Le processus de monstre vert pour la génération de souches de levure portant la délétion de gènes multiples

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

La méthode de Green Monster permet l'assemblage rapide de suppressions multiples marqués d'un gène rapporteur codant pour la protéine fluorescente verte. Cette méthode est basée sur la conduite des souches de levures par des cycles répétés de l'assortiment sexuelle des suppressions et basée sur la fluorescence d'enrichissement de cellules portant des délétions plus.

Cite this Article

Copy Citation | Download Citations

Suzuki, Y., Stam, J., Novotny, M., Yachie, N., Lasken, R. S., Roth, F. P. The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions. J. Vis. Exp. (70), e4072, doi:10.3791/4072 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Phénotypes pour une délétion du gène sont souvent révélée que lorsque la mutation est testé dans un fond génétique particulier ou 1,2 état ​​de l'environnement. Il ya des exemples où de nombreux gènes doivent être supprimés pour démasquer les fonctions des gènes cachés 3,4. Malgré le potentiel de découvertes importantes, les interactions génétiques impliquant trois ou plusieurs gènes sont en grande partie inexploré. Une recherche exhaustive de plusieurs mutants interactions serait impossible, en raison de la multiplicité des combinaisons possibles de suppressions. Cependant, les études d'ensembles sélectionnés de gènes, tels que les jeux de paralogues avec une plus grande chance de partager priori une fonction commune, serait instructive.

Dans la levure Saccharomyces cerevisiae, inactivation du gène est réalisée par le remplacement d'un gène d'un marqueur de sélection par recombinaison homologue. Parce que le nombre de marqueurs est limitée, des méthodes ont été développées pour enlever et réutiliser le sam marqueur e 5,6,7,8,9,10. Cependant, les mutations d'ingénierie séquentielle multiples en utilisant ces méthodes est temps parce que le temps nécessaire échelles linéairement avec le nombre de suppressions d'être généré.

Ici, nous décrivons la méthode de Green Monster régulièrement ingénierie suppressions multiples dans la levure 11. Dans cette méthode, une protéine fluorescente verte (GFP) journaliste intégré suppressions est utilisé pour les souches d'étiquette quantitativement en fonction du nombre de suppressions contenues dans chaque souche (figure 1). Cycles répétés de gamme de la GFP marqués par des suppressions conjugaison de la levure et de la méiose couplé avec cytométrie de flux enrichissement de souches transportant plus de ces suppressions conduire à l'accumulation de délétions dans des souches (figure 2). Effectuer des traitements multiples en parallèle, chaque processus comprenant une ou plusieurs délétions par tour, réduit le temps nécessaire pour la construction de la souche.

contenu "> La première étape consiste à préparer haploïdes simples mutants appelé« ProMonsters, «dont chacun porte un rapporteur GFP dans un locus supprimé et l'un des« boîte à outils »loci-soit-GMToolkit un monstre vert ou GMToolkit-α à l' . can1Δ locus (figure 3) En utilisant des souches de la collection suppression de levure 12, GFP-marqués délétions peuvent être facilement généré par le remplacement de la cassette de kanMX4 commun qui sont dans ces souches avec une GFP universel - URA3 fragment Chaque GMToolkit contient:. supporte la une - ou α-accouplement du type spécifique de marqueur de sélection haploïde 1 et exactement un des deux marqueurs qui, lorsque les deux sont présents GMToolkits, collectivement permettent la sélection des diploïdes.

La deuxième étape consiste à effectuer le cycle sexuel par lequel locus d'effacement peuvent être combinés dans une seule cellule par l'assortiment aléatoire et / ou recombinaison génétiques méiotiquemination qui accompagne chaque cycle de l'accouplement et de la sporulation.

Protocol

1. Génération de ProMonsters

  1. Préparer la cassette GFP universelle de remplacement en amplifiant un tetO 2-GFP marqueur et le marqueur URA3 du plasmide pYOGM012 (résistance à l'ampicilline) en utilisant des amorces de séquences:
    GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCC CAAGCTCCTCGAGTAATTCG et GGCGTTAGTATCGAATCGACAGCAGTATAGCGACCAGCATTCAC GTACCGGGTAATAACTGATATAAT (régions en gras fournir une homologie avec les régions adjacentes de la cassette kanMX4 permettant un remplacement ciblé). La réaction de PCR doit être effectuée avec la polymérase Phusion, tampon HF, et 3% de diméthylsulfoxyde (New England Biolabs) à partir de la concentration d'ADN matrice de 0,5 ng / ul. Le programme de PCR est de 98 ° C pendant 30 s et 35 cycles de 98 ° C pendant 10 sec, 49 ° C pendant 30 sec, et 72 ° C pendant 1,5 min. Le volume de réaction doit être> 50 pl de fournir suffisamment d'ADN pour chaque expérience de transformation. Nous purifionsle produit en utilisant un kit de purification de PCR QIAquick (Qiagen) avec ~ 50 pl de la réaction de PCR traités par colonne, mais en sautant l'étape de purification peut augmenter le rendement des transformants.
    En variante, libérer un fragment contenant le tetO 2-GFP et URA3 marqueurs, ainsi que les régions homologues de kanMX4 ciblage, par digestion du plasmide pYOGM057 (résistance à l'ampicilline) en utilisant l'enzyme de restriction EcoRI (New England Biolabs). La concentration d'ADN dans cette réaction devrait être ~ 30 ng / ul. Le volume de réaction doit être> 34 pl.
    Pour l'intégration de la cassette de GFP dans une région autre que kanMX4, ajuster la région d'homologie des amorces de PCR ci-dessus pour les séquences homologues appropriés.
  2. Transformer une souche haploïde un de la collection KO levure kanMX4 12 avec la cassette de délétion GFP universelle. En suivant le protocole par Woods et Gietz 13 0,34 ul de laÉchantillon d'ADN (PCR purifié produit ou non purifiée digestion de restriction) doit être utilisé pour chaque expérience de transformation. Plaque cinquième du mélange de transformation sur une plaque de CAA-Ura (0,67% de base azotée de levure, glucose 2%, 0,6% d'acide Casamino, 0,0025% hémisulfate adénine, tryptophane 0,005%, et 2% de gélose).
  3. Streak les transformants sur une nouvelle CAA-Ura plaque pour obtenir des colonies isolées.
  4. Transfert des cellules d'une colonie sur une plaque de YPDA contenant 200 ug / ml de G418 pour confirmer l'absence de croissance. Pour confirmer l'intégration réussie GFP, suivez les étapes (1,5) - (1,9) pour effectuer une PCR sur colonie.
  5. Ajouter de cellules prélevées sur une colonie dans 2 pl de tampon de lyse (0,1 M phosphate de sodium, pH 7,4, 1 zymolyase unité de ZymoResearch) dans un tube de 0,2 ml PCR ou un puits d'une plaque de 96 puits. Mélanger par pipetage dans la solution et sur une pointe de pipette.
  6. Superposition avec une goutte (environ 20 pi) d'une huile minérale à l'aide d'un Pipetman P200 (Gilson).
  7. Incuber le mélange à 37 °C pendant 20 min, puis à 95 ° C pendant 10 min.
  8. Diluer le lysat avec 50 pi d'eau. Mélanger à la pipette la solution et sortir dix fois.
  9. Analyser 1 pl du lysat en utilisant 10-yl réactions PCR avec (A) une amorce sens qui s'hybride à la région flanquante en amont associé à une amorce de la séquence CCTGAGAAAGCAACCTGACC (285 pb à partir du début de la cassette), (B) une marche arrière amorce qui s'hybride à la région en aval associé à une amorce de la séquence GCATTGGGTCAACAGTATAG (375 pb de la fin), (C) deux amorces qui s'hybrident à des séquences de kanMX4 CGTACTCCTGATGATGCATG et GACGAAATACGCGATCGCTG (181 pb), et (D) deux amorces qui recuit de la séquence de type sauvage du gène ciblé (Figure 4). (D) est important car environ 8% des souches dans les collections de suppression sont connus pour contenir aneuploïdie 14. Transformant correct doit être positive avec (A) et (B), et négative avec (C) et (D).
  10. Pour mettre en place unGMToolkit en le transformant, ajouter environ 250.000 cellules de la souche transformée et 250.000 cellules de chacune des RY0146 (contenant GMToolkit-a) ou RY0148 (contenant GMToolkit-α) dans un tube Eppendorf 1,6-ml. Vortex. Les génotypes des RY0146 RY0148 et sont MATa lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-a [CMVpr-rtTA kanMX4 STE2pr-Sp-His5] et MATa lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-α [CMVpr-rtTA NatMX4 STE3pr- LEU2], respectivement. pr désigne promoteur. Le nombre de cellules doit être estimée à partir de la densité optique de la culture précédente.
  11. Centrifuger à 800 xg pendant 2 min.
  12. Enlever le surnageant.
  13. Afin de permettre l'échange d'air, faire un trou sur le couvercle à l'aide d'une punaise traitée avec de l'éthanol à 70%.
  14. Ajouter 50 ul de YPDA moyenne (1% extrait de levure, peptone à 2%, 2% de glucose et 0,003% hemisulfat adéninee). Vortex.
  15. Centrifuger à 800 xg pendant 5 min.
  16. Placer le tube dans une boîte humide. Ceci peut être réalisé avec une boîte vide pointe, un stand petite astuce, et une serviette en papier humide.
  17. Incuber la boîte de nuit à 30 ° C.
  18. Sélectionnez diploïdes accouplées en commençant par stries sur les cellules sur une plaque de CAA-Ura. Incuber la plaque à 30 ° C pendant une journée.
  19. Prélever des cellules de la zone, les stries en vrac sur de faire des colonies isolées sur des plaques YPDA (1% extrait de levure, peptone à 2%, glucose 2%, 0,003% hémisulfate adénine et agar à 2%) contenant 200 ug / ml de G418 pour la sélection des diploïdes contenant GMToolkit-a ou 100 pg / ml nourséothricine (Nat) 15 pour la sélection des diploïdes contenant GMToolkit-α.
  20. Incuber la plaque à 30 ° C pendant 3 jours.
  21. A partir d'une colonie isolée, transférer la plupart des cellules à 500 pi de milieu GNA sans agar (1% extrait de levure, 3% Difco bouillon nutritif, et 5% de glucose, glucose autoclave et le reste du til composants séparément × 2 solutions pour éviter la caramélisation) dans un tube de culture de 5 ml avec le couvercle desserré.
  22. Tourner le tube horizontalement pendant cinq heures à 30 ° C. L'axe de la rotation doit être parallèle à l'axe longitudinal du tube.
  23. Confirmer que les colonies utilisées dans (1.21) sont Ura + par les stries sur une plaque de CAA-Ura.
  24. Centrifuger le tube à 800 xg pendant 2 min. Jeter le surnageant.
  25. Ajouter 500 ul de milieu de sporulation minime (1% d'acétate de potassium, l'acétate de zinc à 0,005%; filtre à stériliser). Vortex.
  26. Centrifuger le tube à 800 xg pendant 2 min. Jeter le surnageant.
  27. Répétition (1,25) - (1,26) deux fois.
  28. Ajouter 1 ml de milieu de sporulation minimal supplémenté avec 7,5 ug / ml de lysine, 7,5 mg / ml de leucine, 5 pg / ml d'histidine, 5 ug / ml de méthionine et 1,25 pg / ml d'uracile (pour améliorer le taux de sporulation des souches auxotrophes) . Vortex.
  29. Tourner le tube à température ambiante pendant un jour.
  30. Tourner le tube à 30 ° C pendant 2 jours.
  31. Centrifuger 125 ul de ce mélange dans un tube de 1,6 ml Eppendorf à 800 xg pendant 2 min. Jeter le surnageant.
  32. Ajouter 50 ul de solution zymolyase (100 mM de tampon phosphate de sodium, pH 7,4, 1 M de sorbitol, et 2 unités de zymolyase ZymoResearch). Mélanger par pipetage dans la solution et sur une pointe de pipette.
  33. Incuber à 30 ° C pendant 1 heure.
  34. Ajouter 50 ul de 0,02% de NP-40. Mélanger par pipetage dans la solution et sur une pointe de pipette.
  35. Laisser le tube à température ambiante pendant cinq minutes.
  36. Ajouter 500 ul d'eau.
  37. Placer le tube sur la glace.
  38. Soniquer ce mélange deux fois avec le réglage de sortie de 1 (faible réglage) pendant 15 secondes en utilisant une microsonde 3,2 mm avec Sonifier 450 (Branson). Entre les deux tours de sonication, mettre le tube sur la glace pour ramener la température à 0 ° C ~
  39. Centrifuger les tubes à 800 xg pendant 5 min. Jeter le surnageant.
  40. Ajouter 200 ul de SC-Ura-His(A) ou SC-Ura-Leu (α) moyenne, selon que la croix est d'incorporer un ou GMToolkit-GMToolkit-α. À préparer le support, SC-Ura-His-Leu moyen (0,67% de base azotée de levure, glucose 2%, arginine 0,01%, 0,01% d'acide aspartique, acide glutamique 0,01%, isoleucine 0,01%, 0,01% de lysine, méthionine 0,01% , 0,01% phénylalanine, la sérine 0,08%, thréonine 0,04%, tyrosine 0,002%, valine 0,03%, 0,0025% adénine, tryptophane 0,005%, 0,003% adénine, et 0,005% de tryptophane) et le compléter par l'histidine ou la leucine stérile avant utilisation à l' concentration finale de 0,01%.
  41. Faire un trou sur le couvercle à l'aide d'une épingle traitée avec de l'éthanol 70%.
  42. Tourner le tube horizontalement à 30 ° C pendant 2 jours. L'axe de la rotation doit être parallèle à l'axe longitudinal du tube.
  43. Série sur les cellules sur une plaque de gélose SC-Ura-His ou SC-Ura-Leu (les mêmes ingrédients que ci-dessus, plus 2% d'agar, l'acide aspartique et la thréonine doit être ajouté après unutoclaving, ajouter l'histidine ou la leucine avant de couler) pour faire des colonies isolées des souches ProMonster.

2. Cyclisme sexuelle

  1. Faire pivoter une culture d'une souche de deletion GFP établie dans 100 pi de SC-His (a) ou SC-Leu (α) en fonction du type de couplage à 30 ° C pendant la nuit en utilisant un tube de 1,6 ml Eppendorf. Pour l'échange d'air, faire un trou à l'aide d'une punaise traitée avec de l'éthanol à 70%. Tourner le tube horizontalement. L'axe de la rotation doit être parallèle à l'axe longitudinal du tube. Il est possible de traverser de multiples souches en masse via l'accouplement. Quand un échantillon trié est directement utilisé à cette fin, la culture des cellules dans 200 ul à 30 ° C pendant 2 jours. Pour préparer le milieu, ajouter uracile (concentration finale: 0,0025%) et l'histidine (0,01%) ou la leucine (0,01%) pour SC-Ura-His-Leu moyenne.
  2. Mélanger 250.000 par-cellules haploïdes et 250.000 α-haploïdes cellules souches de deletion de GFP dans un Eppe 1,6 mlTube ndorf. Vortex.
  3. Accoupler ces cellules par les étapes suivantes (1,11) - (1,17).
  4. Transférer 10 ul du mélange de l'accouplement à 500 moyen GNA ul contenant 200 ug / ml de G418 et 100 pg / ml Nat dans un tube de culture de 5 ml avec un couvercle desserré. Le point de départ DO 600 est à peu près 0,1.
  5. Tournez la culture à 30 ° C pendant 24 heures. Cela permet la sélection des diploïdes parce que les diploïdes contenant à la fois dans kanMX4 GMToolkit-a et NatMX4 dans GMToolkit-α peuvent se développer en présence de G418 et Nat (figure 3).
  6. Transférer 20 ul de la culture d'une journée à 500 pi de frais GNA contenant du G418 et Nat. Le point de départ DO 600 est à peu près 0,2.
  7. Faire tourner le tube à 30 ° C pendant 5 heures pour amener les cellules à la phase logarithmique (OD 600 de ~ 1).
  8. Suivez les étapes (1,24) - (1,38) à sporuler les diploïdes et isoler les spores.
  9. Fractionner la suspension de cellules sporulées dans deux 300-pipièces et mettre chacun dans une séparée de 1,5 ml tube Eppendorf.
  10. Centrifuger les tubes à 800 xg pendant 5 min. Jeter le surnageant.
  11. Pour le culot d'un tube, ajouter 100 ul de SC-Son moyen pour sélectionner un haploïdes-. Pour le culot de l'autre tube, ajouter 100 ul de SC-Leu moyen pour sélectionner α-haploïdes.
  12. Faire tourner les tubes à 30 ° C pendant une nuit. La finale DO 600 doit être inférieur à 0,5. Si DO 600 a tendance à être trop élevée, essayez de culture à température ambiante.
  13. Pour induire la GFP, ajouter 100 ul de frais SC-His (a) ou SC-Leu (α) contenant 20 ug / ml de doxycycline. La concentration finale de la doxycycline est de 10 pg / ml. Vortex.
  14. Faire tourner les tubes à 30 ° C pendant 2 jours.

3. Cytométrie en flux

  1. Ajouter 900 ul de pré-filtrée tampon TE (pH 7,5) contenant 10 pg / ml de doxycycline à un tube en polypropylène de 5 ml (BD Falcon # 352063) avec le bouchon remplacée par une cellulebouchon du filtre à partir d'un tube en polystyrène de 5 ml (BD Falcon n ° 352235). Des tubes en polypropylène sont adaptés pour la cytométrie en flux. Le bouchon du filtre est nécessaire pour éliminer les particules de grande taille.
  2. Placez délicatement 75 pl de tampon TE avec de la doxycycline sur le couvercle de la cellule-filtre.
  3. Ajouter 25 ul de cellules induites à la solution sur le bouchon.
  4. Tout en appuyant la pointe de Pipetman contre la maille, tirer l'ensemble de la solution combinée à travers le tamis.
  5. Appuyez sur le bouchon du filtre et le tube vortex.
  6. Préparer des tubes de prélèvement (1,6 ml tubes Eppendorf) remplis avec 200 pi de SC-His-Leu ou SC.
  7. Démarrez le trieur de cellules et ajuster les réglages selon le manuel du fabricant.
  8. Vortex fois le tube de prélèvement (pour enduire le mur avec le support) et le tube contenant des cellules avant de les charger sur le trieur de cellules.
  9. Acquérir des données de cytométrie en flux de l'échantillon. Une souche ne contenant pas de GFP peut être un témoin négatif.
  10. Dessinez portes pour le tri. (A)Pour éviter des agrégats de cellules, qui pourraient présenter intensité élevée GFP, jetez valeurs aberrantes avec largeur d'impulsion disproportionnée pour diffusion vers l'avant (FSC) en utilisant un terrain de largeur d'impulsion et la hauteur d'impulsion pour MoFlo trieuse ou disproportionnellement faible hauteur FSC par une parcelle de hauteur FSC et FSC zone pour FACSAria trieur (Figure 5, en haut à gauche du panneau). (B) Depuis grande FSC (région) est prévu pour les agrégats de cellules, les cellules ne prennent en bas à 20% en CFA, tout en évitant les régions ayant la plus faible dispersion FSC et latérale (SSC) où les valeurs débris cellulaires sont souvent trouvés (figure 5, en haut à droite du panneau). (C) SSC (surface) et GFP signal (région) sont souvent corrélées positivement. Parce que tout simplement en prenant les plus brillants cellules données les portes ci-dessus va également enrichir des cellules à haute valeur SSC, dessiner une porte le long de la périphérie de la population utilisant une parcelle de l'intensité de la GFP et de la SSC à prendre un pourcentage similaire de cellules les plus brillants de chaque point de l'axe de la SSC (figure 5, bottom-gauche diagramme). Dans la population sélectionnée (C) doit être 0.1-1% de la population sélectionnée dans (B).
  11. Trier 200 cellules dans le tube de prélèvement, compte tenu des critères dans (3.10). Pour un procédé en masse ou pour d'autres projets nécessitant une population plus complexe, trier plus de cellules que nécessaire.
  12. Vortexer le tube de prélèvement pour couvrir les cellules triées avec le milieu.
  13. Un sous-ensemble de plaque de cellules (par exemple, 50 cellules) sur une plaque de YPDA pour le génotypage.
  14. Incuber la plaque à 30 ° C pendant 2 jours.
  15. Faire un lysat pendant environ 12 colonies en suivant les étapes (1,5) - (1,8).
  16. Transférer les cellules résiduelles sur la pointe utilisée dans (1,5) à un endroit sur une plaque YPDA contenant du G418 et Nat doucement toucher la plaque avec la pointe. Haploïdes sélectionnés ne doivent pas se développer sur cette plaque. Diploïdes peuvent avoir des copies GFP plus et peut donc être plus claire. Ce test peut montrer l'efficacité de la sélection haploïde.
  17. Pour le génotypage, l'analyse 1 pl du lysat en utilisant un 10-ul PCR reaction avec une amorce sens qui s'hybride à la région flanquante en amont de chaque gène délété associé à une amorce de la séquence CCTGAGAAAGCAACCTGACC.
    Les réactions de PCR multiplex si possible (les conditions peuvent être déterminées en utilisant des lysats de mutants simples). La PCR peut être effectuée dans un 96 - ou 384 puits de format. Le format de celui-ci est adapté pour le volume de réaction de seulement 5 pl. Des rangées des PCR Master Mix dans différentes amorces et plus de lysats de cellules à ces mélanges peuvent être effectués à l'aide d'une pipette multi-canaux ou un robot de manipulation de liquide. Astuce changements sont facultatifs lors de l'ajout du lysat même à différents mélanges de PCR.
  18. Analyser les produits de PCR. Le Gel Ultra XL système V-2 électrophorèse (Labnet) est compatible avec le chargement des échantillons à l'aide de pipettes multicanaux.
  19. Sur la base des informations de (3,16) et (3,18), d'identifier les haploïdes probables qui ont voulu génotypes.
  20. Établir ces souches sur une plaque fraîche (YPDA, CAA-Ura, ou SC-Ura-His/Leu). En outre, les congeler dans25% de glycerol à -80 ° C. Des tests supplémentaires telles que la confirmation de l'absence de séquences de type sauvage des gènes supprimés et l'électrophorèse en champ pulsé sont recommandés.
  21. Répétez vélo sexuelle de (2.1) avec des souches utiles.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Quand une souche haploïde a-bord quatre suppressions GFP-marqués (ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) a été croisée avec une souche haploïde α-portant quatre suppressions (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ), avec deux délétions (ycl033cΔ yer042wΔ) partagée par deux souches, un représentant résultat a été obtenu. Le mélange accouplement a été cultivée dans un milieu contenant du G418 YPDA et Nat pour sélectionner diploïdes. Les diploïdes obtenus ont été cultivés dans le milieu de sporulation. Les spores sont dispersées par le traitement zymolyase et sonication et mises à germer dans un milieu de sélection haploïdes. Les cellules ont ensuite été amenés à exprimer la GFP. En utilisant des fenêtres avec un cytomètre en flux, une population de cellules a été sélectionnée n'est pas susceptible de contenir des agrégats de débris ou de la cellule (figure 5). Dans cette population, la plus brillante de 1% des cellules ont été triées. Les cellules triées et non triées cellules étaient génotapé après avoir formé des colonies sur une plaque. Lorsque les colonies choisies au hasard ont été étalées sur une plaque YPDA contenant du G418 et Nat, des cellules de 2 des 16 colonies a augmenté pour l'échantillon non triés et les cellules de 18 des 26 colonies ont grandi dans l'échantillon trié, ce qui suggère que certains diploïdes acquis la capacité à exprimer un marqueur de sélection haploïde et reproduits pendant les phases de sélection et d'haploïde-GFP-induction dans cette expérience. Diploïdes ont été enrichies dans l'échantillon trié probablement en raison de l'augmentation du nombre de copies GFP qu'ils contenaient. Lorsque haploïdes ont été analysés par PCR, le nombre moyen de suppressions dans les cellules triées était de 5,1 ± 0,4 (n = 8; SEM montré). Quatre de ces cellules avait six suppressions, le nombre maximum possible de suppressions pour cette croix. Haploïdes de l'échantillon non trié eu 3,4 ± 0,2 suppressions en moyenne (n = 14).

Dans une expérience séparée, une souche haploïde un transportant sept GFP-marqués suppressions (vousr042wΔ yer108cΔ yfr057wΔ ykl069wΔ ykr011cΔ ylr123cΔ yol118cΔ) a été croisée avec une souche haploïde α-transportant huit suppressions (ycl033cΔ ydl227cΔ ydl242wΔ yer042wΔ yer108cΔ yfr057wΔ ygl109wΔ ykr011cΔ), avec quatre suppressions communs (yer042wΔ yer108cΔ yfr057wΔ ykr011cΔ) contenues dans les deux souches. Lorsque diploïdes ont été sélectionnés et ensuite mises en culture en milieu de sporulation, environ 20% des cellules sporulées sur la base de l'observation microscopique (n> 100). Après les spores sont dispersées et ont germé, les haploïdes ainsi obtenus ont été induites à exprimer la GFP et triés sur la base de fluorescence comme ci-dessus. Un seul des 61 cellules choisies au hasard a grandi sur une plaque YPDA contenant du G418 et Nat, ce qui suggère que les cellules triées ont été principalement haploïdes. Lors de l'analyse par PCR (figure 6), les cellules triées avait le numéro suppression moyenne de 8,8 ±0,3 (n = 12; SEM représenté), y compris les cellules contenant cinq dix délétions. Le nombre prévu de suppressions pour une cellule non triés résultant de la ségrégation aléatoire était de 7,5.

Figure 1
Figure 1. Monstres verts sous le microscope à fluorescence. Micrographies montrent une souche non mutante (à gauche), une souche ProMonster (au milieu), et une souche monstre de 16 GFP (à droite). Exposition identique, la luminosité et de contraste ont été utilisés pour les images.

Figure 2
Figure 2. Le schéma du processus de monstre vert. Single-mutants haploïdes (vert clair) sont accouplés. Recombinaison méiotique lors de la sporulation des diploïdes accouplées génère un mélange de 0-cellules GFP (blanc cassé), 1-GFP cellules (vert clair), et 2-GFP cellules (vert foncé). Fluxcytométrie est utilisé pour sélectionner les cellules enrichies vertes pour les cellules 2-GFP. Intégrés des outils moléculaires permettant la sélection d'un haploïdes-(His +), α-haploïdes (leu +) et diploïdes (G418 et Nat-résistance). Ce cycle est répété pour enrichir les souches portant un nombre sans cesse croissant de modifications.

Figure 3
Figure 3. Cassettes suppression GFP et GMToolkits. Cassettes suppression GFP contient un gène rapporteur GFP et un marqueur de transformation de la levure (URA3). Le 2 tetO promoteur est inductible par l'addition de doxycycline dans le milieu par l'action du facteur de transcription rtTA. Si le niveau de la GFP atteint la capacité maximale des cellules pour fabriquer la protéine ou de tolérer un quelconque effet toxique de lui, l'expression peut être composé en abaissant la concentration de doxycycline (notez cependant que nous avons fait pas observé une telle saturation ou des effets toxiques même avec 16 copies de la GFP). Cette cassette peut être ciblée sur un gène ou une région en joignant spécifiques des séquences homologues en utilisant la PCR. Alternativement, la cassette GFP universelle avec suppression identiques séquences homologues peuvent être facilement orientée pour aires d'atterrissage »kanMX4 dans les souches de la collection KO levure. YFG indique votre gène favori. Box avec des lignes verticales indique codes à barres ADN. GMToolkits sont intégrés dans le locus CAN1. Le marqueur STE2-His5 et le marqueur LEU2-STE3 sont exprimés de façon spécifique à mating type haploïdes ne permettre qu'à un haploïdes-à croître en l'absence d'histidine et seulement α-haploïdes à croître en l'absence de leucine, respectivement. La sélection pour la résistance à G418 et Nat sélectionne simultanément pour le locus dans une kanMX4 GMToolkit et le locus NatMX4 à l'autre et sélectionne donc pour diploïdes.

_content "fo: keep-together.within pages =" always "> Figure 4
Figure 4. Confirmant la bonne intégration de la cassette GFP. Une cassette GFP universel peut être utilisé pour convertir toute suppression kanMX4 marquée disponibles dans la collection suppression de levure à une délétion GFP marquée. Avec un allèle suppression GFP correctement générée, la réaction de PCR avec une amorce sens qui s'hybride à la région flanquante en amont associé à une amorce anti-sens qui s'hybride au début de la cassette (PCR A de l'étape 1,9) doit faire une bande. PCR avec une amorce anti-sens qui s'hybride à la région flanquante en aval associé à une amorce sens qui s'hybride à l'extrémité de la cassette (PCR B) doit faire un produit. PCR avec deux amorces qui s'hybrident à l'intérieur de la cassette kanMX4 (PCR C) ou avec deux amorces qui s'hybrident à la séquence de type sauvage du gène ciblé (PCR D) ne doit pas produire une bande. Flèche rouge indique une amorce de PCR. Bracché représente une région amplifiée avec une réaction de PCR. Boîte indique la cassette GFP (green), la cassette kanMX4 (jaune), ou votre gène favori (YFG, gris). La ligne noire indique une séquence d'accompagnement dans un chromosome de levure.

Figure 5
Figure 5. La cytométrie en flux. Dans cette expérience, les descendants haploïdes à partir d'un croisement de deux souches, l'une avec le génotype ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ et l'autre avec le génotype ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ ont été amenés à exprimer la GFP. Chaque délétion du gène GFP a eu une cassette. Par les cellules de déclenchement sur la base de la zone de diffusion vers l'avant et la hauteur diffusion vers l'avant (P1), agrégats de cellules (qui ont tendance à avoir disproportionnée zone de diffusion vers l'avant ont été exclus. Par cellules de déclenchement sur la base de diffusion vers l'avant et la diffusion latérale (P2), CElls dans le bas de 20% en dispersion vers l'avant ont été acceptées, tout en excluant les débris avec la plus faible dispersion vers l'avant et la diffusion latérale. Par les cellules de déclenchement sur la base de dispersion latérale et un signal GFP (P3), les cellules fluorescentes plus parmi ceux dans une plage de dispersion latérale donnée ont été prises. Pour permettre de comparer la répartition méiotique et l'échantillon témoin négatif qui ne expriment la GFP, une porte identique à celle utilisée pour la sélection de la population P3 est montré dans le diagramme pour les cellules sélectionnées de manière similaire au témoin négatif.

Figure 6
Figure 6. Le génotypage des souches triés. PCR a été réalisée en utilisant une amorce anti-sens qui s'hybride à la région flanquante en aval associé à une amorce sens qui s'hybride à l'extrémité de la cassette. La présence de bande indique la présence de la cassette de la GFP. Une autre expérience a montré que toutes les con douze souchesmaintenir la suppression yer042w Δ et Δ la suppression ykr011c.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Comme nous l'avons développé l'approche Green Monster, nous étions préoccupés par la possibilité d'une recombinaison entre différentes cartouches de rechange GFP, ce qui conduit à un réarrangement du génome. Atténuer contre cette possibilité est notre sélection des cellules qui ont subi avec succès plusieurs séries d'accouplement et de la méiose. Les cellules porteuses de génomes réarrangés sont censés être moins en forme après l'accouplement aux cellules sans un réarrangement identique. En effet, nous n'avons pas observé une instabilité du génome résultant de la recombinaison entre les cassettes GFP 11. Cependant, nous ne pouvons pas totalement exclure cette possibilité, il est donc recommandé que les utilisateurs de tester les souches générés pour réarrangement. Électrophorèse en champ pulsé peut être utilisé pour détecter une anomalie grave. PCR avec des amorces de séquences de recuit à l'intérieur de la délétion peut être utilisée pour confirmer l'absence de séquences de type sauvage.

Sur la base des niveaux de fluorescence des souches établies, GFIntensité P a eu une relation quasi-linéaire avec le nombre de suppressions, ce qui suggère que la saturation n'est pas un problème au sein de l'intervalle testé de une à 16 suppressions 11. Cependant, même dans les tours plus tard avec des souches avec de nombreuses suppressions ne se chevauchent pas, nous avons pu qu'augmenter le nombre moyen de délétions dans la population d'environ deux à chaque tour, alors que théoriquement une cellule portant l'union de toutes les suppressions dans le parentaux deux souches peuvent être combinées à la fois si rigueur parfaite pour la sélection de la GFP ont été atteints. Une limitation est la variation de cellule à cellule de l'intensité de la GFP chez les cellules isogéniques. Dans le deuxième exemple de résultats représentatifs, seulement 0,8% des cellules dans la population serait susceptible d'avoir tous les 11 suppressions qui étaient possibles dans ce croisement (quatre des 11 suppressions ont été partagés par les deux haploïdes parentales). Cependant, les plus abondantes de dix souches de suppression aura une distribution d'intensité GFP qui chevauche celui de la stra 11-suppressionins. Par conséquent, une partie encore plus petite de la population doit être sélectionné pour sélectionner préférentiellement 11-suppression souches provenant de la plus élevée queue de la distribution de l'intensité de la GFP 11-suppression souches. Une solution peut consister à simplement relever le seuil pour trier les cellules rares avec une intensité plus élevée GFP. Une autre solution pourrait consister à mesurer simultanément un étalon interne, un journaliste protéine fluorescente de couleur différente qui est présent en un seul exemplaire, exprimé par le même promoteur tetO 2. Cette stratégie pourrait s'attendre à annuler le bruit extrinsèque à réduire la variation de cellule à cellule ainsi normalisées des mesures d'intensité GFP 16,17.

La difficulté d'obtenir des rares multi-mutants peut être exacerbée par le taux de croissance potentiellement lent de ces souches. Multi-mutants sont enrichis par cytométrie en flux, mais ils peuvent être surpassés pendant le reste du processus par les frères monteur. Afin de minimiser le nombre de générationssouches de levure subir, il est recommandé de petits volumes de culture qui fournissent une amplification suffisante juste de cellules de la ploïdie souhaitée qui sont sélectionnés à chaque étape.

Parce que plusieurs suppressions peuvent être acquises par cycle, la méthode monstre vert peut être utilisé pour assembler multi-mutants plus rapidement que les méthodes séquentielles 11. Si des sous-ensembles spécifiques de suppressions ont létaux synthétiques relations, "mort extrémités 'on peut rencontrer avec les approches séquentielles. Cette limitation peut être contournée par l'approche Green Monster, où des échantillons de l'espace des chemins possibles vers accumuler l'ensemble des suppressions. Le plus massivement parallèle la version du processus de monstre vert devrait s'avérer utile pour trouver un chemin pour atteindre le plus grand nombre tolérable de suppressions.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Aucun conflit d'intérêt déclaré.

Acknowledgments

Ce travail a été soutenu par la US Defense Advanced Research Projects Agency contrat N66001-12-C-4039 à YS, une subvention de la Fondation Alfred P. Sloan à RSL, et US National Institutes of Health des subventions R01 et R21 CA130266 HG003224 à FPRFPR était également soutenu par une bourse de l'Institut canadien de recherches avancées et par le Programme des chaires de recherche du Canada excellence.

Materials

Name Company Catalog Number Comments
G418 Sigma-Aldrich A1720 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 200 mg/ml. Store at 4 °C.
ClonNAT (nourseothricin) WERNER BioAgents 5001000 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 100 mg/ml. Store at 4 °C.
Doxycycline Sigma-Aldrich D9891 Dissolve in 50% ethanol and filter-sterilize (0.2-μm filter). Stock concentration: 10 mg/ml. Make fresh every four weeks. Shield from light using aluminum foil and store at 4 °C.
Zymolyase ZymoResearch E1005
Difco yeast nitrogen base w/o amino acids BD 291940
Revolver (rotator for tubes) Labnet H5600
Enduro Gel XL electrophoresis unit Labnet E0160
Sonifier 450 Branson 101-063-198
Microtip for Sonifier 450 Branson 101-148-062
FACSAria cell sorter BD
MoFlo cell sorter Beckman-Coulter
Biomek FX or equivalent robot Beckman Coulter Optional. For setting up genotyping PCRs.

DOWNLOAD MATERIALS LIST

References

  1. Tong, A. H., et al. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science's STKE. 294, 2364-23 (2001).
  2. Hillenmeyer, M. E., et al. The chemical genomic portrait of yeast: uncovering a phenotype for all genes. Science. 320, 362-365 (2008).
  3. Beh, C. T., Cool, L., Phillips, J., Rine, J. Overlapping functions of the yeast oxysterol-binding protein homologues. Genetics. 157, 1117 (2001).
  4. Wieczorke, R., et al. Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae. FEBS letters. 464, 123-128 (1999).
  5. Alani, E., Cao, L., Kleckner, N. A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics. 116, 541-545 (1987).
  6. Akada, R., et al. PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae. Yeast. 23, 399-405 (2006).
  7. Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic acids research. 24, 2519 (1996).
  8. Delneri, D., et al. Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system. Gene. 252, 127-135 (2000).
  9. Storici, F., Lewis, L. K., Resnick, M. A. In vivo site-directed mutagenesis using oligonucleotides. Nat. Biotech. 19, 773-776 (2001).
  10. Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast. Nucl. Acids Res. 38, 2570-2576 (2010).
  11. Suzuki, Y., et al. Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection. Nat. Methods. 8, 159-164 (2011).
  12. Winzeler, E. A. Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis. Science. 285, 901-906 (1999).
  13. Woods, R. A., Gietz, R. D. High-efficiency transformation of plasmid DNA into yeast. Methods Mol. Biol. 177, 85-97 (2001).
  14. Hughes, T. R., et al. Widespread aneuploidy revealed by DNA microarray expression profiling. Nature. 25, 333-337 (2000).
  15. Goldstein, A. L., McCusker, J. H. Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast. 15, 1541-1553 (1999).
  16. Newman, J. R. S., et al. Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise. Nature. 441, 840-846 (2006).
  17. Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. Gene regulation at the single-cell level. Science. 307, 1962 (2005).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics