תהליך המפלצת הירוקה לדור של זני שמרי נשיאת מחיקות Gene מרובות

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

שיטת המפלצת הירוקה מאפשרת הרכבה המהירה של מחיקות מרובות מסומנות בחלבון כתב גן קידוד ירוק זרחני. שיטה זו מבוססת על נהיגת זני שמרים במחזורים חוזרים ונשנים של מגוון מיני של מחיקות והעשרה פלואורסצנטי המבוסס של תאים שנשאו יותר מחיקות.

Cite this Article

Copy Citation | Download Citations

Suzuki, Y., Stam, J., Novotny, M., Yachie, N., Lasken, R. S., Roth, F. P. The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions. J. Vis. Exp. (70), e4072, doi:10.3791/4072 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

פנוטיפים למחיקת גן לעתים קרובות מתגלים רק כאשר המוטציה נבדקת ברקע גנטי מסוים או 1,2 תנאי הסביבה. ישנן דוגמאות שבו גנים רבים זקוקות למחיקה לחשוף פונקציות גנים נסתרות 3,4. למרות הפוטנציאל לתגליות חשובות, אינטראקציות הקשורים בשלושה או יותר גנים נחקרו במידה רבה. חיפושים הממצים של אינטראקציות מרובות מוטציה יהיו מעשיים בשל המספר העצום של צירופים אפשריים של מחיקות. עם זאת, מחקרים של קבוצות נבחרות של גנים, כגון ערכות של paralogs עם יותר סיכוי מראש של שיתוף פעולה משותפת, יהיו אינפורמטיבי.

בcerevisiae Saccharomyces השמרים, נוקאאוט הגן מושג על ידי החלפת גנים עם סמן בחירה באמצעות רקומבינציה הומולוגית. מכיוון שמספר הסמנים הוא מוגבל, פותחו שיטות להסרה ושימוש חוזר בסם סמן הדואר 5,6,7,8,9,10. עם זאת, ברצף מוטציות רבות הנדסיות באמצעות שיטות אלה הן זמן רב משום שהזמן דרוש ליניארית קשקשים עם מספר המחיקות להיות שנוצר.

כאן אנו מתארים שיטת המפלצת הירוקה להנדסת מחיקות מרובות באופן שגרתי בשמרי 11. בשיטה זו, כתב חלבון פלואורסצנטי ירוק (GFP) שולב מחיקות משמש לכמותית זני תווית בהתאם למספר של מחיקות כלולות בכל מאמץ (איור 1). סיבובים חוזרים ונשנים של מבחר של GFP-מסומנים מחיקות באמצעות הזדווגות שמרים ומיוזה יחד עם העשרת הזרימה cytometric של זנים נושאים יותר של המחיקות הללו מובילות להצטברות של מחיקות בזנים (איור 2). ביצוע מספר רבים של תהליכים במקבילים, כאשר כל תהליך שילוב מחיקות אחד או יותר בכל סבב, מפחית את הזמן הנדרש לבניית מתח.

תוכן "> הצעד הראשון הוא יכין מוטציות בודדות ההפלואידים כינו 'ProMonsters," כל אחד מהם נושא את כתב ה-GFP במוקד נמחק ואחד' ארגז הכלים 'הלוקוסים-או GMToolkit-המפלצת הירוקה או GMToolkit-α ב . Can1Δ לוקוס (איור 3) שימוש בזנים מאוסף מחיקת שמרי 12, מחיקות GFP-מסומנות יכול להיות שנוצר בנוחות על ידי החלפת KanMX4 הקלטת המשותפת קיימת בזנים אלה עם GFP אוניברסלי - URA3 בר כל GMToolkit מכיל:. או - או α-הזדווגות סוג ספציפי סמן הפלואידים בחירה 1 ובדיוק אחד משני הסמנים ש, כאשר שני GMToolkits נמצא, באופן קולקטיבי מאפשרים בחירה של diploids.

הצעד השני הוא לבצע רכיבה המינית שדרכו ניתן לשלב לוקוסי מחיקה בתוך תא בודד על ידי מבחר האקראי ו / או recomb meioticination המלווה כל מחזור של הזדווגות ונביגה.

Protocol

1. דור של ProMonsters

  1. הכן את קלטת החלפת GFP האוניברסלית על ידי הגברת TETO סמן 2-GFP וסמן URA3 מpYOGM012 פלסמיד (התנגדות אמפיצילין) תוך שימוש בפריימרים עם רצפים:
    GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCC CAAGCTCCTCGAGTAATTCG וGGCGTTAGTATCGAATCGACAGCAGTATAGCGACCAGCATTCAC GTACCGGGTAATAACTGATATAAT (אזורים מודגשים לספק הומולוגיה לאזורי האיגוף של קלטת KanMX4 מאפשרת החלפה ממוקדת). תגובת PCR צריכה להתבצע עם פולימראז Phusion, מאגר HF, וsulfoxide דימתיל 3% (ניו אינגלנד Biolabs) החל בריכוז ה-DNA התבנית של 0.5 ng / μl. תכנית ה-PCR היא 98 מעלות צלזיוס למשך 30 שניות ו35 מחזורים של 98 מעלות צלזיוס למשך 10 שניות, 49 מעלות צלזיוס למשך 30 שניות, ו72 מעלות צלזיוס במשך 1.5 דקות. נפח התגובה צריך להיות> 50 μl לספק מספיק DNA לכל ניסוי טרנספורמציה. אנחנו מטוהריםהמוצר באמצעות PCR QIAquick טיהור ערכה (Qiagen) עם ~ 50 μl של תגובת PCR מעובד לטור, אבל מדלג על שלב הטיהור עשוי להגדיל את התשואה של transformants.
    לחלופין, לשחרר את בר המכיל TETO 2-GFP וURA3 סמנים, כמו גם הומולוגי אזורים עבור KanMX4 מיקוד, על ידי לעכל pYOGM057 פלסמיד (התנגדות אמפיצילין) באמצעות אנזים הגבלת EcoRI (ניו אינגלנד Biolabs). ריכוז ה-DNA בתגובה זו צריך להיות ~ 30 ng / μl. נפח התגובה צריך להיות> 34 μl.
    לשילוב קלטת GFP לאזור אחר מאשר KanMX4, להתאים את אזור ההומולוגיה של primers PCR לעיל כדי הומולוגי הרצפים המתאימים.
  2. להפוך מתח-הפלואידים מאוסף נוקאאוט שמרי KanMX4 12 עם קלטת מחיקת GFP האוניברסלית. בעקבות הפרוטוקול של 13 0.34 μl ודס וGietz שלדגימת DNA (PCR מוצר מטוהרים או הגבלה שאינן מטוהרת תקציר) אמורה לשמש עבור כל ניסוי טרנספורמציה. צלחת חמישית מתערובת הטרנספורמציה על גבי צלחת CAA-אורה (0.67% בסיס שמרי חנקן, 2% גלוקוז, 0.6% casamino חומצה, hemisulfate אדנין 0.0025%, 0.005% טריפטופן, ואגר 2%).
  3. Streak את transformants על צלחת טריה CAA-אורה לקבל מושבות מבודדות.
  4. העברת תאים ממושבה לצלחת YPDA המכילה 200 מיקרוגרם / המ"ל G418 כדי לאשר את חוסר הצמיחה. כדי לאשר אינטגרצית GFP מוצלחת, בצע את השלבים (1.5) - (1.9) לבצע מושבה PCR.
  5. הוסף תאים שנלקחו ממושבה לתוך 2 μl של חיץ תמוגה (0.1 פוספט M נתרן, 7.4 pH, zymolyase 1 יחידה מZymoResearch) בצינור 0.2-מיליליטר PCR או גם מצלחת 96 היטב. מערבבים ידי pipetting הפתרון ולצאת מקצה פיפטה.
  6. שכבה עם טיפה אחת (בערך 20 μl) של שמן מינרלים באמצעות P200 Pipetman (Gilson).
  7. דגירה את התערובת על 37 מעלותצלזיוס במשך 20 דקות ולאחר מכן ב 95 מעלות צלזיוס למשך 10 דקות.
  8. לדלל במי lysate μl 50. מערבב על ידי pipetting הפתרון ולצאת עשר פעמים.
  9. נתח μl 1 מתוך lysate באמצעות PCR תגובות 10-μl עם () פריימר קדימה שanneals לאזור איגוף זרם זיווג עם פריימר של CCTGAGAAAGCAACCTGACC הרצף (285 נ"ב מתחילת הקלטת), (ב) הפוכה פריימר שanneals לאזור מורד זיווג עם פריימר של GCATTGGGTCAACAGTATAG הרצף (375 נ"ב מהסוף), (ג) שני פריימרים שanneal לKanMX4 עם רצפי CGTACTCCTGATGATGCATG וGACGAAATACGCGATCGCTG (181 נ"ב), וכן (ד) שני פריימרים ש לחשל את הרצף פרוע הסוג של הגן הממוקד (איור 4). (ד) הוא חשוב, כי על 8% מהזנים באוספי המחיקה ידועים מכילים aneuploidy 14. Transformant נכון צריכה להיות חיובי עם () ו (ב), ושלילי ב( ג) (ד).
  10. כדי להציג אתGMToolkit לtransformant, להוסיף כ 250.000 תאים מהלחץ והפך 250.000 תאים של שתי RY0146 (המכיל GMToolkit-) או RY0148 (המכיל GMToolkit-α) לתוך צינור אפנדורף 1.6 מ"ל. מערבולת. את גנוטיפים של RY0146 וRY0148 הם MATα lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-[CMVpr-rtTA KanMX4 STE2pr-SP-his5] וMATα lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-α [CMVpr-rtTA NatMX4 STE3pr- LEU2], בהתאמה. יחסי הציבור מציינים אמרגן. מספר תא צריך להיות מוערך מצפיפות אופטית של התרבות הקודמת.
  11. צנטריפוגה XG ב 800 במשך 2 דקות.
  12. הסר את supernatant.
  13. כדי לאפשר לאוויר חליפין, לעשות חור במכסה באמצעות נעץ מטופלים עם אתנול 70%.
  14. הוסף 50 μl של YPDA בינוני (1% תמצית שמרים, peptone 2%, גלוקוז 2%, וhemisulfat אדנין 0.003%ה). מערבולת.
  15. צנטריפוגה XG ב 800 למשך 5 דקות.
  16. הנח את הצינור בתיבה לחה. זה יכול להיות שנוצר עם תיבה ריקה קצה, עמדת טיפ קטנה, ומגבת נייר רטובה.
  17. דגירת הלילה בתיבת 30 ° C.
  18. בחר diploids הזדווגו ידי פסים יוצאים ראשון את התאים על צלחת CAA-אורה. דגירה את הצלחת ב 30 מעלות צלזיוס במשך יום אחד.
  19. נטילת תאים מהאזור, פס תפזורתם לעשות מושבות מבודדות על צלחות YPDA (1% תמצית שמרים, peptone 2%, גלוקוז 2%, 0.003% hemisulfate אדנין, ואגר 2%) המכילות 200 מיקרוגרם / המ"ל G418 לבחירת diploids המכיל GMToolkit-או 100 מיקרוגרם / המ"ל nourseothricin (נת) 15 לבחירת diploids המכיל GMToolkit-α.
  20. דגירה את הצלחת ב 30 מעלות צלזיוס במשך 3 ימים.
  21. החל ממושבה מבודדת, להעביר את רוב התאים עד 500 μl של מדיום GNA בלי אגר (1% תמצית שמרים, 3% מרק תזונתי Difco, ו5% גלוקוז; גלוקוז חיטוי ושאר tהוא רכיבים בנפרד כ2 פתרוני × להימנע שזוף) בצינור תרבות 5-מ"ל עם המכסה רופף.
  22. סובב את הצינור אופקי לחמש שעות ליום 30 ° C. ציר הסיבוב צריך להיות מקביל לציר האורך של הצינור.
  23. לאשר כי בשימוש במושבות (1.21) הם אורה + על ידי פסים אותם על צלחת CAA-אורה.
  24. צנטריפוגה הצינור ב 800 XG עבור 2 דקות. השלך את supernatant.
  25. הוסף 500 μl של מדיום נביגה מינימאלי (1% יצטטו אשלגן, אבץ יצטט 0.005%; מסנן-לעקר). מערבולת.
  26. צנטריפוגה הצינור ב 800 XG עבור 2 דקות. השלך את supernatant.
  27. חזור על (1.25) - (1.26) פעמים.
  28. הוסף 1 מ"ל של מדיום נביגה המינימאלי בתוספת 7.5 מיקרוגרם / המ"ל ליזין, 7.5 מיקרוגרם / המ"ל אוצין, היסטידין 5 מיקרוגרם / מ"ל, 5 מיקרוגרם / מיליליטר מתיונין, ואורציל 1.25 מיקרוגרם / מ"ל ​​(על מנת לשפר את שיעור נביגה מזני auxotrophic) . מערבולת.
  29. סובב את השפופרת בטמפרטורת חדר למשך יום אחד.
  30. סובב את הצינור ב 30 מעלות צלזיוס למשך 2 ימים.
  31. צנטריפוגה 125 μl של תערובת זו בצינור אפנדורף 1.6 מ"ל ב 800 XG עבור 2 דקות. השלך את supernatant.
  32. הוסף 50 μl של פתרון zymolyase (מאגר 100 מ"מ נתרן פוספט, 7.4 pH, M 1 סורביטול וzymolyase 2 יחידות מZymoResearch). מערבבים ידי pipetting הפתרון ולצאת מקצה פיפטה.
  33. לדגור על 30 מעלות צלזיוס במשך שעה 1.
  34. הוסף 50 μl של 0.02% NP-40. מערבבים ידי pipetting הפתרון ולצאת מקצה פיפטה.
  35. השאר את הצינור בטמפרטורת חדר במשך חמש דקות.
  36. הוסף 500 μl של מים.
  37. הנח את הצינור על קרח.
  38. Sonicate תערובת זו פעמים בהגדרת הפלט של 1 (הגדרה החלשה ביותר) עבור 15 שניות באמצעות microtip 3.2 מ"מ עם Sonifier 450 (רנסון). בין שני סיבובים של sonication, לשים צינור על קרח כדי להחזיר את הטמפרטורה ל ~ 0 ° C.
  39. צנטריפוגה את הצינורות ב 800 XG למשך 5 דקות. השלך את supernatant.
  40. הוסף 200 μl של SC-אורה-(א) או SC-האורה-Leu בינוני (α), תלוי אם הצלב הוא עבור שילוב GMToolkit-או GMToolkit-α. כדי להכין את התקשורת, להפוך SC-האורה--Leu בינוני (0.67% בסיס שמרי חנקן, גלוקוז 2%, ארגינין 0.01%, 0.01% חומצה אספרטית, 0.01% חומצה גלוטמית, isoleucine 0.01%, 0.01% ליזין, מתיונין 0.01% , 0.01% פנילאלנין, סרין 0.08%, 0.04% תראונין, טירוזין 0.002%, 0.03% ואלין, אדנין 0.0025%, טריפטופן 0.005%, אדנין 0.003%, 0.005% וטריפטופן) ומשלים את זה בהיסטידין או אוצין סטרילי לפני שימוש כדי ריכוז סופי של 0.01%.
  41. לעשות חור במכסה באמצעות נעץ מטופלים עם אתנול 70%.
  42. סובב את הצינור אופקי ב 30 מעלות צלזיוס למשך 2 ימים. ציר הסיבוב צריך להיות מקביל לציר האורך של הצינור.
  43. Streak את התאים על צלחת אגר SC-אורה-או SC-האורה-Leu (אותם המרכיבים כאמורים לעיל בתוספת 2% אגרו; חומצה אספרטית תראונין ויש להוסיף לאחרutoclaving; להוסיף היסטידין או אוצין לפני המזיגה) כדי להפוך את מושבות שבודדו לזני ProMonster.

2. רכיבה על אופניים מינית

  1. סובב תרבות של זן מחיקת GFP הוקם בשנת 100 μl של SC-(א) או SC-Leu (α) בהתאם לסוג ההזדווגות של 30 ° C בין הלילה באמצעות צינור אפנדורף 1.6 מ"ל. לאוויר חליפין, לעשות חור באמצעות נעץ מטופלים עם אתנול 70%. סובב את הצינור בצורה אופקית. ציר הסיבוב צריך להיות מקביל לציר האורך של הצינור. אפשר לחצות זנים רבים דרך המוני הזדווגות. כאשר מדגם מסודר משמש באופן ישיר למטרה זו, תרבות התאים ב200 μl ב 30 מעלות צלזיוס למשך 2 ימים. כדי להכין הבינוני, מוסיף אורציל (ריכוז סופי: 0.0025%) והיסטידין (0.01%) או לאוצין (0.01%) עד בינוני SC-האורה--Leu.
  2. מערבב 250.000 תאים-ההפלואידים ו250.000 תאי α-ההפלואידים של זני מחיקת GFP ב1.6 מ"ל Eppeצינור ndorf. מערבולת.
  3. Mate תאים אלו על ידי הצעדים באים (1.11) - (1.17).
  4. העברת 10 μl של תערובת ההזדווגות עד בינוני GNA μl 500 המכיל 200 מיקרוגרם / המ"ל G418 ו 100 מיקרוגרם / מ"ל ​​יאט בצינור התרבות 5-מ"ל עם מכסה רופף. OD מתחיל 600 הוא בערך 0.1.
  5. סובב התרבות ב 30 מעלות צלזיוס למשך 24 שעות. זה מאפשר לבחירת diploids בגלל diploids בלבד המכיל את שני KanMX4 בGMToolkit-וNatMX4 בGMToolkit-α יכול לגדול בנוכחות G418 ונט (איור 3).
  6. להעביר 20 μl מהתרבות של היום אחד ועד 500 μl של GNA טרי המכיל G418 ונט. OD מתחיל 600 הוא בערך 0.2.
  7. סובב את הצינור ב 30 מעלות צלזיוס למשך 5 שעות להביא תאים לשלב היומן (OD 600 של ~ 1).
  8. בצע את השלבים (1.24) - (1.38) לsporulate את diploids ולבודד נבגים.
  9. פיצול ההשעיה של תאי sporulated לשתיים 300-μlחלקים ולמקם כל צינור נפרד של 1.5 מיליליטר אפנדורף.
  10. צנטריפוגה את הצינורות ב 800 XG למשך 5 דקות. השלך את supernatant.
  11. לגלולה של צינור אחד, להוסיף 100 μl של מדיום SC-לבחירה בhaploids. לגלולה של צינור האחר, להוסיף 100 μl של מדיום SC-Leu לבחור α-haploids.
  12. סובב את הצינורות של 30 ° C למשך הלילה. OD הסופי צריך להיות 600 פחות מ -0.5. אם OD 600 נוטה להיות גבוה מדי, נסה culturing בטמפרטורת חדר.
  13. כדי לגרום GFP, להוסיף 100 μl טרי SC-(א) או SC-Leu בינוני (α) המכיל 20 מיקרוגרם / המ"ל דוקסיציקלין. הריכוז הסופי של דוקסיציקלין הוא 10 מיקרוגרם / מ"ל. מערבולת.
  14. סובב את הצינורות ב 30 מעלות צלזיוס למשך 2 ימים.

3. זרימת cytometry

  1. הוסף 900 ​​μl של TE חיץ מראש מסונן (pH 7.5) המכיל דוקסיציקלין 10 מיקרוגרם / מ"ל ​​לצינור פוליפרופילן 5-מ"ל (BD פלקון # 352063) עם הכובע החליף עם תאיםכובע מסננת מצינור קלקר 5-מ"ל (BD פלקון # 352235). צינורות פוליפרופילן מתאימים לcytometry זרימה. כובע המסננת הוא רצוי להסרת חלקיקים גדולים.
  2. מניח בעדינות 75 μl של TE חיץ עם דוקסיציקלין על מכסה תא המסננת.
  3. הוסף 25 μl של התאים המושרים לפתרון בכובע.
  4. תוך כדי לחיצה על קצה Pipetman נגד הרשת, לצלם את כל הפתרון המשולב באמצעות המסננת.
  5. לחץ כלפי מטה את כובע המסננת ומערבולת הצינור.
  6. הכן צינורות איסוף (צינורות 1.6 מ"ל Eppendorf) מלאים ב200 μl של SC-או SC-Leu.
  7. התחל סדרן התא ולהתאים את ההגדרות בהתאם להוראות היצרן.
  8. מערבולת הוא צינור האיסוף (למעייל הקיר הבינוני) וצינור המכיל תאים לפני טעינתם על סדרן התא.
  9. להשיג נתוני cytometry זרימה של המדגם. מתח לא מכיל GFP יכול להיות שליטה שלילית.
  10. צייר שערים למיון. ()כדי להימנע ממצבורי תאים, שידעו להפגין עצמת GFP גבוהה, לבטל חריגים עם רוחב דופק פרופורציונלי לפיזור קדימה (FSC) באמצעות עלילה של רוחב וגובה דופק דופק לMoFlo סדרן או גובה FSC פרופורציונלי קטן באמצעות עלילה של גובה FSC וFSC האזור לFACSAria סדרן (איור 5, פנל שמאלי העליון). (ב) מאז FSC הגדול (אזור) צפוי לאגרגט הסלולרי, לקחת רק תאים ב20% הנמוכים יותר בFSC, תוך הימנעות מאזורים עם פיזור FSC וצד הנמוך ביותר (SSC) הערכים שבו פסולת תא לעתים קרובות נמצא (איור 5, פנל ימני העליון). (ג) SSC (אזור) ואות ה-GFP (אזור) לעתים קרובות בקורלציה חיובית. כי פשוט לוקח את התאים הבהירים הניתנים לשערים הנ"ל יהיה גם להעשיר לתאים בעלי ערך גבוה SSC, לצייר שער לאורך הפריפריה של האוכלוסייה באמצעות עלילה של עוצמת GFP וSSC לקחת אחוז דומה של התאים הבהירים מכל נקודה של SSC הציר (איור 5, בוטאום שמאלי תרשים). האוכלוסייה שנבחרה ב( ג) צריכה להיות 0.1-1% מהאוכלוסייה שנבחרה ב( B).
  11. מיון 200 תאים לתוך צינור האיסוף בהתחשב בקריטריונים ב( 3.10). להמוני תהליך או לפרויקטים אחרים הדורשים אוכלוסייה מורכבת יותר, למיין תאים נוספים במידת צורך.
  12. מערבולת צינור האיסוף לכיסוי תאים הממוינים עם מדיום.
  13. צלחת קבוצת משנה של תאים (לדוגמה, 50 תאים) על צלחת YPDA לgenotyping.
  14. דגירה את הצלחת ב 30 מעלות צלזיוס למשך 2 ימים.
  15. הפוך לlysate ~ 12 מושבות ביצוע השלבים (1.5) - (1.8).
  16. להעביר את התאים שיורית בקצה המשמש ב( 1.5) למקום על צלחת המכילה YPDA G418 ונט ידי נגיעה בצלחת עם הקצה בעדינות. haploids הנבחר לא צריך לגדול על הצלחת הזאת. Diploids יכול להיות יותר עותקי GFP ולכן עשוי להיות בהירים יותר. בדיקה זו יכולה להראות את היעילות של בחירה הפלואידים.
  17. לgenotyping, לנתח μl 1 מתוך lysate באמצעות PCR r 10-μleaction עם פריימר קדימה שanneals לאזור האיגוף במעלה הזרם של כל גן נמחק יחד עם פריימר של CCTGAGAAAGCAACCTGACC הרצף.
    תגובות PCR Multiplex אם אפשר (תנאים ניתן לקבוע באמצעות lysates של מוטציות בודדות). PCR יכול להיעשות ב96 - או 384 פורמט היטב. הפורמט השני הוא מתאים לעוצמת התגובה של קטן כמו 5 μl. Arraying של ה-PCR אדון תערובות שונות בפריימרים ותוספת של lysates הסלולרי לתערובות אלו יכולות להתבצע באמצעות ריבוי ערוצי פיפטה או רובוט לטיפול בנוזל. שינויי עצה הם אופציונליים בעת הוספתו לתערובות lysate PCR שונות.
  18. נתח מוצרי PCR. ג'ל אולטרה XL מערכת V-2 אלקטרופורזה (Labnet) תואמת עם טעינת מדגם באמצעות pipettes רב ערוצית.
  19. בהתבסס על מידע מ( 3.16) ו( 3.18), לזהות haploids הסביר שרצויים גנוטיפים.
  20. להקים זנים אלה על צלחת טריה (YPDA, CAA-אורה, או SC-Ura-His/Leu). כמו כן, להקפיא אותם בגליצרול 25% ב-80 ° C. בדיקות נוספות כגון אישור על העדר רצפי סוג פראי לגנים שנמחקו ואלקטרופורזה ג'ל פעם שדה מומלצות.
  21. חזור על אופניים מיניים מ( 2.1) עם זנים שימושיים.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

כאשר מתח-הפלואידים נושאים ארבע מחיקות מסומנות-GFP (ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) נחצה עם מתח α-הפלואידים נושאים ארבע מחיקות (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ), עם שתי מחיקות (ycl033cΔ yer042wΔ) משותף לשני זנים, נציג תוצאה הושגה. תערובת ההזדווגות הייתה בתרבית במדיום המכיל YPDA G418 ונט כדי לבחור diploids. את diploids התוצאה הייתה בתרבית במדיום נביגה. הנבגים פוזרו על ידי הטיפול וsonication zymolyase, וניבטו בתקשורת בחירת ההפלואידים. התאים אז הם שדלו להביע GFP. שימוש בשערים עם cytometer זרימה, אוכלוסייה של תאים שנבחרה היא צפוי להכיל אגרגטים פסולת או תא (איור 5). בתוך אוכלוסייה זו, 1% המבריקים של תאים ממוינים. תאים ממוינים ותאים לא ממוינים היו genoהקליד אחרי שהם יצרו מושבות על צלחת. כאשר מושבות שנבחרו באקראי היו מפוספסות על צלחת המכילה YPDA G418 ונט, תאים מ2 מתוך 16 מושבות גדלו למדגם לא הממוין, ותאים מ18 מתוך 26 מושבות צמחו למדגם מסודר, מה שמרמז כי כמה diploids צבר את היכולת להביע את סמן הפלואידים-בחירה ומופץ בהפלואידים הבחירה וGFP-אינדוקצית השלבים בניסוי הזה. Diploids היו מועשר יותר במדגם מסודר כנראה בשל המספר הגדול יותר של ה-GFP מעתיק הם הכילו. כאשר haploids נותחו עם PCR, המספר הממוצע של מחיקות בתאים הממוינים היה 5.1 ± 0.4 (n = 8; SEM מוצג). ארבעת תאים אלה היו שש מחיקות, המספר מקסימאלי האפשרי של מחיקות לצלב הזה. Haploids של המדגם לא הממוין היו 3.4 ± 0.2 מחיקות בממוצע (n = 14).

בניסוי נפרד, מתח-הפלואידים נושאה שבע מחיקות GFP-מסומנות (אתםr042wΔ yer108cΔ yfr057wΔ ykl069wΔ ykr011cΔ ylr123cΔ yol118cΔ) נחצה עם מתח α-הפלואידים ביצוע מחיקות 8 (ycl033cΔ ydl227cΔ ydl242wΔ yer042wΔ yer108cΔ yfr057wΔ ygl109wΔ ykr011cΔ), עם ארבע מחיקות נפוצות (yer042wΔ yer108cΔ yfr057wΔ ykr011cΔ) שנכלל בשני זנים. כאשר diploids נבחרו ולאחר מכן בתרבית במדיום נביגה, בערך 20% מהתאים sporulated מבוססים על תצפית מיקרוסקופית (n> 100). לאחר שהנבגים התפזרו ומונבטים, את haploids וכתוצאה מכך נגרם למביע GFP וממוין לפי פלואורסצנטי כאמור לעיל. רק אחד מתוך 61 תאים שנבחרו באקראי גדל על צלחת המכילה YPDA G418 ונט, טוען כי תאים ממוינים היו הפלואידים בעיקר. כשנתח עם PCR (איור 6), התאים הממוינים היה מספר מחיקת הממוצע של 8.8 ±0.3 (n = 12; SEM מוצג), כולל חמישה תאים המכילים 10 מחיקות. המספר הצפוי של מחיקות לתא ממוין כתוצאה מהפרדה אקראית היה 7.5.

איור 1
איור 1. מפלצות ירוקות מתחת למיקרוסקופ פלואורסצנטי. Micrographs להראות מתח שאינו מוטציה (משמאל), מתח ProMonster (באמצע), ומתח מפלצת 16-GFP (מימין). חשיפה זהה, בהירות וניגודיות הגדרות שמשו לתמונות.

איור 2
איור 2. הסכימה של תהליך המפלצת הירוק. Haploids יחיד מוטציה (אור הירוק) הם מזדווגים. רקומבינציה meiotic במהלך נביגה של diploids הזדווגו יוצרת תערובת של תאים 0-GFP (בלבן), תאי 1-GFP (אור הירוק), ותאי 2-GFP (ירוק כהה). זרימהcytometry משמש כדי לבחור את התאים הירוקים מועשרים לתאים 2-GFP. כלים מולקולריים משולבים ייאפשרו הבחירה של A-haploids (+), α-haploids (LEU +), וdiploids (G418-ונט להתנגדות). מחזור זה חוזר על עצמו להעשרה לזנים הנושאים את מספר גדל והולך של שינויים.

איור 3
איור 3. קלטות GFP מחיקה וGMToolkits. קלטות מחיקת GFP מכילים גן כתב GFP וסמן הפיכת שמרים (URA3). 2 אמרגן TETO הוא מושרה על ידי התוספת של דוקסיציקלין במדיום שדרך פעולתו של גורם שעתוק rtTA. אם רמת GFP מגיעה קיבולת המרבית של תאים כדי להפוך את החלבון או לסבול כל השפעה רעילה ממנו, הביטוי יכול להיות שחויג למטה על ידי הורדת ריכוז דוקסיציקלין (שים לב, עם זאת, שעשינו לא להתבונן רוויה כזה או השפעות רעילות אפילו עם 16 עותקים של GFP). קלטת זו יכולה להיות ממוקדת לכל גן או באזור על ידי הצמדה הומולוגית רצפים ספציפיים באמצעות PCR. לחלופין, קלטת מחיקת GFP האוניברסלית עם רצפים הומולוגיים זהים יכולה להיות ממוקדת בנוחות ל'רפידות הנחיתה של KanMX4 בזנים של אוסף נוקאאוט שמרים. YFG מציין הגן האהוב עליך. תיבה עם קווים אנכיים מציינת ברקוד ה-DNA. GMToolkits משולב לוקוס CAN1. סמן STE2-his5 וסמן STE3-LEU2 באים לידי הביטוי באופן הזדווגות סוג מסוים בhaploids לאפשר רק-haploids לגדול בהעדר היסטידין וhaploids α-רק לגדול בהעדר אוצין, בהתאמה. בחירה להתנגדות לG418 ונט בוחרת בו זמנית לKanMX4 הלוקוס בGMToolkit אחד וNatMX4 הלוקוס באחר ובכך בוחר לdiploids.

_content "fo: לשמור-together.within עמודים =" תמיד "> איור 4
איור 4. מאשר את השילוב הנכון של קלטת ה-GFP. קלטת GFP אוניברסלית ניתן להשתמש כדי להמיר כל מחיקה זמינה באוסף מחיקת שמרי KanMX4 מסומנת למחיקת GFP מסומנת. עם אלל מחיקת GFP נוצר כראוי, תגובת PCR עם פריימר קדימה שanneals לאזור איגוף זרם זיווג עם פריימר הפוך שanneals לתחילת הקלטת (PCR של שלב 1.9) צריך לעשות את להקה. PCR עם פריימר הפוך שanneals לאזור איגוף מורד זיווג עם פריימר קדימה שanneals לסוף הקלטת (PCR B) צריך לעשות את מוצר. PCR עם שני פריימרים שanneal בתוך KanMX4 הקלטת (PCR C) או עם שני פריימרים שanneal לרצף פרוע הסוג של הגן הממוקד (PCR ד) לא צריך לייצר להקה. החץ אדום מציין פריימר PCR. בראקket מראה אזור מוגבר בתגובת PCR. תיבה מציינת את קלטת ה-GFP (ירוק), KanMX4 קלטת (צהוב), או הגן האהוב עליך (YFG, אפור). קו שחור מציין רצף איגוף בכרומוזום שמרים.

איור 5
איור 5. cytometry זרימה. בניסוי זה צאצאים, הפלואידים מצלב של שני זנים, אחד עם גנוטיפ ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ והשני עם גנוטיפ ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ היו מושרה להביע GFP. כל מחיקת גן הייתה קלטת ה-GFP. על ידי תאי gating על בסיס אזור קדימה פיזור וגובה פיזור קדימה (P1), אגרגטים תא (שנוטים להיות פרופורציונלי שטח פיזור גדול קדימה הוצאו ממחקר. ידי תאי gating על בסיס פיזור קדימה ופיזור צד (P2), ceLLS ב20% הנמוכים יותר בפיזור קדימה היה מתקבל אילו בניכוי פסולת עם הפיזור קדימה הנמוך ביותר ולפזר צד. על ידי תאי gating על בסיס פיזור צד ואות ה-GFP (P3), תאי ניאון יותר בקרב אלו בטווח פיזור צד ניתן בו צולמו. כדי לאפשר השוואה של תמהיל meiotic ומדגם השליטה השלילי שאינו מפורש GFP, שער זהה לזה המשמש לבחירת אוכלוסיית P3 מוצג בתרשים לתאים שנבחרו באופן דומה של השליטה השלילית.

איור 6
איור 6. Genotyping הזנים הממוינים. PCR בוצע באמצעות פריימר הפוך שanneals לאזור איגוף מורד זיווג עם פריימר קדימה שanneals לסיום הקלטת. הנוכחות של להקה מעידה על קיומו של את קלטת ה-GFP. ניסוי נפרד הראה כי כל קון 12 הזניםTain מחיקת yer042w Δ ומחיקת Δ ykr011c.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

כפי שפתחנו את גישת המפלצת הירוקה, שהעסקנו אותנו לאפשרות של רקומבינציה בין קלטות החלפת GFP שונות, שהוביל לארגון מחדש הגנום. מקלים נגד האפשרות הזאת הוא הבחירה שלנו לתאים שעברו סבבים רבים של הזדווגות ומיוזה בהצלחה. תאים הנושאים הגנום סודר מחדש צפויים להיות בכושר ירוד לאחר הזדווגות לתאים בלי סידור מחדש זהה. ואכן, אנו לא צופים כל חוסר יציבות הגנום כתוצאה מרקומבינציה בין קלטות GFP 11. עם זאת, אנחנו לא יכולים לשלול לחלוטין את האפשרות הזאת, ולכן מומלץ שמשתמשת לבדוק את הזנים שנוצרו להתארגנות מחודשת. ג'ל אלקטרופורזה פעם שדה יכולה לשמש כדי לזהות חריגות גולמיות. PCR עם פריימרים חישול לרצפים בתוך את המחיקה ניתן להשתמש כדי לאשר את ההיעדרות של רצפי סוג פראי.

בהתבסס על רמות הקרינה של זנים, שהוקמו GFעוצמת P היה יחסים קרובים ליניארי עם מספר המחיקות, טוענת כי רוויה היא לא בעיה בטווח של השנה עד נבדק 16 מחיקות 11. עם זאת, גם בסבבים מאוחרים יותר עם זנים עם מחיקות רבות שאינם חופפות, הצליח רק כדי להגדיל את המספר הממוצע של מחיקות באוכלוסייה בכ 2 בכל סיבוב, ואילו תיאורטית תא הנושא את האיחוד של כל המחיקות בשני ההורים זנים יכולים להיות משולבים מייד אם חומרה מושלמת לבחירת GFP הושגו. מגבלה אחת היא וריאצית תא לתא בעצמת GFP בין תאי isogenic. בדוגמא השנייה בנציג תוצאות, רק 0.8% מתאים באוכלוסייה יהיו צפויים לי כל 11 המחיקות שהיו אפשריים בצלב הזה (4 מתוך 11 מחיקות היו משותפים לשני הורי haploids). עם זאת, הזנים השופעים יותר עשר המחיקה יהיו התפלגות עצמת GFP שדומה לזה של 11-מחיקת Straתוספות. לכן, חלק קטן עוד יותר של האוכלוסייה יש לבחור מעדיף לבחור זנים 11-מחיקה מהזנב הגבוה יותר של חלוקת עוצמת GFP של זנים 11-מחיקה. פתרון אחד יכול להיות פשוט להעלות את הסף כדי למיין תאים נדירים בעצמת GFP גבוהה יותר. פתרון נוסף יכול להיות בו זמנית למדידה סטנדרטית פנימי, כתב חלבון פלואורסצנטי בצבע שונה שנמצא בעותק יחיד, הביע דרך אותו אמרגן TETO 2. אסטרטגיה זו תהיה צפויה לביטול רעשים חיצוניים כדי להפחית וריאצית תא לתא של מדידות אינטנסיביות GFP כך מנורמלות-16,17.

הקושי בהשגה רבה מוטציות נדירות יכול להחריף את קצב הצמיחה פוטנציאלית האיטי של זנים אלה. Multi-מוטנטים מועשרים באמצעות cytometry זרימה, אך הוא עשויים להיות outcompeted הם במנוחה של התהליך על ידי אחי פיטר. כדי למזער את מספר הדוריםזני שמרים עוברים, אנו ממליצים כרכי התרבות קטנים המספקים הגברה מספיק רק-תאים של ploidy הרצוי שנבחרו בכל שלב.

מכיוון שניתן לרכוש מחיקות מרובות בכל מחזור, שיטת המפלצת הירוקה יכולה לשמש כדי להרכיב-מוטציות רבות במהירות רבה יותר מאשר שיטות רציפות 11. אם תת ספציפי של מחיקות יש יחסים קטלניים סינטטיים, "מבוי סתום" עשוי להיות נתקל עם גישות רציפות. מגבלה זו ניתן לעקוף את גישת המפלצת הירוקה, שדגימות מהחלל של נתיבים אפשריים כלפי צבירת סט המלא של מחיקות. המוני הגרסה המקבילה יותר של תהליך המפלצת הירוקה צריכה להיות שימושית במציאת נתיב להגיע למספר הגדול ביותר של מחיקות הנסבל.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

אין ניגודי האינטרסים הכריזו.

Acknowledgments

עבודה זו נתמכה על ידי חוזה ההגנה האמריקנית המחקר המתקדם פרויקטי סוכנות N66001-12-C-4039 לי"ש, מענק של פ אלפרד סלואן הקרן לRSL, והמוסד אמריקאי הלאומי לבריאות מענקי R01 HG003224 וR21 CA130266 לFPRFPR היה גם נתמך על ידי מלגה מהמכון הקנדי למחקר מתקדם ועל ידי תכנית מחקר כיסאות אקסלנס קנדה.

Materials

Name Company Catalog Number Comments
G418 Sigma-Aldrich A1720 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 200 mg/ml. Store at 4 °C.
ClonNAT (nourseothricin) WERNER BioAgents 5001000 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 100 mg/ml. Store at 4 °C.
Doxycycline Sigma-Aldrich D9891 Dissolve in 50% ethanol and filter-sterilize (0.2-μm filter). Stock concentration: 10 mg/ml. Make fresh every four weeks. Shield from light using aluminum foil and store at 4 °C.
Zymolyase ZymoResearch E1005
Difco yeast nitrogen base w/o amino acids BD 291940
Revolver (rotator for tubes) Labnet H5600
Enduro Gel XL electrophoresis unit Labnet E0160
Sonifier 450 Branson 101-063-198
Microtip for Sonifier 450 Branson 101-148-062
FACSAria cell sorter BD
MoFlo cell sorter Beckman-Coulter
Biomek FX or equivalent robot Beckman Coulter Optional. For setting up genotyping PCRs.

DOWNLOAD MATERIALS LIST

References

  1. Tong, A. H., et al. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science's STKE. 294, 2364-23 (2001).
  2. Hillenmeyer, M. E., et al. The chemical genomic portrait of yeast: uncovering a phenotype for all genes. Science. 320, 362-365 (2008).
  3. Beh, C. T., Cool, L., Phillips, J., Rine, J. Overlapping functions of the yeast oxysterol-binding protein homologues. Genetics. 157, 1117 (2001).
  4. Wieczorke, R., et al. Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae. FEBS letters. 464, 123-128 (1999).
  5. Alani, E., Cao, L., Kleckner, N. A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics. 116, 541-545 (1987).
  6. Akada, R., et al. PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae. Yeast. 23, 399-405 (2006).
  7. Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic acids research. 24, 2519 (1996).
  8. Delneri, D., et al. Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system. Gene. 252, 127-135 (2000).
  9. Storici, F., Lewis, L. K., Resnick, M. A. In vivo site-directed mutagenesis using oligonucleotides. Nat. Biotech. 19, 773-776 (2001).
  10. Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast. Nucl. Acids Res. 38, 2570-2576 (2010).
  11. Suzuki, Y., et al. Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection. Nat. Methods. 8, 159-164 (2011).
  12. Winzeler, E. A. Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis. Science. 285, 901-906 (1999).
  13. Woods, R. A., Gietz, R. D. High-efficiency transformation of plasmid DNA into yeast. Methods Mol. Biol. 177, 85-97 (2001).
  14. Hughes, T. R., et al. Widespread aneuploidy revealed by DNA microarray expression profiling. Nature. 25, 333-337 (2000).
  15. Goldstein, A. L., McCusker, J. H. Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast. 15, 1541-1553 (1999).
  16. Newman, J. R. S., et al. Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise. Nature. 441, 840-846 (2006).
  17. Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. Gene regulation at the single-cell level. Science. 307, 1962 (2005).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics