Зеленый монстр процесса генерации штаммов дрожжей проведение нескольких удалений Гена

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Зеленый монстр метод позволяет быструю сборку нескольких удалений отмечены кодирования гена-репортера зеленого флуоресцентного белка. Этот метод основан на вождение штаммов дрожжей через повторяющиеся циклы сексуальных ассортимент удалений и флуоресценции на основе обогащения клеток, несущих более удалений.

Cite this Article

Copy Citation | Download Citations

Suzuki, Y., Stam, J., Novotny, M., Yachie, N., Lasken, R. S., Roth, F. P. The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions. J. Vis. Exp. (70), e4072, doi:10.3791/4072 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Protocol

1. Генерация ProMonsters

  1. Подготовка универсальные кассеты замены GFP путем усиления Teto 2-GFP маркер и маркер URA3 из плазмиды pYOGM012 (ампициллину) с использованием праймеров с последовательностями:
    GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCC CAAGCTCCTCGAGTAATTCG и GGCGTTAGTATCGAATCGACAGCAGTATAGCGACCAGCATTCAC GTACCGGGTAATAACTGATATAAT (полужирным регионов обеспечить гомологии с фланговых районах KanMX4 кассеты позволяет целевых замены). ПЦР должна проводиться с Phusion полимеразы, HF буфера, и 3% диметилсульфоксида (New England Biolabs), начиная с концентрацией ДНК-матрицы 0,5 нг / мкл. Программа ПЦР 98 ° C в течение 30 сек и 35 циклов 98 ° C в течение 10 сек, 49 ° C в течение 30 сек и 72 ° С в течение 1,5 мин. Реакция объем должен быть> 50 мкл, чтобы обеспечить достаточно ДНК для каждого преобразования эксперимент. Мы очищаемпродукта с использованием QIAquick ПЦР очистки (Qiagen) с ~ 50 мкл ПЦР-реакции, обрабатываемых в колонке, но пропуская стадию очистки может увеличить выход трансформантов.
    Кроме того, отпустите фрагмент, содержащий Teto 2-GFP и URA3 маркеров, а также гомологичные регионы KanMX4 таргетинг, путем расщепления плазмиды pYOGM057 (ампициллину) с помощью ферментов рестрикции EcoRI (New England Biolabs). Концентрация ДНК в этой реакции должно быть ~ 30 нг / мкл. Реакция объем должен быть> 34 мкл.
    Для интеграции GFP кассету в регионе, кроме KanMX4, отрегулируйте гомологии области ПЦР-праймеров выше соответствующего гомологичных последовательностей.
  2. Transform-гаплоидные штамма из коллекции KanMX4 нокаутом дрожжи 12 с универсальной кассетой удаления GFP. В соответствии с протоколом лесами и Gietz 13 0,34 мклОбразец ДНК (очищенный продукт ПЦР или не очищенный ограничение дайджест) следует использовать для каждого преобразования эксперимент. Плита пятая часть преобразований смесь на CAA-Ура пластины (0,67% базы дрожжей азота, 2% глюкозы, 0,6% казаминовой кислоты, 0,0025% аденина гемисульфат, 0,005% триптофана, и 2% агар).
  3. Подряд из трансформантов на свежем CAA-Ура пластины для получения изолированных колоний.
  4. Передача клетки из колонии на тарелку YPDA, содержащий 200 мкг / мл G418, чтобы подтвердить отсутствие роста. Для подтверждения успешной интеграции GFP, выполните следующие действия (1,5) - (1,9) для выполнения ПЦР колоний.
  5. Добавить клеток, взятых из колонии в 2 мкл буфера для лизиса (0,1 М фосфата натрия, рН 7,4, 1 единица zymolyase от ZymoResearch) в 0,2-мл ПЦР трубу или колодец 96-луночный планшет. Смешать с помощью пипетки решение и выход из кончика пипетки.
  6. Наложение одной капле (около 20 мкл) минерального масла с использованием P200 Pipetman (Gilson).
  7. Выдержите эту смесь при температуре 37 °С в течение 20 мин, а затем при 95 ° С в течение 10 мин.
  8. Развести лизат с 50 мкл воды. Смешать с помощью пипетки решение и выход в десять раз.
  9. Анализ 1 мкл лизатов с помощью 10-мкл ПЦР-реакции с (A) прямой праймер, что отжига выше по течению флангового региона в сочетании с грунтовкой последовательности CCTGAGAAAGCAACCTGACC (285 б.п. с начала кассеты), (B) обратные праймер, который отжигается вниз по течению региона в паре с грунтовкой последовательности GCATTGGGTCAACAGTATAG (375 б.п. с конца), (C) двух праймеров, что отжиг в KanMX4 с последовательностями CGTACTCCTGATGATGCATG и GACGAAATACGCGATCGCTG (181 б.п.) и (D) двух праймеров, что отжига в последовательности дикого типа целевого гена (рис. 4). (D) является важным, поскольку около 8% штаммов в удалении коллекций как известно, содержат анеуплоидии 14. Правильное Трансформант должно быть положительным (А) и (Б), и отрицательным (C) и (D).
  10. Для введенияGMToolkit в Трансформант, добавить примерно 250000 клеток из трансформированного штамма и 250000 клеток либо RY0146 (содержащие GMToolkit-а) или RY0148 (содержащие GMToolkit-α) в 1,6-мл трубки Эппендорф. Vortex. Генотипов RY0146 и RY0148 являются MATα lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-[CMVpr-rtTA KanMX4 STE2pr-Sp-his5] и MATα lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-α [CMVpr-rtTA NatMX4 STE3pr- LEU2], соответственно. PR обозначает промотор. Сотовый номер должен быть оценен по оптической плотности предыдущей культуры.
  11. Центрифуга при 800 мкг в течение 2 мин.
  12. Удалить супернатант.
  13. Для обеспечения воздухообмена, сделать отверстие на крышке помощью канцелярской кнопки обрабатывают 70% этанолом.
  14. Добавить 50 мкл YPDA среде (1% дрожжевой экстракт, 2% пептон, 2% глюкозы и 0,003% аденина hemisulfatе). Vortex.
  15. Центрифуга при 800 мкг в течение 5 мин.
  16. Поместите пробирку в сыром поле. Это может быть создан с пустой коробки наконечник, небольшой стенд чаевые, и влажное бумажное полотенце.
  17. Инкубируйте поле в течение ночи при 30 ° C.
  18. Выберите повязана диплоиды первым полос из клетки на CAA-Ура пластины. Инкубировать при 30 ° C в течение одного дня.
  19. Принимая клетки от основной области, полоса них, чтобы сделать изолированных колоний на чашках YPDA (1% дрожжевой экстракт, 2% пептон, 2% глюкозы, 0,003% аденина гемисульфат, и 2% агар), содержащей 200 мкг / мл G418 для выбора диплоиды содержащие GMToolkit-или 100 мкг / мл nourseothricin (Nat) 15 для выбора диплоиды содержащие GMToolkit-α.
  20. Инкубировать при 30 ° С в течение 3 дней.
  21. Начиная с изолированной колонии, передать большинство клеток в 500 мкл среды GNA без агар (1% дрожжевого экстракта, 3% Difco питательный бульон и 5% глюкозы; автоклаве глюкозы и остальных тОн компоненты по отдельности, как 2 × решения, чтобы избежать карамелизации) в 5-мл пробирку с крышкой ослаблены.
  22. Поверните трубу горизонтально в течение пяти часов при 30 ° C. Ось вращения должна быть параллельной продольной оси трубки.
  23. Убедитесь, что используется в колонии (1,21) являются Ura + от полос их на CAA-Ура пластины.
  24. Центрифуги трубы при 800 мкг в течение 2 мин. Удалите супернатант.
  25. Добавить 500 мкл минимальной среды споруляции (1% ацетата калия, 0,005% ацетата цинка; фильтр-стерилизовать). Vortex.
  26. Центрифуги трубы при 800 мкг в течение 2 мин. Удалите супернатант.
  27. Повтор (1,25) - (1,26) раза.
  28. Добавить 1 мл минимальной среды споруляции дополнен с 7,5 мкг / мл лизина, 7,5 мкг / мл лейцин, 5 мкг / мл гистидина, 5 мкг / мл метионина и 1,25 мкг / мл урацил (для повышения споруляции скорость ауксотрофный штаммов) . Vortex.
  29. Поворот трубки при комнатной температуре в течение одного дня.
  30. Поворот трубы при 30 ° С в течение 2 дней.
  31. Центрифуга 125 мкл этой смеси в 1,6-мл трубки Эппендорф при 800 мкг в течение 2 мин. Удалите супернатант.
  32. Добавить 50 мкл zymolyase решения (100 мМ натрий-фосфатного буфера, рН 7,4, 1 М сорбит, и 2 единицы zymolyase от ZymoResearch). Смешать с помощью пипетки решение и выход из кончика пипетки.
  33. Инкубировать при 30 ° С в течение 1 часа.
  34. Добавить 50 мкл 0,02% NP-40. Смешать с помощью пипетки решение и выход из кончика пипетки.
  35. Оставьте трубки при комнатной температуре в течение пяти минут.
  36. Добавить 500 мкл воды.
  37. Поместите пробирку на льду.
  38. Разрушать ультразвуком эту смесь два раза на выходе установки 1 (слабая установка) в течение 15 сек помощью 3,2-мм микронаконечником с Sonifier 450 (Branson). Между двумя турами ультразвуком, положил трубку на льду, чтобы вернуться температуры до ~ 0 ° C.
  39. Центрифуги трубы при 800 мкг в течение 5 мин. Удалите супернатант.
  40. Добавить 200 мкл SC-Ура-Его(А) или SC-Ура-лей (α) среды, в зависимости от того креста по включению GMToolkit-или GMToolkit-α. Для приготовления средства массовой информации, делают SC-Ура-His-Leu среднего (0,67% базы дрожжей азота, 2% глюкозы, 0,01% аргинина, 0,01% аспарагиновой кислоты, 0,01% глутаминовая кислота, изолейцин 0,01%, 0,01% лизина, 0,01% метионина , 0,01% фенилаланина, 0,08% серин, треонин 0,04%, 0,002% тирозин, валин 0,03%, 0,0025% аденина, триптофан 0,005%, 0,003% аденина, и 0,005% триптофана) и дополнить его стерильным гистидина или лейцин перед использованием, чтобы конечной концентрации 0,01%.
  41. Сделайте отверстие на крышке помощью канцелярской кнопки обрабатывают 70% этанолом.
  42. Поверните трубу горизонтально при 30 ° С в течение 2 дней. Ось вращения должна быть параллельной продольной оси трубки.
  43. Подряд из клетки на SC-Ура-Его SC-Ура-Leu агар пластины (те же ингредиенты, что и выше, плюс 2% агара, треонин и аспарагиновой кислоты должен быть добавлен послеutoclaving, добавить гистидина или лейцин перед заливкой), чтобы сделать изолированных колоний для штаммов ProMonster.

2. Сексуальные Велоспорт

  1. Поворот культуры создан штамм GFP удалении в 100 мкл SC-His (а) или SC-лей (α) в зависимости от типа спаривания при температуре 30 ° С в течение ночи помощью 1,6-мл Eppendorf трубки. Для обмена воздуха, сделать отверстие с помощью канцелярской кнопки обрабатывают 70% этанолом. Поверните трубу горизонтально. Ось вращения должна быть параллельной продольной оси трубки. Это можно пересечь несколько штаммов через спаривания в массовом порядке. Когда отсортированный образец непосредственно используемых для этой цели, культуре клеток в 200 мкл при 30 ° С в течение 2 дней. Для приготовления среды, добавить урацил (конечная концентрация: 0,0025%) и гистидина (0,01%) или лейцин (0,01%) к SC-Ура-His-Leu среды.
  2. Смешать 250000-гаплоидных клеток и 250000 α-гаплоидных клеток штаммов GFP удаление в 1,6-мл Eppendorf трубку. Vortex.
  3. Совместите эти клетки, выполнив следующие действия (1,11) - (1,17).
  4. Передача 10 мкл спаривания смеси до 500 мкл среды GNA, содержащий 200 мкг / мл G418 и 100 мкг / мл Nat в 5-мл пробирку с ослабил крышку. Начиная OD 600 составляет примерно 0,1.
  5. Поверните культуры при 30 ° С в течение 24 часов. Это дает возможность выбора диплоиды, потому что только диплоиды, содержащие как KanMX4 в GMToolkit-и NatMX4 в GMToolkit-α может расти в присутствии G418 и Нат (рис. 3).
  6. Передача 20 мкл однодневный культуры до 500 мкл свежей GNA содержащей G418 и Nat. Начиная OD 600 составляет примерно 0,2.
  7. Поворот трубы на 30 ° C в течение 5 часов, чтобы принести клеток в логарифмической фазе (OD 600 из ~ 1).
  8. Следуйте инструкциям (1,24) - (1,38) в спорулируют диплоиды и изолировать споры.
  9. Сплит приостановлении спорулированных клетки на две 300-мклчасти и положить каждую в отдельный 1,5-мл трубки Эппендорф.
  10. Центрифуги трубы при 800 мкг в течение 5 мин. Удалите супернатант.
  11. Для гранул из одной трубки, добавляют 100 мкл SC-Его среда для выбора-гаплоидов. Для гранул из другой трубы, добавить 100 мкл SC-лей средних для выбора α-гаплоидов.
  12. Поворот трубы при 30 ° С в течение ночи. Окончательный OD 600 должна быть не менее 0,5. Если OD 600 имеет тенденцию быть слишком высокой, попробуйте культивирования при комнатной температуре.
  13. Для стимулирования GFP, добавьте 100 мкл свежей SC-His (а) или SC-лей (α) среде, содержащей 20 мкг / мл доксициклина. Конечная концентрация доксициклина составляет 10 мкг / мл. Vortex.
  14. Поворот трубы при 30 ° С в течение 2 дней.

3. Проточной цитометрии

  1. Добавить 900 мкл предварительно отфильтрованные TE буфером (рН 7,5), содержащем 10 мкг / мл доксициклина в 5-мл полипропиленовые трубы (BD Falcon # 352063) с крышкой местами с клеточнойФильтр колпачок с 5-мл полистирола трубки (BD Falcon # 352235). Полипропиленовые трубы предназначены для проточной цитометрии. Крышка фильтра требуется для удаления крупных частиц.
  2. Аккуратно поместите 75 мкл ТЕ-буфера с доксициклином на сотовом фильтр крышки.
  3. Добавить 25 мкл индуцированных клеток в растворе на крышке.
  4. Нажимая на кончике Pipetman против сеткой, снимать все комбинированного раствора через фильтр.
  5. Надавите на крышку фильтра и вихревой трубки.
  6. Подготовить коллекцию трубок (1,6 мл Eppendorf труб), заполненная 200 мкл SC-Его SC-лей.
  7. Начало клетки сортировщика и настройки параметров в зависимости от производителя руководства.
  8. Vortex как коллекция трубку (чтобы покрыть стены со средой) и пробирку, содержащую клетки, прежде чем загружать их на клетку сортировщика.
  9. Приобретать проточной цитометрии данных образца. Штамм не содержащих GFP может быть отрицательным контролем.
  10. Ничья ворота для сортировки. (A)Чтобы избежать клеточные агрегаты, которые могут обладать высокой интенсивности GFP, отказаться от выбросов с непропорционально большой ширины импульса для рассеяния вперед (FSC), используя участок шириной импульса и высота для MoFlo сортировщика или непропорционально малый FSC высоту с помощью сюжета высота FSC и FSC области для FACSAria сортировщик (рис. 5, верхней левой панели). (B) С большим FSC (область), как ожидается, для клеточных агрегатов, только взять клеток в нижние 20% в ФСБ, избегая регионов с самым низким FSC и боковые рассеяния (SSC) значения, где остатки клеток часто встречается (рис. 5, верхней правой панели). (C) SSC (области) и GFP сигнала (область), часто положительно коррелируют. Потому что просто взять самые яркие клетки данного ворот выше, также обогащают для клеток с высоким значением SSC, нарисуйте ворота по периферии населения, использующего участок GFP интенсивности и SSC взять такой же процент из самых ярких клеток из каждой точки ГНЦ оси (рис. 5, бутОМ-левая диаграмма). Население выбран в (С) должно быть 0,1-1% населения, выбранный в (B).
  11. Сортировка 200 клеток в пробирку с учетом критериев (3,10). Для процесса в массовом порядке или для других проектов, требующих более сложной населения, сортировку больше клеток по мере необходимости.
  12. Vortex пробирки для покрытия отсортированных клеток со средой.
  13. Плита подмножество клеток (например, 50 ячеек) на тарелку YPDA для генотипирования.
  14. Инкубировать при 30 ° С в течение 2 дней.
  15. Сделать лизат для ~ 12 колоний следующие шаги (1,5) - (1,8).
  16. Передача остаточных клеток на кончике используется в (1,5) в пятно на тарелке YPDA содержащей G418 и Nat, осторожно касаясь пластины с наконечником. Выбранный гаплоидов не должны расти на этой пластинке. Диплоиды может иметь несколько копий GFP и поэтому может быть ярче. Этот тест может показать эффективность гаплоидных выбор.
  17. Для генотипирования, анализировать 1 мкл лизатов с помощью 10-мкл ПЦР-Reaction с прямым праймером, что отжига выше по течению фланкирующей области каждом удален ген в паре с грунтовкой последовательности CCTGAGAAAGCAACCTGACC.
    Мультиплекс ПЦР-реакции, если возможно (условия могут быть определены с использованием лизатов одиночных мутантов). ПЦР может быть сделано в 96 - или 384-луночных формате. Последний формат подходит для реакции объемом всего 5 мкл. Выстроив из ПЦР смесей, отличающихся грунтовки и добавление клеточных лизатов этих смесей может быть осуществлена ​​с использованием многоканальной пипетки или жидкого робота обработки. Совет изменения не являются обязательными при добавлении же лизат различных смесей ПЦР.
  18. Анализ продуктов ПЦР. Гель XL Ultra V-2 электрофорез системы (Labnet) совместим с загрузки образца использовании многоканальных пипеток.
  19. На основании информации из (3,16) и (3,18), определить вероятность гаплоидов, что желали генотипов.
  20. Создание этих штаммов на свежей пластинки (YPDA, CAA-УПА, или SC-Ura-His/Leu). Кроме того, заморозить их в25% глицерина при температуре -80 ° C. Дополнительные тесты, такие как подтверждение отсутствия дикого типа последовательностей генов для удаленных и импульсных поле гель-электрофореза рекомендуется.
  21. Повторите сексуальной езда на велосипеде из (2,1) полезных штаммов.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Когда-гаплоидные штамма с четырьмя GFP-заметным делеции (ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) были скрещены с α-гаплоидные штамма с четырьмя делеции (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ), с двумя делеции (ycl033cΔ yer042wΔ) на территории двух штаммов, представитель результат был получен. Спаривания смесь культивировали в среде, содержащей YPDA G418 и Нат, чтобы выбрать диплоидов. В результате диплоиды культивировали в споруляции среды. Споры были разогнаны zymolyase лечения и ультразвуком, а проросшие в гаплоидных СМИ выбор. Затем клетки индуцируют экспрессию GFP. Использование ворота с проточной цитометрии, популяция клеток была выбрана, которые вряд ли содержат мусор или клеточных агрегатов (рис. 5). В рамках этого населения, самая яркая 1% клеток были отсортированы. Упорядочить клетки и клетки были несортированные геновведено после того, как они образуются колонии на тарелку. Когда случайно выбранных колоний прожилками на тарелке YPDA содержащей G418 и Nat, клетки 2 из 16 колоний вырос на несортированные образца, и клетки с 18 из 26 колоний вырос на отсортированы образца, предполагая, что некоторые диплоиды получили возможность чтобы выразить гаплоидный-маркера селекции и распространяется в гаплоидных отбора и GFP-индукционной фазы в этом эксперименте. Диплоиды был обогащен в отсортированном образца предположительно, из-за большего количества GFP копирует в них содержится. Когда гаплоидов были проанализированы с ПЦР, среднее количество удалений в отсортированных клеток была 5,1 ± 0,4 (n = 8; SEM показано). Четыре из этих клеток было шесть удалений, максимально возможное количество удалений для этого креста. Гаплоидов несортированные образец был 3,4 ± 0,2 удалений в среднем (n = 14).

В отдельном эксперименте,-гаплоидные штамма с семью GFP-заметным делеции (выr042wΔ yer108cΔ yfr057wΔ ykl069wΔ ykr011cΔ ylr123cΔ yol118cΔ) были скрещены с α-гаплоидные штамма с восемью делеции (ycl033cΔ ydl227cΔ ydl242wΔ yer042wΔ yer108cΔ yfr057wΔ ygl109wΔ ykr011cΔ), с четырьмя общими делеции (yer042wΔ yer108cΔ yfr057wΔ ykr011cΔ), содержащиеся в двух штаммов. Когда диплоиды были выбраны, а затем культивировали в споруляции среду, около 20% клеток спорулированных на основе микроскопических наблюдений (N> 100). После того, как споры были рассеяны и проращивают, в результате гаплоидов были вынуждены экспресс-GFP и сортируются на основе флуоресценции, как указано выше. Только один из 61 случайно выбранных клетки росли на тарелку YPDA содержащей G418 и Nat, предполагая, что упорядоченные клетки преимущественно гаплоидных. При анализе методом ПЦР (рис. 6), отсортированных клеток было среднее число удалении 8,8 ±0,3 (п = 12; SEM показано), в том числе пять клетки, содержащие десять удалений. Ожидаемое количество удалений за несортированный клетки в результате случайной сегрегации составила 7,5.

Рисунок 1
Рисунок 1. Зеленые монстры под микроскопом. Флуоресцентной микроскопии показывают, не мутантный штамм (слева), штамм ProMonster (в центре) и 16-GFP монстра деформации (справа). Идентичные экспозиции, яркости и контрастности были использованы для изображения.

Рисунок 2
Рисунок 2. Схема зеленых процесс Monster. Single-мутант гаплоидов (светло-зеленая) соединяются. Мейотические рекомбинации во время спороношение повязана диплоиды генерирует смеси 0-GFP клеток (грязно-белого), 1-GFP клеток (светло-зеленый), и 2-GFP клеток (темно-зеленый). Потокцитометрии используется для выбора самых зеленых клеток обогащенный для 2-GFP клеток. Комплексная молекулярные инструменты позволяют выбор-гаплоидов (His +), α-гаплоидов (Leu +), и диплоидные (G418 и Nat-сопротивления). Этот цикл повторяется для обогащения штаммов подшипников все большее число изменений.

Рисунок 3
Рисунок 3. GFP удаления кассеты и GMToolkits. Кассетах GFP удаления содержат ген GFP репортер и маркер дрожжей преобразования (URA3). Teto 2 промоутера индуцируется путем добавления доксициклина в среде под действием фактора транскрипции rtTA. Если уровень GFP достигает максимальной способности клеток, чтобы белок или терпеть любые токсический эффект от него, выражение может быть набран вниз за счет снижения концентрации доксициклина (обратите внимание, что мы сделали не наблюдаем такого насыщения или токсическое воздействие даже при 16 копий GFP). Эта кассета может быть направлена ​​на любого гена или региона путем присоединения конкретных гомологичных последовательностей с помощью ПЦР. Кроме того, универсальная кассета для удаления GFP с одинаковыми гомологичных последовательностей может быть легко направлена ​​на KanMX4 «посадочные площадки» в штаммах дрожжей коллекции нокаутом. YFG обозначает вашу любимую ген. Коробка с вертикальными линиями обозначена ДНК штрих-кодов. GMToolkits интегрированы в CAN1 локуса. Ste2-his5 маркер и STE3-LEU2 маркер выражаются типа спаривания определенным образом в гаплоидов, чтобы позволить только-гаплоидов расти в отсутствие гистидина и только α-гаплоидов расти в отсутствие лейцин, соответственно. Выбор на устойчивость к G418 и Nat одновременно выбирает для KanMX4 локуса в одной GMToolkit и NatMX4 локуса в другой и таким образом выбирает для диплоидов.

_content "FO: Keep-together.within-страница =" Всегда "> Рисунок 4
Рисунок 4. Подтверждение правильной интеграции кассеты GFP. Универсальные кассеты GFP может быть использована для преобразования любого KanMX4 обозначенных удаления имеющихся в коллекции удаление дрожжей GFP-заметное исключение. При правильно генерируются аллеля удаление GFP, ПЦР-реакции с прямым праймером, что отжига выше по течению флангового региона в паре с обратным праймером, что отжигов на начало кассеты (ПЦР стадии 1,9) следует создать группу. ПЦР с обратным праймером, что отжигов вниз по течению флангового региона в паре с прямым праймером, что отжигов до конца кассеты (ПЦР B) должно сделать продукт. ПЦР с двумя праймерами, что отжиг в KanMX4 кассеты (ПЦР C) или с двумя праймерами, что отжиг в последовательности дикого типа целевого гена (ПЦР D) не должно приводить к группе. Красная стрелка обозначает ПЦР-праймер. Брачкет показывает регионе усиливается с ПЦР-реакции. Box указывает на кассете GFP (зеленый), KanMX4 кассеты (желтый), или ваш любимый гена (YFG, серый). Черная линия указывает фланкирующей последовательности в дрожжевой хромосомы.

Рисунок 5
Рисунок 5. Проточной цитометрии. В этом эксперименте гаплоидных потомство от скрещивания двух штаммов, один с генотипом ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ, а другой с генотипом ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ были индуцируют экспрессию GFP. Каждый ген удаление было GFP кассеты. По стробирования клеток на основе передового района разброс и вперед высота разброс (P1), клеточные агрегаты (которые, как правило, имеют непропорционально большую площадь рассеяния вперед, были исключены. Путем стробирования клеток на основе рассеяния вперед и боковой разброс (P2), CEООО в нижних 20% рассеяния вперед было принято в то время как без учета мусора с самой низкой рассеяния вперед и боковой разброс. По стробирования клеток на основе разброса стороне и GFP сигнала (P3), тем больше флуоресцентных клеток, среди тех, кто в данный диапазон разброса стороны были приняты. Для того чтобы сравнение мейотического смеси и отрицательный контрольный образец, который не выражают GFP, ворота идентична той, которая используется для выбора P3 населения показана на схеме аналогично выбраны клетки отрицательного контроля.

Рисунок 6
Рисунок 6. Генотипирование отсортированы штаммов. ПЦР проводили с использованием обратного праймера, что отжигов вниз по течению флангового региона в паре с прямым праймером, что отжигов до конца кассеты. Наличие группы указывает на наличие кассеты GFP. Отдельный эксперимент показал, что все двенадцать против штаммовTain удаления yer042w Δ и удаление ykr011c Δ.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Как мы разработали подход Зеленый Монстр, мы были обеспокоены возможностью рекомбинации между различными кассетами замены GFP, что приводит к перестройке генома. Смягчение против этой возможности нашего выбора для клеток, которые успешно прошли несколько раундов спаривания и мейоза. Клетки, несущие переставить геномов как ожидается, будут менее приспособленных после спаривания в клетках, не идентичны перестройки. Действительно, мы не наблюдали нестабильность генома в результате рекомбинации между кассетами GFP 11. Тем не менее, мы не можем полностью исключить эту возможность, поэтому пользователям рекомендуется проверить созданный штаммов для перегруппировки. Импульсное поле гель-электрофореза может быть использован для определения валовых аномалии. ПЦР с праймерами отжига последовательностей в удалении может быть использован для подтверждения отсутствия дикого типа последовательностей.

На основе флуоресценции уровнях созданы штаммы, GFP интенсивность была почти линейной зависимостью с числом удалений, предполагая, что насыщение не является проблемой в рамках испытания диапазоне от одного до 16 удалений 11. Тем не менее, даже в поздних раундах со штаммами со многими неперекрывающихся удалений, мы смогли только увеличить среднее количество удалений в популяции примерно по два в каждом раунде, в то время как теоретически ячейки подшипников объединение всех удалений в двух родительских штаммы могут быть объединены сразу, если идеальный строгости отбора GFP были достигнуты. Одним из ограничений является клетка-клетка изменение интенсивности GFP среди изогенных клеток. Во втором примере в Представитель Результаты, лишь 0,8% клеток в популяции можно было бы ожидать, чтобы все 11 удалений, которые были возможны в этой крест (четыре из 11 удалений были общими для обеих родительских гаплоидов). Тем не менее, более обильные десять удаления штаммов будет иметь распределение интенсивности GFP, который перекрывается, что из 11-удаления стратегическидюймов Таким образом, даже меньшая часть населения должна быть выбрана предпочтительно выбрать 11-удаления штаммов из высших хвост распределения GFP интенсивности 11-удаления штаммов. Одним из решений может быть просто поднять порог для сортировки реже клеток с более высокой интенсивностью GFP. Другим решением может быть одновременно измерять внутренний стандарт, флуоресцентный белок репортера другого цвета, которые присутствуют в единственном экземпляре, выраженные через тот же Teto два промоутера. Эта стратегия, как ожидается, сократятся внешние шумы уменьшить клетки к клетке изменения таким образом нормированные GFP измерения интенсивности 16,17.

Трудность получения редких мульти-мутанты могут быть усилены потенциально медленные темпы роста этих штаммов. Multi-мутанты обогащены с помощью проточной цитометрии, но они могут вытеснить в течение остальной части процесса, слесарь братьев и сестер. Чтобы свести к минимуму число поколенийштаммов дрожжей пройти, мы рекомендуем небольших объемах культуры, которые обеспечивают только что достаточное усиление клетки нужного плоидности, которые выбираются на каждом шагу.

Потому что несколько удалений могут быть приобретены за цикл, зеленый монстр метод может быть использован для сборки нескольких мутантов быстрее, чем последовательные методы 11. Если конкретные подмножества удалений у синтетических смертельным отношения, "мертвые концы» можно столкнуться с последовательным подходов. Это ограничение можно обойти, зеленый монстр подход, который образцах из пространства возможных путей к накоплению полного набора удалений. Чем больше параллельных массово версия Зеленый Монстр процесс должен оказаться полезным в поиске пути для достижения крупнейших допустимого количества удалений.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Нет конфликта интересов объявлены.

Acknowledgments

Эта работа была поддержана США Defense Advanced Research Projects Agency контракту N66001-12-C-4039, чтобы Ю.С., грант от Alfred P. Sloan Foundation в РГБ и американского Национального института здравоохранения грантов R01 и R21 HG003224 CA130266 в FPRFPR было Также поддерживается общение от Канадского института передовых исследований и исследований Канады программы мастерства председателей.

Materials

Name Company Catalog Number Comments
G418 Sigma-Aldrich A1720 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 200 mg/ml. Store at 4 °C.
ClonNAT (nourseothricin) WERNER BioAgents 5001000 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 100 mg/ml. Store at 4 °C.
Doxycycline Sigma-Aldrich D9891 Dissolve in 50% ethanol and filter-sterilize (0.2-μm filter). Stock concentration: 10 mg/ml. Make fresh every four weeks. Shield from light using aluminum foil and store at 4 °C.
Zymolyase ZymoResearch E1005
Difco yeast nitrogen base w/o amino acids BD 291940
Revolver (rotator for tubes) Labnet H5600
Enduro Gel XL electrophoresis unit Labnet E0160
Sonifier 450 Branson 101-063-198
Microtip for Sonifier 450 Branson 101-148-062
FACSAria cell sorter BD
MoFlo cell sorter Beckman-Coulter
Biomek FX or equivalent robot Beckman Coulter Optional. For setting up genotyping PCRs.

DOWNLOAD MATERIALS LIST

References

  1. Tong, A. H., et al. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science's STKE. 294, 2364-23 (2001).
  2. Hillenmeyer, M. E., et al. The chemical genomic portrait of yeast: uncovering a phenotype for all genes. Science. 320, 362-365 (2008).
  3. Beh, C. T., Cool, L., Phillips, J., Rine, J. Overlapping functions of the yeast oxysterol-binding protein homologues. Genetics. 157, 1117 (2001).
  4. Wieczorke, R., et al. Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae. FEBS letters. 464, 123-128 (1999).
  5. Alani, E., Cao, L., Kleckner, N. A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics. 116, 541-545 (1987).
  6. Akada, R., et al. PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae. Yeast. 23, 399-405 (2006).
  7. Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic acids research. 24, 2519 (1996).
  8. Delneri, D., et al. Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system. Gene. 252, 127-135 (2000).
  9. Storici, F., Lewis, L. K., Resnick, M. A. In vivo site-directed mutagenesis using oligonucleotides. Nat. Biotech. 19, 773-776 (2001).
  10. Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast. Nucl. Acids Res. 38, 2570-2576 (2010).
  11. Suzuki, Y., et al. Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection. Nat. Methods. 8, 159-164 (2011).
  12. Winzeler, E. A. Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis. Science. 285, 901-906 (1999).
  13. Woods, R. A., Gietz, R. D. High-efficiency transformation of plasmid DNA into yeast. Methods Mol. Biol. 177, 85-97 (2001).
  14. Hughes, T. R., et al. Widespread aneuploidy revealed by DNA microarray expression profiling. Nature. 25, 333-337 (2000).
  15. Goldstein, A. L., McCusker, J. H. Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast. 15, 1541-1553 (1999).
  16. Newman, J. R. S., et al. Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise. Nature. 441, 840-846 (2006).
  17. Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. Gene regulation at the single-cell level. Science. 307, 1962 (2005).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics