेल्सियस पर प्रयोग किया जाता है. SC-Ura उसकी लियू मध्यम और (0.01%) हिस्टडीन या leucine (0.01%) के लिए मध्यम तैयार, uracil (.0025% अंतिम एकाग्रता) जोड़ने.
  2. एक 1.6 मिलीलीटर EPPE में 250.000 एक अगुणित कोशिकाओं और 250.000 GFP विलोपन उपभेदों के α अगुणित कोशिकाओं मिक्सndorf ट्यूब. भंवर.
  3. (1.17) - निम्नलिखित (1.11) कदम से इन कोशिकाओं दोस्त.
  4. 500 μl GNA एक ढीला ढक्कन के साथ एक संस्कृति 5 मिलीलीटर ट्यूब में ग्राम 200 मिलीग्राम / G418 और 100 छ / मिलीलीटर नेट युक्त मध्यम संभोग के मिश्रण के 10 μl स्थानांतरण. शुरू 600 आयुध डिपो 0.1 लगभग है.
  5. 30 डिग्री सेल्सियस पर 24 घंटे के लिए संस्कृति घुमाएँ. यह diploids के चयन के लिए अनुमति देता है, क्योंकि केवल diploids में दोनों KanMX4 युक्त GMToolkit एक और GMToolkit-α में NatMX4 G418 और नेट (3 चित्रा) की उपस्थिति में वृद्धि कर सकते हैं.
  6. ताजा GNA के 500 μl G418 और नेट से युक्त करने के लिए एक दिन संस्कृति की 20 μl स्थानांतरण. शुरू आयुध डिपो 600 लगभग 0.2.
  7. 30 डिग्री सेल्सियस पर 5 घंटे के लिए ट्यूब लॉग चरण (1 ~~ 600 ओवर ड्राफ्ट) करने के लिए कोशिकाओं को लाने घुमाएँ.
  8. (1.24) चरणों का पालन करें - (1.38) के लिए diploids sporulate और spores को अलग.
  9. दो 300 μl में sporulated कोशिकाओं के निलंबन विभाजितभागों और एक अलग 1.5 मिलीलीटर Eppendorf ट्यूब में प्रत्येक डाल दिया.
  10. 5 मिनट के लिए 800 XG ट्यूबों अपकेंद्रित्र. तैरनेवाला त्यागें.
  11. एक ट्यूब की गोली, अनुसूचित जाति उनका मध्यम के 100 μl जोड़ने के लिए एक haploids का चयन करें. अन्य ट्यूब की गोली, SC-Leu माध्यम के 100 μl जोड़ें α haploids का चयन करें.
  12. 30 ° रातोंरात सी ट्यूबों घुमाएँ. अंतिम ओवर ड्राफ्ट 600 0.5 से कम होना चाहिए. यदि 600 आयुध डिपो पर बहुत अधिक हो जाता है, कमरे के तापमान पर संवर्धन की कोशिश करो.
  13. GFP प्रेरित ताजा SC - उनकी (क) या अनुसूचित जाति लियू (α) 20 छ / मिलीलीटर डॉक्सीसाइक्लिन युक्त मध्यम के 100 μl जोड़ें डॉक्सीसाइक्लिन के अंतिम एकाग्रता 10 ग्राम / मिलीलीटर है. भंवर.
  14. 2 दिनों के लिए 30 डिग्री सेल्सियस पर ट्यूबों घुमाएँ.

3. फ्लो

  1. पूर्व फ़िल्टर ते बफर (7.5 पीएच) के 900 μl जोड़ें एक polypropylene 5 मिलीलीटर ट्यूब (बी # फाल्कन 352,063) टोपी के साथ 10 डॉक्सीसाइक्लिन / ग्राम मिलीलीटर युक्त एक साथ बदली सेलएक polystyrene 5 मिलीलीटर ट्यूब से झरनी टोपी (बी # फाल्कन +३५२२३५). Polypropylene ट्यूबों प्रवाह cytometry के लिए उपयुक्त हैं. झरनी टोपी बड़े कण को ​​दूर करने के लिए वांछित है.
  2. धीरे सेल झरनी टोपी पर डॉक्सीसाइक्लिन के साथ ते बफर के 75 μl जगह है.
  3. टोपी पर समाधान के लिए प्रेरित कोशिकाओं के 25 μl जोड़ें.
  4. जबकि जाल खिलाफ Pipetman की नोक दबाने, झरनी के माध्यम से संयुक्त समाधान के सभी गोली मार.
  5. नीचे प्रेस झरनी टोपी और ट्यूब भंवर.
  6. संग्रह ट्यूब (1.6 मिलीलीटर Eppendorf ट्यूब) तैयार अनुसूचित जाति उनका या अनुसूचित जाति लियू की 200 μl के साथ भरा.
  7. सेल सॉर्टर प्रारंभ और निर्माता पुस्तिका के अनुसार सेटिंग्स को समायोजित.
  8. भंवर दोनों संग्रह (मध्यम के साथ दीवार कोट) ट्यूब और उन्हें सेल सॉर्टर पर लोड करने से पहले कोशिकाओं से युक्त ट्यूब.
  9. नमूना के प्रवाह cytometry डेटा मोल. तनाव युक्त GFP नहीं एक नकारात्मक नियंत्रण हो सकता है.
  10. सॉर्टिंग के लिए द्वार ड्रा. (ए)सेल समुच्चय है, जो उच्च GFP तीव्रता एक्ज़िबिट सकता से बचने के लिए, disproportionately बड़े आगे (FSC) तितर बितर FSC ऊंचाई के एक भूखंड और FSC का उपयोग पल्स चौड़ाई नाड़ी और MoFlo सॉर्टर के लिए ऊंचाई या disproportionately छोटे FSC ऊंचाई के एक भूखंड का उपयोग करने के लिए पल्स चौड़ाई के साथ outliers त्यागें FACSAria सॉर्टर (5 चित्रा, शीर्ष बाएँ पैनल) के लिए क्षेत्र. (बी) के बाद से बड़े FSC (क्षेत्र) सेल समुच्चय के लिए उम्मीद है, केवल कम FSC में 20% में कोशिकाओं ले, जबकि सबसे कम FSC और (एसएससी) की ओर तितर बितर मूल्यों जहां सेल मलबे अक्सर पाया जाता है के साथ क्षेत्रों से परहेज (5 चित्रा, पैनल शीर्ष सही). (सी) (क्षेत्र) एसएससी और GFP संकेत (क्षेत्र) अक्सर सकारात्मक सहसंबद्ध होते हैं. क्योंकि बस ऊपर फाटकों दिया प्रतिभाशाली कोशिकाओं लेने भी एक उच्च एसएससी मूल्य के साथ कोशिकाओं के लिए समृद्ध, जनसंख्या की परिधि के साथ एक गेट GFP तीव्रता और एसएससी की एक साजिश का उपयोग करने के लिए हर बिंदु से प्रतिभाशाली कोशिकाओं के एक समान प्रतिशत ले आकर्षित एसएससी अक्ष (5 चित्रा, bottआरेख ओम बाएं). (सी) में चयनित आबादी जनसंख्या का 0.1-1% (बी) में चयनित होना चाहिए.
  11. संग्रह (3.10) मापदंड दिया ट्यूब में 200 कोशिकाओं तरह. एक सामूहिक प्रक्रिया के लिए या अन्य परियोजनाओं के लिए एक अधिक जटिल आबादी की आवश्यकता होती है, और अधिक कोशिकाओं तरह के रूप में की जरूरत है.
  12. भंवर संग्रह ट्यूब के माध्यम से हल की कोशिकाओं को कवर करने के लिए.
  13. प्लेट कोशिकाओं के एक सबसेट जीनोटाइपिंग के लिए एक YPDA प्लेट पर (उदाहरण के लिए, 50 कोशिकाओं).
  14. 2 दिनों के लिए 30 डिग्री सेल्सियस पर थाली सेते हैं.
  15. (1.8) - ~ कदम (1.5) के बाद 12 से अधिक कालोनियों के लिए एक lysate बनाओ.
  16. एक YPDA धीरे टिप के साथ प्लेट को छू G418 और नेट युक्त थाली पर एक जगह के लिए स्थानांतरण में इस्तेमाल किया टिप (1.5) पर अवशिष्ट कोशिकाओं. चयनित haploids इस प्लेट पर नहीं जाना चाहिए. Diploids अधिक GFP प्रतियां है और इसलिए उज्जवल हो सकता है. इस परीक्षण अगुणित चयन की क्षमता दिखा सकते हैं.
  17. जीनोटाइपिंग के लिए, lysate की 1 μl विश्लेषण एक 10 μl पीसीआर r का उपयोगएक आगे प्राइमर कि प्रत्येक नष्ट अनुक्रम CCTGAGAAAGCAACCTGACC की एक किताब के साथ बनती जीन की अपस्ट्रीम क्षेत्र flanking anneals साथ eaction.
    मल्टीप्लेक्स पीसीआर प्रतिक्रियाओं यदि संभव हो तो (शर्तों एकल म्यूटेंट के lysates का उपयोग निर्धारित किया जा सकता है). या 384 अच्छी तरह से प्रारूप - पीसीआर एक 96 में किया जा सकता है. बाद प्रारूप के रूप में छोटे रूप में 5 μl की प्रतिक्रिया की मात्रा के लिए उपयुक्त है. पीसीआर मास्टर की arraying प्राइमरों और सेल lysates इन घोला जा सकता है के अलावा बाहर किया जा सकता है एक मल्टी चैनल विंदुक या एक तरल से निपटने रोबोट का उपयोग में भिन्न घोला जा सकता है. टिप परिवर्तन वैकल्पिक हैं जब अलग पीसीआर घोला जा सकता है एक ही lysate जोड़ने.
  18. पीसीआर उत्पादों का विश्लेषण. जेल एक्स्ट्रा लार्ज अल्ट्रा V-2 वैद्युतकणसंचलन प्रणाली (Labnet) नमूना pipettes मल्टी चैनल का उपयोग लदान के साथ संगत है.
  19. से जानकारी (3.16) और (3.18) के आधार पर है, की संभावना haploids कि जीनोटाइप वांछित है की पहचान.
  20. इन उपभेदों एक ताजा प्लेट (YPDA, CAA Ura, या SC-Ura-His/Leu) पर स्थापित करना. इसके अलावा, उन्हें फ्रीज में-80 में 25% ग्लिसरॉल डिग्री सेल्सियस अतिरिक्त परीक्षण ऐसे हटाए गए जीन और स्पंदित क्षेत्र जेल वैद्युतकणसंचलन के लिए जंगली प्रकार के दृश्यों के अभाव की पुष्टि के रूप में सिफारिश की है.
  21. उपयोगी उपभेदों के साथ यौन साइकिल चालन (2.1) को दोहराएँ.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

जैसा कि हम ग्रीन दानव दृष्टिकोण विकसित की है, हम अलग GFP प्रतिस्थापन कैसेट के बीच पुनर्संयोजन की संभावना के साथ संबंध रहे थे, जिससे जीनोम पुनर्व्यवस्था. इस संभावना के खिलाफ Mitigating कोशिकाओं है कि सफलतापूर्वक संभोग और अर्धसूत्रीविभाजन के कई दौर से गुजरा है के लिए हमारे चयन है. Rearranged जीनोम असर कोशिकाओं कम एक समान पुनर्व्यवस्था बिना कोशिकाओं को संभोग के बाद फिट होने की उम्मीद कर रहे हैं. दरअसल, हम किसी भी जीनोम GFP 11 कैसेट के बीच पुनर्संयोजन से उत्पन्न अस्थिरता का पालन नहीं किया. हालांकि, हम पूरी तरह से इस संभावना नहीं बाहर करते हैं, कर सकते हैं तो यह सिफारिश की है कि उपयोगकर्ताओं पुनर्व्यवस्था के लिए उत्पन्न उपभेदों परीक्षण. स्पंदित क्षेत्र जेल वैद्युतकणसंचलन सकल असामान्यता का पता लगाने के लिए इस्तेमाल किया जा सकता है. दृश्यों को हटाए जाने के भीतर annealing प्राइमरों के साथ पीसीआर जंगली प्रकार के दृश्यों की अनुपस्थिति की पुष्टि करने के लिए इस्तेमाल किया जा सकता है.

स्थापित उपभेदों, GF प्रतिदीप्ति स्तर के आधार परपी तीव्रता पास रेखीय विलोपन की संख्या के साथ एक रिश्ता था, सुझाव है कि संतृप्ति एक 16 11 विलोपन के परीक्षण सीमा के भीतर एक समस्या नहीं है. हालांकि, कई गैर अतिव्यापी विलोपन के साथ तनाव के बाद के दौर में भी, हम केवल आबादी में हर दौर में मोटे तौर पर दो विलोपन की औसत संख्या को बढ़ाने के लिए सैद्धांतिक रूप से एक दो माता पिता में सभी विलोपन के संघ असर सेल जबकि करने में सक्षम थे उपभेदों एक बार में जोड़ा जा सकता है अगर GFP चयन के लिए एकदम सही तंगी प्राप्त किया गया. Isogenic कोशिकाओं के बीच एक सीमा सेल करने वाली सेल GFP तीव्रता की भिन्नता है. प्रतिनिधि परिणाम में दूसरे उदाहरण में, जनसंख्या में कोशिकाओं के केवल 0.8% के लिए सभी 11 विलोपन कि इस पार (11 में से चार विलोपन दोनों माता पिता haploids द्वारा साझा किया गया) में संभव थे उम्मीद होगी. हालांकि, अधिक प्रचुर मात्रा में दस विलोपन उपभेदों GFP तीव्रता का वितरण होगा कि overlaps है कि 11 विलोपन रणनीतिआईएनएस. इसलिए, आबादी का एक भी छोटे हिस्से preferentially 11-11-विलोपन उपभेदों की GFP तीव्रता वितरण के उच्च पूंछ से विलोपन उपभेदों का चयन करने के लिए चुना जाना चाहिए. एक समाधान के लिए केवल उच्च GFP तीव्रता के साथ दुर्लभ कोशिकाओं को सॉर्ट सीमा बढ़ाने के लिए हो सकता है. एक अन्य समाधान के लिए एक साथ एक आंतरिक मानक, एक अलग रंग की एक फ्लोरोसेंट प्रोटीन रिपोर्टर है कि एक भी कॉपी में मौजूद है, एक ही teto दो प्रमोटर के माध्यम से व्यक्त उपाय हो सकता है. इस रणनीति के बाह्य शोर रद्द करने के लिए इस प्रकार सामान्यीकृत GFP तीव्रता 16,17 माप की भिन्नता सेल करने वाली सेल कम की उम्मीद होगी.

दुर्लभ बहु म्यूटेंट प्राप्त करने की कठिनाई संभावित धीमी गति से इन उपभेदों के विकास दर के द्वारा exacerbated किया जा सकता है. मल्टी म्यूटेंट प्रवाह cytometry का उपयोग कर समृद्ध कर रहे हैं, लेकिन वे इस प्रक्रिया के बाकी के दौरान फिटर भाई बहन द्वारा outcompeted किया जा सकता है. पीढ़ियों की संख्या को कम करनेखमीर उपभेदों से गुजरना है, हम छोटे संस्कृति मात्रा में है कि वांछित ploidy की कोशिकाओं है कि हर कदम पर चयन कर रहे हैं की बस पर्याप्त प्रवर्धन प्रदान की सलाह देते हैं.

क्योंकि कई विलोपन प्रति चक्र प्राप्त किया जा सकता है, ग्रीन दानव विधि बहु म्यूटेंट अनुक्रमिक 11 तरीकों की तुलना में अधिक तेजी से इकट्ठा करने के लिए इस्तेमाल किया जा सकता है. यदि विलोपन के विशिष्ट सबसेट सिंथेटिक घातक रिश्ते हैं, 'मृत समाप्त होता है' अनुक्रमिक दृष्टिकोण के साथ सामना किया जा सकता है. यह सीमा ग्रीन दानव, दृष्टिकोण द्वारा circumvented किया जा सकता है जो विलोपन का पूरा सेट जमा की ओर संभावित रास्तों की अंतरिक्ष से नमूने. ग्रीन दानव प्रक्रिया के अधिक समानांतर सामूहिक संस्करण विलोपन की सबसे बड़ी संख्या संतोषजनक तक पहुँचने के लिए एक रास्ता खोजने के लिए उपयोगी साबित करना चाहिए.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

ब्याज की कोई संघर्ष की घोषणा की.

Acknowledgments

यह काम अमेरिकी रक्षा एडवांस्ड रिसर्च प्रोजेक्ट्स एजेंसी अनुबंध N66001-12-C-4039 के द्वारा FPRFPR वाईएस, अल्फ्रेड पी. स्लोअन फाउंडेशन से एक आरएसएल के लिए अनुदान, और अनुदान स्वास्थ्य के अमेरिकी राष्ट्रीय संस्थानों HG003224 R01 और R21 CA130266 समर्थित किया गया था यह भी उन्नत अनुसंधान के लिए कनाडा संस्थान से एक फैलोशिप और कनाडा उत्कृष्टता अनुसंधान अध्यक्षों कार्यक्रम द्वारा समर्थित है.

Materials

Name Company Catalog Number Comments
G418 Sigma-Aldrich A1720 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 200 mg/ml. Store at 4 °C.
ClonNAT (nourseothricin) WERNER BioAgents 5001000 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 100 mg/ml. Store at 4 °C.
Doxycycline Sigma-Aldrich D9891 Dissolve in 50% ethanol and filter-sterilize (0.2-μm filter). Stock concentration: 10 mg/ml. Make fresh every four weeks. Shield from light using aluminum foil and store at 4 °C.
Zymolyase ZymoResearch E1005
Difco yeast nitrogen base w/o amino acids BD 291940
Revolver (rotator for tubes) Labnet H5600
Enduro Gel XL electrophoresis unit Labnet E0160
Sonifier 450 Branson 101-063-198
Microtip for Sonifier 450 Branson 101-148-062
FACSAria cell sorter BD
MoFlo cell sorter Beckman-Coulter
Biomek FX or equivalent robot Beckman Coulter Optional. For setting up genotyping PCRs.

DOWNLOAD MATERIALS LIST

References

  1. Tong, A. H., et al. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science's STKE. 294, 2364-23 (2001).
  2. Hillenmeyer, M. E., et al. The chemical genomic portrait of yeast: uncovering a phenotype for all genes. Science. 320, 362-365 (2008).
  3. Beh, C. T., Cool, L., Phillips, J., Rine, J. Overlapping functions of the yeast oxysterol-binding protein homologues. Genetics. 157, 1117 (2001).
  4. Wieczorke, R., et al. Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae. FEBS letters. 464, 123-128 (1999).
  5. Alani, E., Cao, L., Kleckner, N. A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics. 116, 541-545 (1987).
  6. Akada, R., et al. PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae. Yeast. 23, 399-405 (2006).
  7. Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic acids research. 24, 2519 (1996).
  8. Delneri, D., et al. Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system. Gene. 252, 127-135 (2000).
  9. Storici, F., Lewis, L. K., Resnick, M. A. In vivo site-directed mutagenesis using oligonucleotides. Nat. Biotech. 19, 773-776 (2001).
  10. Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast. Nucl. Acids Res. 38, 2570-2576 (2010).
  11. Suzuki, Y., et al. Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection. Nat. Methods. 8, 159-164 (2011).
  12. Winzeler, E. A. Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis. Science. 285, 901-906 (1999).
  13. Woods, R. A., Gietz, R. D. High-efficiency transformation of plasmid DNA into yeast. Methods Mol. Biol. 177, 85-97 (2001).
  14. Hughes, T. R., et al. Widespread aneuploidy revealed by DNA microarray expression profiling. Nature. 25, 333-337 (2000).
  15. Goldstein, A. L., McCusker, J. H. Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast. 15, 1541-1553 (1999).
  16. Newman, J. R. S., et al. Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise. Nature. 441, 840-846 (2006).
  17. Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. Gene regulation at the single-cell level. Science. 307, 1962 (2005).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics