Den gröna monster Process för generering av jäststammar Redovisat flera Gene Strykningar

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Den gröna monster Metoden möjliggör snabb montering av flera deletioner markerade med en reportergen som kodar grönfluorescerande protein. Denna metod bygger på att köra jäststammar genom upprepade cykler av sexuell sortiment av strykningar och fluorescens-baserade anrikning av celler som bär fler strykningar.

Cite this Article

Copy Citation | Download Citations

Suzuki, Y., Stam, J., Novotny, M., Yachie, N., Lasken, R. S., Roth, F. P. The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions. J. Vis. Exp. (70), e4072, doi:10.3791/4072 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Fenotyper för en gendeletion ofta avslöjas endast när mutationen testas i en viss genetisk bakgrund eller miljöförhållanden 1,2. Det finns exempel där många gener måste bort för att avslöja dolda genfunktioner 3,4. Trots risken för viktiga upptäckter, är genetiska interaktioner mellan tre eller flera gener i stort sett outforskat. Uttömmande sökningar i flera muterade interaktioner skulle vara opraktiskt på grund av det stora antalet möjliga kombinationer av strykningar. Skulle dock studier av utvalda uppsättningar av gener, som uppsättningar paraloger med större a priori chans att dela en gemensam funktion, vara informativ.

I jästen Saccharomyces cerevisiae, är genen knockout åstadkoms genom att ersätta en gen med en selekterbar markör via homolog rekombination. Eftersom antalet markörer är begränsad, har metoder utvecklats för att avlägsna och återanvända sam e markör 5,6,7,8,9,10. Emellertid är sekventiellt teknik multipla mutationer med användning av dessa metoder tidsödande, eftersom den tid som krävs skalor linjärt med antalet deletioner genereras.

Här beskriver vi den gröna monster metoden för rutinmässigt konstruerar flera strykningar i jäst 11. I denna metod, är ett grönt fluorescerande protein (GFP) reporter integreras deletioner används för att kvantitativt märka stammar enligt antalet deletioner ingår i varje stam (Figur 1). Upprepade omgångar sortiment av GFP märkta-strykningar via jäst parning och meios tillsammans med flödes-cytometrisk anrikning av stammar som bär flera av dessa strykningar leder till ackumulering av deletioner i stammar (Figur 2). Utföra flera processer parallellt, med varje process innefattande en eller flera deletioner per runda, minskar tiden som krävs för stam konstruktion.

innehåll "> Det första steget är att förbereda haploida singel-mutanter kallade" ProMonsters, "var och en bär en GFP reporter i en borttagen lokus och en av de" verktygslåda "loci, antingen gröna monster GMToolkit-a eller GMToolkit-α på . can1Δ lokus (figur 3) Använda stammar från jästen radering samlingen 12, kan GFP-märkta deletioner lämpligen genereras genom att ersätta den vanliga KanMX4 kassetten finns i dessa stammar med en universell GFP - URA3-fragmentet Varje GMToolkit innehåller:. antingen a - eller α-parning-typ-specifik haploida selektionsmarkör 1 och exakt en av de två markörerna som, när båda GMToolkits är närvarande, tillsammans medger selektion av diploider.

Det andra steget är att utföra sexuella cykling genom vilken radering loci kan kombineras i en enda cell genom den slumpmässiga sorteringen och / eller meiotiska recombnering som medföljer varje cykel av parning och sporulering.

Protocol

1. Generering av ProMonsters

  1. Förbered den universella kassett GFP ersättning genom att förstärka en tetO 2-GFP markör och URA3 markören från plasmiden pYOGM012 (ampicillinresistens) användning av primrar med sekvenser:
    GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCC CAAGCTCCTCGAGTAATTCG och GGCGTTAGTATCGAATCGACAGCAGTATAGCGACCAGCATTCAC GTACCGGGTAATAACTGATATAAT (fetstil regioner ger homologi med de flankerande regionerna av KanMX4 kassetten möjliggör målinriktad ersättning). PCR-reaktionen bör utföras med Phusion polymeras, HF-buffert, och 3% dimetylsulfoxid (New England BioLabs) börjar med mall-DNA-koncentrationen av 0,5 ng / | il. PCR-programmet är 98 ° C under 30 sekunder och 35 cykler av 98 ° C under 10 sek, 49 ° C under 30 sekunder, och 72 ° C under 1,5 minuter. Reaktionen volym bör vara> 50 pl för att ge tillräckligt med DNA för varje transformation experiment. Vi renarprodukten med en QIAquick PCR-reningskit (Qiagen) med ~ 50 | il av PCR-reaktionen behandlas per kolumn, men hoppar över reningssteget kan öka utbytet av transformanter.
    Alternativt frigöra ett fragment innehållande tetO 2-GFP och URA3 markörer, liksom homologa regioner för KanMX4 inriktning, genom att digerera plasmiden pYOGM057 (ampicillinresistens) med EcoRI-restriktionsenzym (New England BioLabs). DNA-koncentrationen i denna reaktion bör vara ~ 30 ng / | il. Reaktionsvolymen bör vara> 34 ul.
    För integrering av GFP-kassetten i ett annat område än KanMX4, justera homologiområde av PCR-primers ovan till lämpliga homologa sekvenser.
  2. Förvandla en a-haploida stammen från KanMX4 jäst knockout kollektion 12 med den universella GFP radering kassett. Efter protokollet av skog och Gietz 13 0,34 il avDNA-prov (renad PCR-produkt eller icke-renad restriktionsdigerering) bör användas för varje transformation experiment. Platta en femtedel av omvandlingen blandningen på en CAA-Ura platta (0,67% jästkvävebas, 2% glukos, 0,6% kasaminosyra, 0,0025% adenin hemisulfat, 0,005% tryptofan, och 2% agar).
  3. Strimma ut transformanter på en färsk CAA-Ura-platta för att erhålla isolerade kolonier.
  4. Överför celler från en koloni på en YPDA platta innehållande 200 pg / ml G418 för att bekräfta avsaknaden av tillväxt. För att bekräfta lyckad GFP integration genom att följa stegen (1,5) - (1,9) för att utföra koloni-PCR.
  5. Lägg celler tagna från en koloni i 2 pl lysbuffert (0,1 M natriumfosfat, pH 7,4, 1 enhet zymolyas från ZymoResearch) i en 0,2-ml PCR-rör eller en brunn i en 96-brunnars platta. Blanda genom att pipettera lösningen i och ut ur en pipettspets.
  6. Överlagring med en droppe (ca 20 pl) av mineralolja med en P200 Pipetman (Gilson).
  7. Inkubera blandningen vid 37 °C i 20 min och därefter vid 95 ° C under 10 minuter.
  8. Späd lysatet med 50 pl vatten. Blanda genom att pipettera lösningen i och ut tio gånger.
  9. Analysera 1 il av lysatet med 10-il PCR-reaktioner med (A) en främre primer som parar till den uppströms flankerande regionen parat med en primer av sekvensen CCTGAGAAAGCAACCTGACC (285 bp från början av kassetten), (B) en omvänd primer som parar till regionen nedströms parat med en primer av sekvensen GCATTGGGTCAACAGTATAG (375 bp från slutet), (C) två primrar som hybridiserar till KanMX4 med sekvenserna CGTACTCCTGATGATGCATG och GACGAAATACGCGATCGCTG (181 bp), och (D) två primrar som para till vildtypssekvensen av den målsökta genen (Figur 4). (D) är viktigt eftersom cirka 8% av stammarna i raderingen samlingar är kända för att innehålla aneuploidi 14. En korrekt transformant bör vara positiv med (A) och (B), och negativ med (C) och (D).
  10. Att införa enGMToolkit i transformanten, tillsätt ungefär 250.000 celler från den transformerade stammen och 250.000 celler av antingen RY0146 (innehållande GMToolkit-a) eller RY0148 (innehållande GMToolkit-α) till en 1,6-ml Eppendorf-rör. Vortex. De genotyper av RY0146 och RY0148 är MATa lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-a [CMVpr-rtTA KanMX4 STE2pr-Sp-his5] och MATa lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-α [CMVpr-rtTA NatMX4 STE3pr- LEU2], respektive. pr betecknar promotor. Cellantalet bör uppskattas från optisk densitet av föregående kulturen.
  11. Centrifugera vid 800 x g under 2 minuter.
  12. Avlägsna supernatanten.
  13. Att möjliggöra luftväxling, göra ett hål i locket med en nål som behandlats med 70% etanol.
  14. Lägg 50 il YPDA-medium (1% jästextrakt, 2% pepton, 2% glukos, och 0,003% adenin hemisulfate). Vortex.
  15. Centrifugera vid 800 x g under 5 minuter.
  16. Placera röret i en fuktig låda. Detta kan skapas med en tom spets låda, en liten spets stativ, och en våt pappershandduk.
  17. Inkubera lådan natten vid 30 ° C.
  18. Välj parade diploider genom att först strimmor av cellerna på en CAA-Ura plattan. Inkubera plattan vid 30 ° C under en dag.
  19. Med celler från huvuddelen området, strimma dem att göra isolerade kolonier på YPDA plattor (1% jästextrakt, 2% pepton, 2% glukos, 0,003% adenin hemisulfat, och 2% agar) innehållande 200 ug / ml G418 för att välja diploider innehållande GMToolkit-a eller 100 pg / ml nourseothricin (Nat) 15 för att välja diploider innehållande GMToolkit-α.
  20. Inkubera plattan vid 30 ° C under 3 dagar.
  21. Med utgångspunkt från en isolerad koloni, överför de flesta av cellerna till 500 pl av GNA-medium utan agar (1% jästextrakt, 3% Difco näringsbuljong, och 5% glukos, autoklav glukos och resten av tHan komponenter separat som 2 × lösningar för att undvika karamelliseringen) i en 5-ml kultur rör med locket lossas.
  22. Rotera röret horisontellt i fem timmar vid 30 ° C. Axeln för rotationen måste vara parallell med den längsgående axeln hos röret.
  23. Bekräftar att kolonier som används i (1,21) är Ura + genom att stryka ut dem på en CAA-Ura plattan.
  24. Centrifugera röret vid 800 xg under 2 minuter. Kasta bort supernatanten.
  25. Lägg 500 pl minimalt sporulering-medium (1% kaliumacetat, 0,005% zinkacetat, filter-sterilisera). Vortex.
  26. Centrifugera röret vid 800 xg under 2 minuter. Kasta bort supernatanten.
  27. Upprepa (1,25) - (1,26) två gånger.
  28. Tillsätt 1 ml av minimalt sporulering medium kompletterat med 7,5 | ig / ml lysin, 7,5 pg / ml leucin, 5 pg / ml histidin, 5 pg / ml metionin, och 1,25 | ig / ml uracil (för att öka hastigheten sporulering av auxotrofa stammar) . Vortex.
  29. Vrid röret vid rumstemperatur under en dag.
  30. Vrid röret vid 30 ° C under 2 dagar.
  31. Centrifugera 125 pl av denna blandning i en 1,6-ml Eppendorf-rör vid 800 x g under 2 minuter. Kasta bort supernatanten.
  32. Lägg 50 pl zymolyas-lösning (100 mM natriumfosfatbuffert, pH 7,4, 1 M sorbitol, och 2 enheter zymolyas från ZymoResearch). Blanda genom att pipettera lösningen i och ut ur en pipettspets.
  33. Inkubera vid 30 ° C under 1 timme.
  34. Lägg 50 pl 0,02% NP-40. Blanda genom att pipettera lösningen i och ut ur en pipettspets.
  35. Låt röret vid rumstemperatur under fem minuter.
  36. Lägg 500 fil vatten.
  37. Placera röret på is.
  38. Sonikera denna blandning två gånger vid utgången inställningen 1 (svagaste inställning) under 15 sekunder med hjälp av en 3,2-mm mikrospets med Sonifier 450 (Branson). Mellan de två omgångar sonikering, sätta röret på is för att återföra temperaturen till ~ 0 ° C.
  39. Centrifugera rören vid 800 xg under 5 minuter. Kasta bort supernatanten.
  40. Tillsätt 200 pl SC-Ura-His(A) eller SC-Ura-Leu (α)-medium, beroende på huruvida korset är för införlivande GMToolkit-a eller GMToolkit-α. För att framställa mediet gör SC-Ura-His-Leu-medium (0,67% jästkvävebas, 2% glukos, 0,01% arginin, 0,01% asparaginsyra, 0,01% glutaminsyra, 0,01% isoleucin, 0,01% lysin, 0,01% metionin , 0,01% fenylalanin, 0,08% serin, 0,04% treonin, 0,002% tyrosin, 0,03% valin, 0,0025% adenin, 0,005% tryptofan, 0,003% adenin och 0,005% tryptofan) och komplettera den med steril histidin eller leucin före användning till slutlig koncentration av 0,01%.
  41. Göra ett hål på locket med en nål som behandlats med 70% etanol.
  42. Rotera röret horisontellt vid 30 ° C under 2 dagar. Axeln för rotationen måste vara parallell med den längsgående axeln hos röret.
  43. Strimma av cellerna på en SC-Ura-His eller SC-Ura-Leu agarplatta (samma ingredienser som ovan plus 2% agar, treonin och asparaginsyra måste läggas efterutoclaving, lägga histidin eller leucin innan du häller) för att göra isolerade kolonier för ProMonster stammar.

2. Sexuell Cykling

  1. Rotera en kultur av en etablerad GFP deletion stam i 100 pl SC-His (a) eller SC-Leu (α) beroende på parning typ vid 30 ° C över natten med användning av en 1,6-ml Eppendorf-rör. För luftväxling, göra ett hål med en nål som behandlats med 70% etanol. Rotera röret horisontellt. Axeln för rotationen måste vara parallell med den längsgående axeln hos röret. Det är möjligt att korsa flera stammar via en masse parning. När en sorterad prov direkt används för detta ändamål, odla cellerna i 200 pl vid 30 ° C under 2 dagar. För att framställa mediet, tillsätt uracil (slutlig koncentration: 0,0025%) och histidin (0,01%) eller leucin (0,01%) till SC-Ura-His-Leu-medium.
  2. Blanda 250.000 a-haploida celler och 250.000 α-haploida celler av GFP radering stammar i en 1,6-ml Eppendorf röret. Vortex.
  3. Para dessa celler genom följande steg (1,11) - (1,17).
  4. Överför 10 ul av den passande blandningen till 500 pl GNA medium innehållande 200 pg / ml G418 och 100 pg / ml NAT i en 5-ml kultur rör med en lossat lock. Utgångs OD 600 är ungefär 0,1.
  5. Vrid kulturen vid 30 ° C under 24 timmar. Detta möjliggör val av diploider eftersom endast diploider innehåller både KanMX4 i GMToolkit-a och NatMX4 i GMToolkit-α kan växa i närvaro av G418 och Nat (Figur 3).
  6. Överför 20 ul av en dag kulturen till 500 pl färsk GNA innehållande G418 och Nat. Utgångs OD 600 är ungefär 0,2.
  7. Vrid röret vid 30 ° C under 5 timmar för att få celler i logfas (OD 600 av ~ 1).
  8. Följ stegen (1,24) - (1,38) för att sporulera de diploider och isolera sporer.
  9. Dela upp suspensionen av sporulerade celler i två 300-xldelar och sätta vardera i en separat 1,5-ml Eppendorf-rör.
  10. Centrifugera rören vid 800 xg under 5 minuter. Kasta bort supernatanten.
  11. Till pellet av en tub, tillsätt 100 ^ SC-Hans medium för välja-haploider. Till pelleten i det andra röret, tillsätt 100 ^ SC-Leu-medium för att välja α-haploider.
  12. Rotera rören vid 30 ° C över natten. Den slutliga OD 600 bör vara mindre än 0,5. Om OD 600 tenderar att vara alltför hög, prova odling vid rumstemperatur.
  13. För att inducera GFP, tillsätt 100 pl färsk SC-His (a) eller SC-Leu (α) medium innehållande 20 ug / ml doxycyklin. Den slutliga koncentrationen av doxycyklin är 10 pg / ml. Vortex.
  14. Rotera rören vid 30 ° C under 2 dagar.

3. Flödescytometri

  1. Lägg 900 pl förfiltrerat TE-buffert (pH 7,5) innehållande 10 pg / ml doxicyklin till en 5-ml polypropylenrör (BD Falcon # 352.063) med locket bytte med en cell-sil locket från en 5-ml polystyrenrör (BD Falcon # 352.235). Polypropenrör är lämpliga för flödescytometri. Silen lock är önskvärt för avlägsnande av stora partiklar.
  2. Placera försiktigt 75 pl TE-buffert med doxycyklin på cell-sil lock.
  3. Tillsätt 25 | il av de inducerade cellerna till lösningen på locket.
  4. Medan du trycker på spetsen av Pipetman mot nätet, skjuta alla i den kombinerade lösningen genom silen.
  5. Tryck ner silen locket och skaka röret.
  6. Förbered uppsamlingsrör (1,6-ml Eppendorf-rör) fyllda med 200 pl SC-His eller SC-Leu.
  7. Starta cellen sorterare och justera inställningarna enligt tillverkarens bruksanvisning.
  8. Vortex både uppsamlingsrör (att belägga väggen med mediet) och röret som innehåller celler innan du lägger dem på cellsorterare.
  9. Hämta data flödescytometriinstrument i provet. En stam som inte innehåller GFP kan vara en negativ kontroll.
  10. Rita grindar för sortering. (A)För att undvika cellaggregat, vilket kan uppvisa hög GFP intensitet, kassera avvikande med oproportionerligt stor pulsbredd för framåt spridning (FSC) med en tomt på pulsbredd och puls höjd MoFlo sorterare eller oproportionerligt liten FSC höjd med hjälp av en tomt på FSC höjd och FSC område för FACSAria sorterare (Figur 5, övre vänstra panelen). (B) Eftersom stora FSC (område) förväntas för cellaggregat, endast ta celler i den nedre 20% i FSC, samtidigt som man undviker regioner med den lägsta FSC och sidospridning (SSC) värden där cellfragment ofta finns (figur 5, övre högra panelen). (C) SSC (område) och GFP-signal (område) är ofta positivt korrelerade. Eftersom att helt enkelt ta den ljusaste cellerna ges portarna ovan skulle också berika för celler med högt SSC värde rita en grind längs periferin av befolkningen med en tomt av GFP intensitet och SSC för att ta ett liknande procentandel av de ljusaste cellerna från varje punkt av SSC-axeln (figur 5, BottOM-vänster diagram). Befolkningen valts i (C) bör vara 0.1-1% av befolkningen valts i (B).
  11. Sortera 200 celler i samlingen röret ges kriterierna i (3,10). För en en masse process eller för andra projekt som kräver en mer komplex befolkning, sortera fler celler som behövs.
  12. Vortexblanda uppsamlingsröret att täcka de sorterade cellerna med medium.
  13. Platta en undergrupp av celler (till exempel, 50 celler) på en YPDA platta för genotypning.
  14. Inkubera plattan vid 30 ° C under 2 dagar.
  15. Gör en lysat för ~ 12 kolonier enligt de steg (1,5) - (1,8).
  16. Överför de återstående cellerna på den använda spetsen i (1,5) till en plats på en YPDA platta innehållande G418 och Nat genom att försiktigt trycka plattan med spetsen. Valda haploider bör inte växa på denna platta. Diploider kan ha fler GFP kopior och kan därför vara ljusare. Detta test kan visa effektiviteten hos haploida val.
  17. För genotypning, analysera 1 pl av lysatet med en 10-il PCR reaction med en framåt primer som hybridiserar till uppströms flankerande regionen av varje raderade gen ihop med en primer av sekvensen CCTGAGAAAGCAACCTGACC.
    Multiplex PCR-reaktioner om möjligt (kan villkor som skall fastställas med hjälp lysat av enstaka mutanter). PCR kan utföras i en 96 - eller 384-brunnsformat. Den sistnämnda formatet är lämpliga för reaktionen volym av så lite som 5 | il. Ordnande av PCR mästare blandar skiljer sig i primers och tillägg av cellysat till dessa blandningar kan utföras med hjälp av en flerkanalig pipett eller en flytande hanteringsrobot. Tips förändringar är frivilliga när du lägger samma lysatet till olika PCR mixar.
  18. Analysera PCR-produkter. Gel XL Ultra V-2 elektroforessystem (Labnet) är kompatibel med prov lastning med flerkanaliga pipetter.
  19. Baserat på information från (3,16) och (3,18), identifiera sannolika haploider som önskade genotyper.
  20. Upprätta dessa stammar på en färsk platta (YPDA, CAA-Ura eller SC-Ura-His/Leu). Dessutom, frysa dem i25% glycerol vid -80 ° C. Ytterligare tester som bekräftelse på avsaknaden av vildtyp sekvenser för raderade gener och pulserande fält gelelektrofores rekommenderas.
  21. Upprepa sexuell cykling från (2,1) med användbara stammar.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

När en a-haploida stammen bär fyra GFP-märkta deletioner (ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) korsades med en α-haploida stammen bär fyra strykningar (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ), med två strykningar (ycl033cΔ yer042wΔ) delas av två stammar, en företrädare resultat erhölls. Den passande blandningen odlades i YPDA medium innehållande G418 och Nat att välja diploider. De resulterande diploider odlades i sporbildningen mediet. Sporerna skingrades genom zymolyas behandling och ultraljudsbehandling och grodde i haploida urval medier. Cellerna inducerades därefter för att uttrycka GFP. Använda portar med en flödescytometer, var en population av celler valda som sannolikt inte innehålla skräp eller cellaggregat (Figur 5). Inom denna population var den ljusaste 1% av cellerna sorteras. Sorterade celler och osorterade celler var genoskrivs efter att de bildade kolonier på en plåt. När slumpmässigt utvalda kolonier ströks ut på en YPDA platta innehållande G418 och Nat, celler från 2 av 16 kolonier ökade för osorterat prov och celler från 18 av 26 kolonier växte för den sorterade provet, vilket tyder på att vissa diploider fick möjlighet att uttrycka en haploid-selektionsmarkör och fortplantas under haploida-urvals-och GFP-induktion faser i detta experiment. Diploider var ytterligare anrikat på den sorterade provet troligen beroende på det större antalet av GFP kopierar de innehöll. När haploider analyserades med PCR, var det genomsnittliga antalet deletioner i de sorterade cellerna 5,1 ± 0,4 (n = 8, SEM visade). Fyra av dessa celler hade sex deletioner, den maximalt möjliga antal strykningar för kors. Haploider av osorterade provet hade 3,4 ± 0,2 strykningar i genomsnitt (n = 14).

I ett separat experiment, en a-haploida stammen bär syv GFP-märkta deletioner (nir042wΔ yer108cΔ yfr057wΔ ykl069wΔ ykr011cΔ ylr123cΔ yol118cΔ) korsades med en α-haploida stammen bär åtta strykningar (ycl033cΔ ydl227cΔ ydl242wΔ yer042wΔ yer108cΔ yfr057wΔ ygl109wΔ ykr011cΔ), med fyra gemensamma deletioner (yer042wΔ yer108cΔ yfr057wΔ ykr011cΔ) som ingår i de två stammarna. När diploider valdes och därefter odlas i sporbildning mediet, sporulerades cirka 20% av celler baserat på mikroskopisk observation (n> 100). Efter att sporerna dispergerades och gro, de resulterande haploider induceras att uttrycka GFP och sorteras baserat på fluorescens såsom ovan. Endast en av 61 slumpmässigt utvalda celler växte på en YPDA platta innehållande G418 och Nat, vilket tyder på att sorterade celler huvudsakligen var haploida. Vid analys med PCR (figur 6), hade de sorterade cellerna i genomsnitt radering antalet 8,8 ±0,3 (n = 12, SEM visade), inklusive fem celler som innehåller tio deletioner. Det förväntade antalet raderingar för en osorterad cell följd slumpvis segregation var 7,5.

Figur 1
Figur 1. Gröna monster under mikroskop. Fluorescence micrographs visa en icke-mutant stam (vänster), en ProMonster stam (mitten), och en 16-GFP monster stam (höger). Identisk exponering, ljusstyrka och kontrast användes för bilder.

Figur 2
Figur 2. Systemet av Green Monster processen. Single-muterade haploider (ljusgrön) paras. Meiotiska rekombination under sporulering av de parade diploider genererar en blandning av 0-GFP celler (off-white), 1-GFP celler (ljusgrön) och 2-GFP celler (mörkgrön). Flödecytometri används för att välja de grönaste cellerna anrikade för 2-GFP celler. Integrerade molekylära verktyg möjliggör val av a-haploider (His +), α-haploider (Leu +) och diploider (G418-och Nat-motstånd). Denna cykel upprepas för att berika för stammar som bär ett ständigt ökande antal förändringar.

Figur 3
Figur 3. GFP radering kassetter och GMToolkits. GFP radering kassetter innehåller en gen GFP reporter och en jäst omvandling markör (URA3). Den tetO 2-promotorn är inducerbar genom tillsats av doxycyklin i mediet genom verkan av få den rätta transkriptionsfaktorn. Om GFP når den maximala kapaciteten hos celler att göra proteinet eller att tolerera någon toxisk effekt av det, kan uttrycket ringas ner genom att sänka doxycyklin koncentrationen (notera dock att vi gjorde inte observera sådan mättnad eller effekter toxicitet även med 16 kopior av GFP). Denna kassett kan riktas till alla gen eller region genom att fästa specifika homologa sekvenser med PCR. Alternativt kan den universella GFP radering kassett med identiska homologa sekvenser lämpligen inriktas på KanMX4 'landning kuddar "i stammar av jäst knockout samling. YFG betecknar din favorit gen. Box med vertikala linjer betecknar DNA streckkod. GMToolkits är integrerade i CAN1 lokuset. STE2-his5 markören och STE3-LEU2-markör uttrycks i en passande typspecifik sätt haploider att endast a-haploider att växa i frånvaro av histidin och endast α-haploider att växa i frånvaro av leucin, respektive. Selektering för resistens mot G418 och Nat samtidigt väljer för KanMX4 locus i en GMToolkit och NatMX4 locus i den andra och därmed selekterar för diploider.

_content "fo: keep-together.within-page =" alltid "> Figur 4
Figur 4. Bekräfta korrekt integrering av GFP kassetten. En universell GFP kassett kan användas för att konvertera alla KanMX4-märkt radering finns i jäst radering samlingen till en GFP-märkt radering. Med en korrekt genererad GFP radering allel, PCR-reaktion med en främre primer som parar till den uppströms flankerande regionen parad med en omvänd primer som hybridiseras till början av kassetten (PCR A steg 1,9) bör göra ett band. PCR med en omvänd primer som parar till den nedströms flankerande regionen ihopkopplad med en främre primer som parar till änden av kassetten (PCR B) bör göra en produkt. PCR med två primers som hybridiserar i KanMX4 kassetten (PCR C) eller med två primers som hybridiserar till vildtypssekvensen av riktade genen (PCR D) bör inte ge ett band. Röd pil betecknar en PCR-primer. Bracmarknaden visar en region amplifierades med en PCR-reaktion. Ruta anger GFP kassetten (grön), den KanMX4 kassetten (gul), eller din favorit-gen (YFG, grå). Svarta linjen visar en flankerande sekvens i en jästkromosom.

Figur 5
Figur 5. Flödescytometri. I detta experiment haploida avkomma från en korsning av två stammar, en med genotypen ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ och den andra med genotyp ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ inducerades att uttrycka GFP. Varje gendeletion hade en GFP-kassett. Genom slussning celler på grundval av framåtspridning område och framåtspridning höjd (P1), cellaggregat (som tenderar att ha oproportionerligt stora framåtspridning område uteslöts. Genom slussning celler på grundval av framåt spridning och sidospridning (P2), CELLS i nedre 20% i framåtspridning godkändes under exklusive skräp med den lägsta framåt scatter och sidospridning. Genom slussning celler på grundval av sidospridning och GFP-signal (P3), var mer fluorescerande celler bland dem i en given sidospridning har vidtagits. För att tillåta jämförelse av meiotiska blandningen och den negativa kontrollprovet som inte uttrycker GFP, en grind identisk med den som används för att välja P3 populationen visas i ett diagram för de motsvarande markerade cellerna i den negativa kontrollen.

Figur 6
Figur 6. Genotypning de sorterade stammarna. PCR utfördes med användning av en omvänd primer som parar till den nedströms flankerande regionen ihopkopplad med en främre primer som hybridiseras till slutet av kassetten. Närvaron av bandet indikerar närvaron av GFP kassetten. En separat experiment visade att alla de tolv stammar konupprätthålla den yer042w Δ radering och ykr011c Δ radering.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

När vi utvecklade den gröna monster synsätt vi sysslar med möjlighet till rekombination mellan olika kassetter GFP ersättning, vilket leder till genomet omlagring. Mildra mot denna möjlighet är vårt urval av celler som framgångsrikt har genomgått flera omgångar av parning och meios. Celler som bär omlagrade genomen förväntas vara mindre passform efter parning till celler utan en identisk omlagring. Faktum, vi observerar någon genomet instabilitet till följd av rekombination mellan GFP kassetter 11. Men vi kan inte helt utesluta denna möjlighet, så det rekommenderas att användarna testa genererade stammar för omlagring. Pulsad fält gelelektrofores kan användas för att detektera grov abnormitet. PCR med primrar glödgning till sekvenser inom deletionen kan användas för att bekräfta frånvaron av vildtypssekvenser.

Baserat på fluorescens nivåer etablerade stammar, GFP intensitet hade en nära-linjärt förhållande med antalet raderingar, vilket tyder på att mättnad är inte ett problem inom den testade intervallet av en till 16 deletioner 11. Men även i senare rundor med stammar med många icke-överlappande deletioner, kunde vi bara öka det genomsnittliga antalet strykningar i befolkningen med cirka två i varje runda, medan teoretiskt en cell som bär föreningen av alla strykningar i två föräldra stammar kan kombineras på en gång om perfekt stringens för GFP val uppnåddes. En begränsning är cell-till-cell-variation av GFP intensitet bland isogena celler. I det andra exemplet i ett representativt resultat skulle bara 0,8% av cellerna i populationen förväntas ha alla 11 strykningar som var möjligt i detta kors (fyra av de 11 strykningar delades av båda föräldrarnas haploider). Emellertid kommer de mer rikliga tio-deletion stammar har en fördelning av GFP intensitet som överlappar den för 11-deletionen strains. Därför måste en ännu mindre del av befolkningen väljas för att företrädesvis välja 11-deletion stammar från högre svansen av GFP intensitetsfördelningen av 11-deletion stammar. En lösning kan vara att helt enkelt höja tröskeln för att sortera sällsynta celler med högre GFP intensitet. En annan lösning kan vara att samtidigt mäta en inre standard, en fluorescerande protein reporter av en annan färg som är närvarande i en enda kopia, uttryckt via samma tetO 2 promotor. Denna strategi skulle kunna förväntas upphäva yttre brus för att minska cell-till-cell-variation av sålunda normaliserade mätningar GFP intensitet 16,17.

Svårigheten att få sällsynta multi-mutanter kan förvärras av den potentiellt långsam tillväxt av dessa stammar. Multi-mutanter anrikas med användning av flödescytometri, men de kan konkurreras under resten av processen genom montör syskon. För att minimera antalet generationerjäststammar genomgår rekommenderar vi små kulturvolymer som ger just tillräckligt förstärkning av celler av den önskade ploidi som väljs vid varje steg.

Eftersom flera strykningar kan förvärvas per cykel, kan den gröna monster metod användas för att montera flera mutanter snabbare än sekventiella metoder 11. Om särskilda undergrupper av strykningar har syntetiska dödliga relationer kan "återvändsgränder" uppträda med sekventiella metoder. Denna begränsning kan kringgås genom den gröna monster tillvägagångssätt som prover från loppet av möjliga vägar mot ackumulera den fullständiga uppsättningen strykningar. Ju mer parallell i massor version av Green Monster processen bör vara användbar för att hitta en väg för att nå den största tillåtna antalet strykningar.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Inga intressekonflikter deklareras.

Acknowledgments

Detta arbete stöddes av USA Defense Advanced Research Projects Agency kontrakt N66001-12-C-4039 till YS, ett anslag från Alfred P. Sloan Foundation till RSL och amerikanska National Institutes of Health bidrag R01 HG003224 och R21 CA130266 till FPRFPR var också stöds av en gemenskap från den kanadensiska institutet för avancerad forskning och genom Kanadas Excellence Research Stolar programmet.

Materials

Name Company Catalog Number Comments
G418 Sigma-Aldrich A1720 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 200 mg/ml. Store at 4 °C.
ClonNAT (nourseothricin) WERNER BioAgents 5001000 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 100 mg/ml. Store at 4 °C.
Doxycycline Sigma-Aldrich D9891 Dissolve in 50% ethanol and filter-sterilize (0.2-μm filter). Stock concentration: 10 mg/ml. Make fresh every four weeks. Shield from light using aluminum foil and store at 4 °C.
Zymolyase ZymoResearch E1005
Difco yeast nitrogen base w/o amino acids BD 291940
Revolver (rotator for tubes) Labnet H5600
Enduro Gel XL electrophoresis unit Labnet E0160
Sonifier 450 Branson 101-063-198
Microtip for Sonifier 450 Branson 101-148-062
FACSAria cell sorter BD
MoFlo cell sorter Beckman-Coulter
Biomek FX or equivalent robot Beckman Coulter Optional. For setting up genotyping PCRs.

DOWNLOAD MATERIALS LIST

References

  1. Tong, A. H., et al. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science's STKE. 294, 2364-23 (2001).
  2. Hillenmeyer, M. E., et al. The chemical genomic portrait of yeast: uncovering a phenotype for all genes. Science. 320, 362-365 (2008).
  3. Beh, C. T., Cool, L., Phillips, J., Rine, J. Overlapping functions of the yeast oxysterol-binding protein homologues. Genetics. 157, 1117 (2001).
  4. Wieczorke, R., et al. Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae. FEBS letters. 464, 123-128 (1999).
  5. Alani, E., Cao, L., Kleckner, N. A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics. 116, 541-545 (1987).
  6. Akada, R., et al. PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae. Yeast. 23, 399-405 (2006).
  7. Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic acids research. 24, 2519 (1996).
  8. Delneri, D., et al. Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system. Gene. 252, 127-135 (2000).
  9. Storici, F., Lewis, L. K., Resnick, M. A. In vivo site-directed mutagenesis using oligonucleotides. Nat. Biotech. 19, 773-776 (2001).
  10. Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast. Nucl. Acids Res. 38, 2570-2576 (2010).
  11. Suzuki, Y., et al. Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection. Nat. Methods. 8, 159-164 (2011).
  12. Winzeler, E. A. Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis. Science. 285, 901-906 (1999).
  13. Woods, R. A., Gietz, R. D. High-efficiency transformation of plasmid DNA into yeast. Methods Mol. Biol. 177, 85-97 (2001).
  14. Hughes, T. R., et al. Widespread aneuploidy revealed by DNA microarray expression profiling. Nature. 25, 333-337 (2000).
  15. Goldstein, A. L., McCusker, J. H. Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast. 15, 1541-1553 (1999).
  16. Newman, J. R. S., et al. Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise. Nature. 441, 840-846 (2006).
  17. Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. Gene regulation at the single-cell level. Science. 307, 1962 (2005).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics