Il processo di Green Monster per la generazione di ceppi di lieviti trasporto gene delezioni multiple

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Il metodo Green Monster consente l'assemblaggio rapido di delezioni multiple contrassegnati con un reporter gene codificante proteina fluorescente verde. Questo metodo si basa sulla guida ceppi di lievito attraverso cicli ripetuti di assortimento sessuale di delezioni e basato sulla fluorescenza arricchimento di cellule che trasportano più eliminazioni.

Cite this Article

Copy Citation | Download Citations

Suzuki, Y., Stam, J., Novotny, M., Yachie, N., Lasken, R. S., Roth, F. P. The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions. J. Vis. Exp. (70), e4072, doi:10.3791/4072 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Fenotipi di una delezione del gene sono spesso rivelati solo quando la mutazione viene testato in un contesto particolare genetica o 1,2 condizione ambientale. Ci sono esempi in cui molti geni devono essere eliminati per smascherare le funzioni del gene nascoste 3,4. Nonostante il potenziale di scoperte importanti, interazioni genetiche che coinvolgono tre o più geni sono in gran parte inesplorate. Ricerche esaustive di multi-mutanti interazioni sarebbe impraticabile a causa del gran numero di possibili combinazioni di delezioni. Tuttavia, studi di insiemi di geni selezionati, quali giochi di paraloghi con una maggiore possibilità di scambio priori una funzione comune, sarebbe informativo.

Nel lievito Saccharomyces cerevisiae, knockout gene è realizzato sostituendo un gene con un marcatore selezionabile tramite ricombinazione omologa. Poiché il numero di marcatori è limitata, sono stati sviluppati metodi per rimuovere e riutilizzare il sam 5,6,7,8,9,10 e marcatore. Tuttavia, sequenzialmente mutazioni ingegneria multipli utilizzando questi metodi richiede tempo perché il tempo richiesto scale linearmente con il numero di delezioni da generare.

Qui si descrive il metodo Verde Monster per routine ingegnerizzazione molteplici delezioni nel lievito 11. In questo metodo, una proteina verde fluorescente (GFP) reporter integrato in delezioni viene utilizzato per quantitativamente ceppi etichette secondo il numero delle delezioni contenuti in ogni ceppo (Figura 1). Cicli ripetuti di assortimento di GFP-segnate delezioni tramite accoppiamento lievito e meiosi accoppiato con citometria a flusso arricchimento di ceppi che trasportano più di queste delezioni portare all'accumulo di delezioni in ceppi (Figura 2). Esecuzione di più processi in parallelo, con ogni processo che incorpora uno o più delezioni per round, riduce il tempo richiesto per la costruzione ceppo.

contenuto "> Il primo passo è quello di preparare aploidi singolo mutanti chiamato 'ProMonsters,' ciascuno dei quali porta un reporter GFP in un luogo cancellato e uno dei 'toolkit' loci-sia-una GMToolkit verde Monster o GMToolkit-α al . can1Δ locus (Figura 3) utilizzando ceppi della collezione delezione lievito 12, GFP-marcate delezioni possono essere convenientemente generato sostituendo il comune KanMX4 cassetta esistente in questi ceppi con un universale GFP - URA3 frammento Ogni GMToolkit contiene:. sia l'una - o α-accoppiamento di tipo-specifico marcatore di selezione aploide 1 ed esattamente uno dei due marcatori che, quando entrambi sono presenti GMToolkits, collettivamente permettere una selezione di diploidi.

Il secondo passo è quello di effettuare il ciclismo sessuale attraverso cui loci cancellare possono essere combinate in una singola cellula dal assortimento casuale e / o recomb meioticaminazione che accompagna ogni ciclo di accoppiamento e la sporulazione.

Protocol

1. Generazione di ProMonsters

  1. Preparare la cassetta universale sostituzione GFP, amplificando un tetO 2-GFP marcatore e il marcatore URA3 dal plasmide pYOGM012 (resistenza all'ampicillina) utilizzando primer con le sequenze:
    GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCC CAAGCTCCTCGAGTAATTCG e GGCGTTAGTATCGAATCGACAGCAGTATAGCGACCAGCATTCAC GTACCGGGTAATAACTGATATAAT (regioni in grassetto fornire omologia con le regioni a fianco della cassetta KanMX4 permettendo la sostituzione mirata). La reazione PCR deve essere effettuata con Phusion polimerasi, tampone HF, e il 3% dimetilsolfossido (New England Biolabs) a partire dalla concentrazione di stampo di DNA di 0,5 ng / pl. Il programma PCR è di 98 ° C per 30 sec e 35 cicli di 98 ° C per 10 sec, 49 ° C per 30 sec e 72 ° C per 1,5 min. Il volume di reazione deve essere> 50 pl per fornire abbastanza DNA per ciascun esperimento di trasformazione. Abbiamo purificareil prodotto utilizzando un QIAquick PCR Purification Kit (Qiagen) con ~ 50 pl della reazione PCR trasformati per colonna, ma saltando la fase di purificazione può aumentare la resa dei trasformanti.
    In alternativa, rilasciare un frammento contenente il tetO 2-GFP e marcatori URA3, nonché regioni omologhe per KanMX4 targeting, digerendo il plasmide pYOGM057 (resistenza all'ampicillina) utilizzando l'enzima di restrizione EcoRI (New England Biolabs). La concentrazione di DNA in questa reazione dovrebbe essere ~ 30 ng / mL. Il volume di reazione deve essere> 34 microlitri.
    Per integrare la cassetta GFP in una regione diversa KanMX4, regolare la regione omologia dei primer PCR sopra per le opportune sequenze omologhe.
  2. Trasformare un un ceppo aploide della collezione KanMX4 eliminazione diretta lievito 12 con la cassetta universale eliminazione GFP. In seguito il protocollo da Woods e Gietz 13 0,34 microlitri dellaCampione di DNA (prodotto di PCR purificato o non purificato digestione di restrizione) deve essere usato per ogni esperimento trasformazione. Piastra un quinto trasformazione della miscela su un CAA-Ura piastra (0,67% base azotata di lievito, 2% di glucosio, 0,6% di acido Casamino, 0,0025% emisolfato adenina, 0,005% triptofano, e 2% agar).
  3. Streak i trasformanti su un nuovo CAA-Ura piastra per ottenere colonie isolate.
  4. Trasferire le cellule da una colonia su un piatto YPDA contenente 200 ug / ml di G418 per confermare l'assenza di crescita. Per confermare il successo dell'integrazione GFP, seguire la procedura (1.5) - (1.9) per eseguire colonia PCR.
  5. Aggiungere cellule prelevate da una colonia in 2 ml di tampone di lisi (0,1 M fosfato di sodio, pH 7,4, 1 zymolyase unità da ZymoResearch) in una provetta da 0,2 ml PCR o un pozzetto di una piastra a 96 pozzetti. Mescolare pipettando la soluzione in e fuori di una punta di pipetta.
  6. Overlay con una goccia (circa 20 pl) di olio minerale con un Pipetman P200 (Gilson).
  7. Incubare la miscela a 37 °C per 20 minuti e poi a 95 ° C per 10 min.
  8. Diluire il lisato con 50 microlitri di acqua. Mescolare pipettando la soluzione in e fuori dieci volte.
  9. Analizzare 1 ml del lisato utilizzando 10 ul reazioni di PCR con (A) un primer forward che ricombina con la regione fiancheggiante monte accoppiato con un primer del CCTGAGAAAGCAACCTGACC sequenza (285 bp dall'inizio della cassetta), (B) un inverso primer che si ricombina con la regione a valle accoppiato con un primer del GCATTGGGTCAACAGTATAG sequenza (375 bp dall'estremità), (C) due primer che annealing a KanMX4 con le sequenze CGTACTCCTGATGATGCATG e GACGAAATACGCGATCGCTG (181 bp), e (D) due primer che ricottura alla sequenza wild-type del gene mirato (Figura 4). (D) è importante perché circa l'8% dei ceppi appartenenti alle collezioni di eliminazione sono noti per contenere aneuploidia 14. Un trasformante corretta dovrebbe essere positivo (A) e (B), e negativa con (C) e (D).
  10. Per introdurre unGMToolkit nel trasformante, aggiungere circa 250.000 cellule dal ceppo trasformato e 250.000 cellule di entrambi RY0146 (contenente GMToolkit-a) o RY0148 (contenente GMToolkit-α) in una provetta da 1,6 ml Eppendorf. Vortex. I genotipi di RY0146 e RY0148 sono MATα lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-a [CMVpr-rtTA KanMX4 STE2pr-Sp-his5] e MATα lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-α [CMVpr-rtTA NatMX4 STE3pr- LEU2], rispettivamente. pr denota promotore. Numero di cellulare deve essere definita sulla base della densità ottica della cultura precedente.
  11. Centrifugare a 800 xg per 2 minuti.
  12. Rimuovere il surnatante.
  13. Per consentire il ricambio dell'aria, un foro sul coperchio utilizzando una puntina trattato con etanolo al 70%.
  14. Aggiungere 50 ml di YPDA media (1% estratto di lievito, 2% peptone, 2% di glucosio, e 0,003% hemisulfat adeninae). Vortex.
  15. Centrifugare a 800 xg per 5 min.
  16. Porre il tubo in una scatola umida. Questo può essere realizzato con una scatola vuota punta, uno stand piccolo suggerimento, e un tovagliolo di carta bagnato.
  17. Incubare la casella notte a 30 ° C.
  18. Selezionare diploidi accoppiati dalla prima strisciando le celle di un CAA-Ura piastra. Incubare la piastra a 30 ° C per un giorno.
  19. Prendendo cellule dal bulk zona, striscia fuori per rendere colonie isolate su piastre YPDA (1% estratto di lievito, 2% peptone, glucosio 2%, 0,003% emisolfato adenina, e 2% agar) contenenti 200 pg / ml di G418 per selezionare diploidi contenente GMToolkit-a o 100 pg / ml nourseothricin (Nat) 15 per la selezione diploidi contenenti GMToolkit-α.
  20. Incubare la piastra a 30 ° C per 3 giorni.
  21. Partendo da una colonia isolata, trasferire la maggior parte delle cellule a 500 pl di mezzo GNA senza agar (estratto di lievito 1%, 3% brodo nutriente Difco, e il 5% di glucosio, glucosio autoclave e il resto della tha componenti separatamente come 2 × soluzioni per evitare caramellizzazione) in un 5 ml provetta con il coperchio allentato.
  22. Ruotare il tubo orizzontalmente per cinque ore a 30 ° C. L'asse di rotazione deve essere parallela all'asse longitudinale del tubo.
  23. Verificare che le colonie utilizzati in (1.21) sono Ura + strisciando fuori su un CAA-Ura piastra.
  24. Centrifugare la provetta a 800 xg per 2 minuti. Eliminare il surnatante.
  25. Aggiungere 500 pl di mezzo di sporulazione minima (1% acetato di potassio, acetato di zinco 0,005%; filtro-sterilizzare). Vortex.
  26. Centrifugare la provetta a 800 xg per 2 minuti. Eliminare il surnatante.
  27. Repeat (1.25) - (1.26) due volte.
  28. Aggiungere 1 ml di mezzo di sporulazione minima supplementato con 7,5 ug / ml lisina, 7,5 ug / ml leucina, 5 pg / ml istidina, 5 pg / ml di metionina, e 1,25 mg / ml uracile (per aumentare il tasso di sporulazione dei ceppi auxotrophic) . Vortex.
  29. Ruotare il tubo a temperatura ambiente per un giorno.
  30. Ruotare il tubo a 30 ° C per 2 giorni.
  31. Centrifugare 125 pl di questa miscela in una provetta da 1,6 ml Eppendorf a 800 xg per 2 min. Eliminare il surnatante.
  32. Aggiungere 50 ml di soluzione zymolyase (100 mM tampone fosfato di sodio, pH 7,4, 1 M sorbitolo, e due unità da zymolyase ZymoResearch). Mescolare pipettando la soluzione in e fuori di una punta di pipetta.
  33. Incubare a 30 ° C per 1 ora.
  34. Aggiungere 50 ml di 0,02% NP-40. Mescolare pipettando la soluzione in e fuori di una punta di pipetta.
  35. Lasciare il tubo a temperatura ambiente per cinque minuti.
  36. Aggiungere 500 ml di acqua.
  37. Mettere la provetta in ghiaccio.
  38. Sonicare questa miscela due volte l'impostazione di uscita 1 (impostazione più debole) per 15 secondi con un 3,2 mm microtip con Sonifier 450 (Branson). Tra i due cicli di sonicazione, mettere il tubo in ghiaccio per riportare la temperatura a ~ 0 ° C.
  39. Centrifugare le provette a 800 xg per 5 min. Eliminare il surnatante.
  40. Aggiungere 200 ml di SC-Ura-His(A) o SC-Ura-Leu (α) medio, a seconda che la croce è per incorporare GMToolkit-a o GMToolkit-α. Per preparare i mezzi di comunicazione, rendono SC-Ura-His-Leu medio (0,67% base di azoto di lievito, 2% di glucosio, 0,01% arginina, acido aspartico 0,01%, 0,01% di acido glutammico, isoleucina 0,01%, 0,01% di lisina, metionina 0,01% , 0,01% fenilalanina, serina 0,08%, 0,04% treonina, tirosina 0,002%, 0,03% valina, 0.0025% adenina, triptofano 0,005%, 0,003% adenina e triptofano 0,005%) e integrare con istidina sterile o leucina prima dell'uso al concentrazione finale di 0,01%.
  41. Praticare un foro sul coperchio utilizzando una puntina trattato con etanolo al 70%.
  42. Ruotare il tubo orizzontalmente a 30 ° C per 2 giorni. L'asse di rotazione deve essere parallela all'asse longitudinale del tubo.
  43. Streak le celle di un SC-Ura-His o SC-Ura-Leu piastra di agar (gli stessi ingredienti di cui sopra più 2% di agar, acido aspartico e treonina deve essere aggiunto dopo unutoclaving, aggiungere o istidina leucina prima di versare) per rendere colonie isolate per i ceppi ProMonster.

2. Ciclismo sessuale

  1. Ruotare una coltura di un ceppo di GFP stabilito delezione in 100 pl di SC-His (a) o SC-Leu (α) secondo il tipo di accoppiamento a 30 ° C per una notte con un 1,6 ml provetta Eppendorf. Per il ricambio dell'aria, fare un foro con una puntina da disegno trattato con etanolo al 70%. Ruotare il tubo orizzontalmente. L'asse di rotazione deve essere parallela all'asse longitudinale del tubo. È possibile attraversare ceppi multipli tramite accoppiamento in massa. Quando un campione viene ordinato direttamente utilizzato per questo scopo, coltivare le cellule in 200 pl a 30 ° C per 2 giorni. Per preparare il mezzo, aggiungere uracile (concentrazione finale: 0,0025%) e istidina (0,01%) o leucina (0,01%) per SC-Ura-His-Leu medie.
  2. Mescolare 250.000 a-cellule aploidi e 250.000 α-cellule aploidi di ceppi di delezione GFP in un 1,6 ml Eppendorf tubo. Vortex.
  3. Mate queste cellule seguendo i passaggi da (1.11) - (1.17).
  4. Trasferire 10 microlitri della miscela di accoppiamento per mezzo GNA 500 microlitri contenente 200 ug / ml di G418 e 100 pg / ml Nat in 5 ml di una provetta di coltura con un coperchio allentato. La partenza OD 600 è circa 0,1.
  5. Ruotare la coltura a 30 ° C per 24 ore. Questo permette la selezione di diploidi perché solo diploidi contenente sia KanMX4 in GMToolkit-a e NatMX4 in GMToolkit-α può crescere in presenza di G418 e Nat (Figura 3).
  6. Trasferire 20 microlitri della cultura di un giorno a 500 ml di fresca GNA contenente G418 e Nat. La partenza OD 600 è circa 0,2.
  7. Ruotare il tubo a 30 ° C per 5 ore per portare le cellule alla fase log (OD 600 di ~ 1).
  8. Seguire i passi (1.24) - (1.38) per le sporulare diploidi e isolare spore.
  9. Suddividere la sospensione di cellule in due sporigeni 300-plparti e mettere ciascuno in un separato da 1,5 ml provetta Eppendorf.
  10. Centrifugare le provette a 800 xg per 5 min. Eliminare il surnatante.
  11. Per il pellet di un tubo, aggiungere 100 ml di SC-Il suo mezzo per selezionare una-aploidi. Al pellet di altro tubo, aggiungere 100 microlitri di SC-Leu medie per selezionare α-aploidi.
  12. Ruotare le provette a 30 ° C per una notte. Il finale OD 600 deve essere inferiore a 0,5. Se OD 600 tende ad essere troppo alto, prova a coltura a temperatura ambiente.
  13. Per indurre GFP, aggiungere 100 microlitri di fresco SC-His (a) o SC-Leu (α) contenente 20 mg / ml di doxiciclina. La concentrazione finale di doxiciclina è di 10 mcg / ml. Vortex.
  14. Ruotare le provette a 30 ° C per 2 giorni.

3. Citometria a Flusso

  1. Aggiungere 900 pl di prefiltrata tampone TE (pH 7,5) contenente 10 ug / ml di doxiciclina al 5 ml provetta di polipropilene (BD Falcon # 352.063) con il tappo scambiato con un cellularetappo filtro da 5 ml in polistirene (BD Falcon # 352235). Tubi in polipropilene sono adatti per citometria a flusso. Il tappo filtro è desiderato per rimuovere le particelle più grandi.
  2. Posizionare delicatamente 75 ml di tampone TE con doxiciclina sulla cellula-filtro cap.
  3. Aggiungere 25 ml di cellule indotte alla soluzione sul tappo.
  4. Mentre si preme la punta della Pipetman contro la maglia, spara tutta la soluzione combinata attraverso il filtro.
  5. Premere verso il basso il coperchio filtro e il tubo di vortice.
  6. Preparare le provette di raccolta (1,6 ml provette Eppendorf) riempiti con 200 ml di SC-His o SC-Leu.
  7. Avviare il cell sorter e regolare le impostazioni in base al manuale del produttore.
  8. Vortex sia il tubo di raccolta (per rivestire la parete con il mezzo) e la provetta contenente le cellule prima di caricarle sul cell sorter.
  9. Acquisire dati citometria a flusso del campione. Un ceppo non contenenti GFP può essere un controllo negativo.
  10. Disegna cancelli per l'ordinamento. (A)Per evitare di aggregati di cellule, che potrebbero presentano alta intensità GFP, eliminare valori anomali con larghezza di impulso sproporzionatamente grande per forward scatter (FSC) con un terreno di larghezza di impulso e l'altezza di impulso per MoFlo sorter o sproporzionatamente piccola altezza FSC usando un diagramma di altezza FSC e FSC area per FACSAria sorter (Figura 5, in alto a sinistra del pannello). (B) dal grande FSC (area) è previsto per aggregati di cellule, soltanto in cellule inferiore al 20% in FSC, evitando regioni con il minor dispersione FSC e laterale (SSC) valori dove detriti cellulari è spesso trovato (figura 5, in alto a destra del pannello). (C) SSC (area) e GFP segnale (area) sono spesso correlati positivamente. Perché semplicemente tenendo brillanti cellule indicate le porte sopra avrebbe anche arricchito di cellule con un alto valore SSC, disegnare un cancello lungo la periferia della popolazione usando un diagramma dell'intensità GFP e SSC a prendere una percentuale simile di brillanti cellule da ciascun punto dell'asse SSC (Figura 5, bottom-sinistra lo schema). La popolazione selezionata in (C) dovrebbe essere 0,1-1% della popolazione selezionata in (B).
  11. Ordina 200 cellule nel tubo di raccolta tenuto conto dei criteri di cui (3.10). Per un processo in massa o per altri progetti richiedono una popolazione più complesso, ordinare altre cellule come necessario.
  12. Vortex il tubo di raccolta per coprire le celle filtrate con terreno.
  13. Piastra un sottogruppo di cellule (per esempio, 50 celle) su una piastra YPDA per la genotipizzazione.
  14. Incubare la piastra a 30 ° C per 2 giorni.
  15. Fai un lisato per ~ 12 colonie seguendo la procedura (1.5) - (1.8).
  16. Trasferire le cellule residue sulla punta utilizzata in (1.5) in un posto su un piatto contenente YPDA G418 e Nat toccando delicatamente la piastra con la punta. Aploidi selezionati non dovrebbero crescere su questa piastra. Diploidi può avere copie GFP più e possono quindi essere più luminoso. Questo test può mostrare l'efficienza della selezione aploide.
  17. Per la genotipizzazione, analisi 1 ml del lisato con 10 microlitri PCR reaction con un primer forward che si appaia alla regione fiancheggiante monte di ogni gene soppresso accoppiato con un primer del CCTGAGAAAGCAACCTGACC sequenza.
    Multiplex PCR reazioni, se possibile (condizioni può essere determinata utilizzando lisati di singoli mutanti). PCR può essere fatto in un 96 - o 384 pozzetti. Quest'ultimo formato è adatto per il volume di reazione di soli 5 microlitri. Formare gli array di PCR Master Mix differenti in primers e aggiunta di lisati cellulari di queste miscele possono essere effettuati utilizzando pipetta multicanale o un robot di manipolazione dei liquidi. Suggerimento cambiamenti sono facoltativi quando si aggiunge il lisato stesso a diverse miscele di PCR.
  18. Analizzare prodotti di PCR. Il Gel XL sistema Ultra V-2 elettroforesi (Labnet) è compatibile con il caricamento del campione utilizzando pipette multicanale.
  19. Sulla base di informazioni da (3.16) e (3.18), identificare aploidi probabile che hanno voluto genotipi.
  20. Stabilire questi ceppi su un piatto fresco (YPDA, CAA-Ura, o SC-Ura-His/Leu). Inoltre, li congelare in25% glicerolo a -80 ° C. Test aggiuntivi come conferma l'assenza di sequenze wild-type per geni eliminati e pulsed-field gel elettroforesi sono raccomandati.
  21. Ripetere ciclismo sessuale da (2.1) con ceppi utili.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Quando un ceppo aploide portare quattro eliminazioni GFP segnalati (ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) è stata incrociata con un α-ceppo aploide portare quattro eliminazioni (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ), con due eliminazioni (ycl033cΔ yer042wΔ) condiviso da due ceppi, da un rappresentante risultato è stato ottenuto. La miscela di accoppiamento è stato coltivato in terreno contenente YPDA G418 e Nat per selezionare diploidi. Le diploidi risultanti sono state coltivate in mezzo di sporulazione. Le spore sono stati dispersi dal trattamento zymolyase e sonicazione, e germogliato nei mezzi di selezione aploidi. Le cellule sono poi indotti ad esprimere GFP. Utilizzando cancelli con un citofluorimetro, una popolazione di cellule è stato selezionato che è improbabile che contiene aggregati detriti o cella (Figura 5). In questa popolazione, più luminoso l'1% delle cellule sono stati ordinati. Cellule separate e le cellule sono state sottoposte a cernita genotipodigitato dopo hanno formato colonie su una piastra. Quando le colonie sono stati scelti a caso strisciate su un piatto contenente YPDA G418 e Nat, le cellule da 2 su 16 colonie è cresciuta per il campione non ordinato, e le cellule da 18 su 26 colonie sono cresciuti per il campione ordinato, suggerendo che alcuni diploidi acquisito la capacità esprimere un marcatore di selezione aploide e propagate durante le fasi di selezione e aploide-GFP-induzione in questo esperimento. Diploidi sono stati ulteriormente arricchita nel campione ordinati presumibilmente a causa del maggior numero di copie che contenevano GFP. Quando aploidi sono stati analizzati con PCR, il numero medio di delezioni nelle cellule filtrate era di 5,1 ± 0,4 (n = 8; SEM mostrato). Quattro di queste cellule aveva sei eliminazioni, il numero massimo possibile di eliminazioni per questa croce. Aploidi del campione non ordinato aveva 3,4 ± 0,2 delezioni in media (n = 14).

In un esperimento separato, un a-aploide ceppo trasportava sette GFP-marcate delezioni (yer042wΔ yer108cΔ yfr057wΔ ykl069wΔ ykr011cΔ ylr123cΔ yol118cΔ) è stata incrociata con un α-ceppo aploide trasporto otto eliminazioni (ycl033cΔ ydl227cΔ ydl242wΔ yer042wΔ yer108cΔ yfr057wΔ ygl109wΔ ykr011cΔ), con quattro eliminazioni comuni (yer042wΔ yer108cΔ yfr057wΔ ykr011cΔ) contenute nei due ceppi. Quando diploidi sono stati selezionati e successivamente coltivate in terreno di sporulazione, circa il 20% delle cellule sporigeni basata sull'osservazione microscopica (n> 100). Dopo che le spore sono stati dispersi e germinati, i aploidi risultanti sono stati indotti a esprimere GFP e ordinati in base fluorescenza come sopra. Solo uno di 61 celle selezionate casualmente cresciuto su un piatto YPDA contenente G418 e Nat, suggerendo che le cellule sono state filtrate prevalentemente aploide. Se analizzato con PCR (Figura 6), le cellule filtrate avuto il numero medio di 8,8 ± soppressione0,3 (n = 12; mostrata SEM), di cui cinque celle contenenti dieci delezioni. Il numero atteso di eliminazioni per una cella non ordinata risultante dalla segregazione casuale è stato 7.5.

Figura 1
Figura 1. Mostri verdi sotto il microscopio a fluorescenza. Micrografie mostrano un non-mutante ceppo (a sinistra), un ceppo ProMonster (al centro), e un 16-GFP ceppo mostro (a destra). Identico l'esposizione, la luminosità e le impostazioni di contrasto sono stati utilizzati per le immagini.

Figura 2
Figura 2. Lo schema del processo di Green Monster. Singolo mutante aploidi (luce verde) sono abbinati. Ricombinazione meiotica durante la sporulazione dei diploidi accoppiate genera una miscela di 0-GFP cellule (bianco sporco), 1-cellule GFP (verde chiaro), e 2-GFP cellule (verde scuro). Flussocitometria viene usato per selezionare le celle verdi arricchite per le 2-GFP cellule. Integrati strumenti molecolari permettono la selezione di a-aploidi (+) I suoi, α-aploidi (Leu +) e diploidi (G418-e Nat-resistenza). Questo ciclo si ripete per arricchire per i ceppi recanti un numero sempre crescente di alterazioni.

Figura 3
Figura 3. Cassette cancellazione GFP e GMToolkits. Cassette di delezione GFP contengono un gene reporter GFP e un indicatore di trasformazione lievito (URA3). Il tetO 2 promotore è inducibile con l'aggiunta di doxiciclina al terreno tramite l'azione del fattore di trascrizione rtTA. Se il livello di GFP raggiunge la massima capacità delle cellule di rendere la proteina o di tollerare alcun effetto tossico da esso, l'espressione può essere composto dal abbassando la concentrazione doxiciclina (notare tuttavia che abbiamo fatto non osservare saturazione tale o effetti di tossicità anche con 16 copie di GFP). La cassetta può essere mirata a qualsiasi gene o regione collegando specifiche sequenze omologhe con PCR. In alternativa, l'universale cassetta cancellazione GFP con identiche sequenze omologhe può essere convenientemente mirate a 'di atterraggio "KanMX4 nei ceppi della collezione knockout lievito. YFG indica il gene preferito. Box con linee verticali indica codice a barre del DNA. GMToolkits sono integrati nel locus CAN1. Il STE2-his5 marcatore e il STE3-LEU2 marcatore sono espressi in modo specifico tipo di accoppiamento in aploidi per consentire solo a-aploidi a crescere in assenza di istidina e solo α-aploidi di crescere in assenza di leucina, rispettivamente. Selezionando per la resistenza a G418 e Nat seleziona simultaneamente per il locus KanMX4 in uno GMToolkit e NatMX4 locus nell'altra e seleziona così per diploidi.

_content "fo: keep-together.within-page =" always "> Figura 4
Figura 4. Confermando la corretta integrazione della cassetta GFP. Una cassetta GFP universale può essere utilizzato per convertire qualsiasi KanMX4-marcato delezione disponibile nella raccolta delezione lievito ad una GFP-marcato delezione. Con un allele GFP correttamente generato delezione, reazione di PCR con un primer forward che ricombina con la regione fiancheggiante monte accoppiato con un primer reverse che ricombina all'inizio della cassetta (PCR Fase A di 1,9) dovrebbe fare una band. PCR con un primer reverse che ricombina con la regione fiancheggiante a valle accoppiato con un primer forward che ricombina alla fine della cassetta (PCR B) dovrebbe fare un prodotto. PCR con due primer che annealing all'interno della cassetta KanMX4 (PCR C) o con due primer che annealing alla sequenza wild-type del gene mirata (PCR D) non dovrebbe produrre una band. Freccia rossa indica un primer PCR. BracKET mostra una regione amplificata con una reazione di PCR. Box indica la cassetta GFP (verde), il KanMX4 cassetta (giallo), o il gene preferito (YFG, grigio). La linea nera indica una sequenza di accompagnamento in un cromosoma di lievito.

Figura 5
Figura 5. Citometria a flusso. In questo esperimento progenie, aploide da un incrocio di due ceppi, uno con il genotipo ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ e l'altra con il genotipo ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ sono stati indotti ad esprimere GFP. Ogni delezione del gene aveva una cassetta GFP. Da parte delle cellule gating sulla base della superficie scatter in avanti e l'altezza forward scatter (P1), aggregati di cellule (che tendono ad avere sproporzionatamente grande zona scatter in avanti sono stati esclusi. Dalle cellule gating sulla base di scatter scatter in avanti e laterale (P2), ceLLS in basso è il 20% di dispersione in avanti sono stati accettati, escludendo detriti con il più basso scatter scatter in avanti e laterale. Dalle cellule gating sulla base di dispersione laterale e segnale GFP (P3), le cellule più fluorescenti tra quelle in un intervallo dato lato scatter state prese. Per consentire il confronto del mix meiotica e il campione di controllo negativo che non esprimono GFP, un cancello identico a quello utilizzato per selezionare la popolazione P3 è illustrato in un diagramma simile per le cellule selezionate del controllo negativo.

Figura 6
Figura 6. Genotipizzazione dei ceppi filtrate. PCR è stata eseguita utilizzando un primer reverse che ricombina con la regione fiancheggiante a valle accoppiato con un primer forward che ricombina alla fine della cassetta. La presenza della banda indica la presenza della cassetta GFP. Un esperimento separato ha mostrato che tutti i ceppi con dodicimantenere la cancellazione yer042w Δ e l'eliminazione ykr011c Δ.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Come abbiamo sviluppato l'approccio verde mostro, eravamo preoccupati con la possibilità di ricombinazione tra i diversi cassetti di ricambio GFP, con conseguente riarrangiamento del genoma. Attenuare contro questa possibilità è la selezione per le cellule che hanno superato con successo a vari cicli di accoppiamento e meiosi. Cellule recanti genomi riarrangiati dovrebbero essere meno misura dopo l'accoppiamento di cellule senza un riarrangiamento identica. In effetti, non abbiamo osservato alcuna instabilità del genoma risultante dalla ricombinazione tra le cassette GFP 11. Tuttavia, non si può del tutto escludere questa possibilità, per cui si consiglia agli utenti di testare le tensioni generate per riarrangiamento. Campo pulsato elettroforesi su gel può essere usato per rilevare grave anomalia. PCR con primers ricottura a sequenze all'interno della soppressione può essere utilizzata per confermare l'assenza di sequenze wild-type.

Sulla base dei livelli di fluorescenza di ceppi stabiliti, GFIntensità P aveva un rapporto quasi lineare con il numero di delezioni, suggerendo che la saturazione non è un problema nella gamma testata di uno a 16 delezioni 11. Tuttavia, anche in fasi successive, con ceppi con molte delezioni non si sovrappongono, siamo stati in grado di aumentare solo il numero medio di delezioni nella popolazione di circa il due per ogni turno, mentre teoricamente una cellula che porta l'unione di tutte le cancellazioni nei due genitori ceppi possono essere combinati in una sola volta se stringenza perfetto per la selezione GFP sono stati raggiunti. Un limite è la cellula-cellula variazione di intensità tra cellule GFP isogeniche. Nel secondo esempio di Rappresentante dei risultati, solo lo 0,8% delle cellule nella popolazione ci si aspetterebbe di avere tutti i 11 delezioni che erano possibili in questa croce (quattro dei 11 delezioni sono state condivise da entrambi i genitori aploidi). Tuttavia, i più abbondanti dieci ceppi di delezione avrà una distribuzione di intensità GFP che si sovrappone quella del 11-stra delezioneins. Pertanto, una porzione ancora più piccola della popolazione deve essere selezionata per selezionare preferenzialmente 11-delezione ceppi dalla coda superiore della distribuzione di intensità del 11-GFP ceppi di delezione. Una soluzione potrebbe essere quella di aumentare semplicemente la soglia per ordinare più rare cellule GFP con intensità maggiore. Un'altra soluzione potrebbe essere quella di misurare simultaneamente uno standard interno, un reporter proteina fluorescente di colore diverso che è presente in una singola copia, espressa tramite lo stesso promotore tetO 2. Questa strategia ci si aspetterebbe di cancellare il rumore estrinseco per ridurre la cellula-cellula variazione delle misurazioni GFP così normalizzati intensità 16,17.

La difficoltà di ottenere rari multi-mutanti può essere aggravato dal tasso di crescita potenziale lento di questi ceppi. Multi-mutanti sono arricchiti in citometria a flusso, ma possono essere outcompeted durante il resto del processo fratelli montatore. Per ridurre al minimo il numero di generazioniceppi di lievito sottoposti, si consiglia di piccoli volumi di coltura che forniscono amplificazione appena sufficiente di cellule del ploidia desiderato selezionati a ogni passo.

Poiché delezioni multiple possono essere acquisite per ciclo, il metodo Monster verde può essere utilizzato per assemblare multi-mutanti più rapidamente dei metodi sequenziali 11. Se specifici sottoinsiemi di delezioni hanno sintetiche relazioni letali, 'morto estremità' si possono incontrare con approcci sequenziali. Questa limitazione può essere aggirata con l'approccio Green Monster, che i campioni dallo spazio dei possibili percorsi verso accumulare l'intera serie di eliminazioni. Più parallelo en versione in massa del processo Green Monster dovrebbe rivelarsi utile nella ricerca di un percorso per raggiungere il maggior numero tollerabile di eliminazioni.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Nessun conflitto di interessi dichiarati.

Acknowledgments

Questo lavoro è stato sostenuto dal contratto US Research Projects Agency Defense N66001-12-C-4039 a YS, un finanziamento della Alfred P. Sloan Foundation per RSL, e US National Institutes of concede Salute HG003224 R01 e R21 CA130266 a FPRFPR era supportato anche da una borsa di studio presso l'Istituto canadese per la ricerca avanzata e per l'eccellenza di ricerca del Canada programma di sedie.

Materials

Name Company Catalog Number Comments
G418 Sigma-Aldrich A1720 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 200 mg/ml. Store at 4 °C.
ClonNAT (nourseothricin) WERNER BioAgents 5001000 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 100 mg/ml. Store at 4 °C.
Doxycycline Sigma-Aldrich D9891 Dissolve in 50% ethanol and filter-sterilize (0.2-μm filter). Stock concentration: 10 mg/ml. Make fresh every four weeks. Shield from light using aluminum foil and store at 4 °C.
Zymolyase ZymoResearch E1005
Difco yeast nitrogen base w/o amino acids BD 291940
Revolver (rotator for tubes) Labnet H5600
Enduro Gel XL electrophoresis unit Labnet E0160
Sonifier 450 Branson 101-063-198
Microtip for Sonifier 450 Branson 101-148-062
FACSAria cell sorter BD
MoFlo cell sorter Beckman-Coulter
Biomek FX or equivalent robot Beckman Coulter Optional. For setting up genotyping PCRs.

DOWNLOAD MATERIALS LIST

References

  1. Tong, A. H., et al. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science's STKE. 294, 2364-23 (2001).
  2. Hillenmeyer, M. E., et al. The chemical genomic portrait of yeast: uncovering a phenotype for all genes. Science. 320, 362-365 (2008).
  3. Beh, C. T., Cool, L., Phillips, J., Rine, J. Overlapping functions of the yeast oxysterol-binding protein homologues. Genetics. 157, 1117 (2001).
  4. Wieczorke, R., et al. Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae. FEBS letters. 464, 123-128 (1999).
  5. Alani, E., Cao, L., Kleckner, N. A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics. 116, 541-545 (1987).
  6. Akada, R., et al. PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae. Yeast. 23, 399-405 (2006).
  7. Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic acids research. 24, 2519 (1996).
  8. Delneri, D., et al. Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system. Gene. 252, 127-135 (2000).
  9. Storici, F., Lewis, L. K., Resnick, M. A. In vivo site-directed mutagenesis using oligonucleotides. Nat. Biotech. 19, 773-776 (2001).
  10. Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast. Nucl. Acids Res. 38, 2570-2576 (2010).
  11. Suzuki, Y., et al. Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection. Nat. Methods. 8, 159-164 (2011).
  12. Winzeler, E. A. Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis. Science. 285, 901-906 (1999).
  13. Woods, R. A., Gietz, R. D. High-efficiency transformation of plasmid DNA into yeast. Methods Mol. Biol. 177, 85-97 (2001).
  14. Hughes, T. R., et al. Widespread aneuploidy revealed by DNA microarray expression profiling. Nature. 25, 333-337 (2000).
  15. Goldstein, A. L., McCusker, J. H. Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast. 15, 1541-1553 (1999).
  16. Newman, J. R. S., et al. Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise. Nature. 441, 840-846 (2006).
  17. Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. Gene regulation at the single-cell level. Science. 307, 1962 (2005).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics