O Processo de monstro verde para a Geração de linhagens de levedura de transporte deleções de genes múltiplos

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

O método permite que o monstro verde montagem rápida de exclusões múltiplas marcados com um gene que codifica a proteína verde fluorescente repórter. Este método baseia-se em estirpes de levedura de condução através de ciclos repetidos de sortimento sexual de deleções e fluorescência baseada enriquecimento de células que transportem mais deleções.

Cite this Article

Copy Citation | Download Citations

Suzuki, Y., Stam, J., Novotny, M., Yachie, N., Lasken, R. S., Roth, F. P. The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions. J. Vis. Exp. (70), e4072, doi:10.3791/4072 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Fenótipos de uma deleção do gene são frequentemente revela apenas quando a mutação é testado em um fundo genético particular ou 1,2 condição ambiental. Há exemplos em que muitos genes precisam ser apagados para desmascarar funções de genes ocultos 3,4. Apesar do potencial de descobertas importantes, interações genéticas envolvendo três ou mais genes são largamente inexplorado. Buscas exaustivas de multi-mutantes interações seria inviável devido ao grande número de combinações possíveis de exclusões. No entanto, os estudos de conjuntos de genes seleccionados, tais como conjuntos de parálogos com maior probabilidade a priori de uma partilha uma função comum, seria informativo.

Na levedura Saccharomyces cerevisiae, knockout do gene é realizada por substituição de um gene com um marcador seleccionável através de recombinação homóloga. Devido ao número de marcadores é limitada, foram desenvolvidos métodos para a remoção e reutilização do sam e marcador 5,6,7,8,9,10. No entanto, as mutações de engenharia sequencialmente múltiplas usando esses métodos é demorado porque o tempo necessário escalas linearmente com o número de deleções a ser gerado.

Aqui descrevemos o método monstro verde para rotineiramente a engenharia de exclusões múltiplas na levedura 11. Neste método, a proteína verde fluorescente repórter (GFP) integrado deleções é usado para estirpes quantitativamente etiquetas de acordo com o número de deleções contidos em cada estirpe (Figura 1). Ciclos repetidos de sortimento de GFP-marcados através de deleções de acasalamento de levedura e meiose acoplado com fluxo de citometria de enriquecimento de estirpes que transportem mais dessas supressões levar à acumulação de deleções em estirpes (Figura 2). Realizando vários processos em paralelo, com cada processo de incorporação de um ou mais deleções por rodada, reduz o tempo necessário para a construção da estirpe.

conteúdo "> O primeiro passo consiste em preparar um único mutantes haplóides denominado« ProMonsters ', cada um dos quais transporta um repórter GFP em um locus suprimido e um dos "kit de ferramentas" loci-ou-GMToolkit um monstro verde ou GMToolkit-α no . can1Δ locus (Figura 3) usando as estirpes de levedura a supressão recolha 12, GFP marcadas deleções pode ser convenientemente gerado pela substituição da cassete KanMX4 comum existente nessas estirpes com uma GFP universal - URA3 Cada fragmento GMToolkit contém:. quer a um - ou α-acasalamento tipo específico de marca de selecção haplóide 1 e exatamente um dos dois marcadores que, quando ambos estão presentes GMToolkits, coletivamente permitem a selecção de diplóides.

O segundo passo é fazer o ciclo sexual por meio do qual loci deleção podem ser combinados dentro de uma única célula, a distribuição aleatória e / ou recomb meióticaminação que acompanha cada ciclo de acasalamento e esporulação.

Protocol

1. Geração de ProMonsters

  1. Prepare a cassete de substituição universal GFP, amplificando um tetO 2-GFP marcador e o marcador URA3 a partir do plasmídeo pYOGM012 (resistência à ampicilina), utilizando iniciadores com sequências:
    GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCC CAAGCTCCTCGAGTAATTCG e GGCGTTAGTATCGAATCGACAGCAGTATAGCGACCAGCATTCAC GTACCGGGTAATAACTGATATAAT (regiões negrito proporcionar homologia com as regiões flanqueadoras do cassete KanMX4 permitindo a substituição segmentada). A reacção de PCR deve ser efectuada com a polimerase Phusion, tampão HF, e 3% de dimetilsulfóxido (New England Biolabs), a partir da concentração de DNA modelo de 0,5 ng / uL. O programa de PCR é de 98 ° C durante 30 seg e 35 ciclos de 98 ° C durante 10 seg, 49 ° C durante 30 seg e 72 ° C durante 1,5 min. O volume de reacção deve ser> 50 ul de ADN suficiente para fornecer, para cada experiência de transformação. Nós purificaro produto utilizando um kit de purificação PCR QIAquick (Qiagen) com ~ 50 uL da reacção de PCR processado por coluna, mas saltando a etapa de purificação pode aumentar o rendimento de transformantes.
    Alternativamente, libertar um fragmento contendo a tetO 2-GFP e marcadores URA3, bem como homólogas regiões para KanMX4 direccionamento, por digestão do plasmídeo pYOGM057 (resistência à ampicilina), utilizando a enzima de restrição EcoRI (New England Biolabs). A concentração de DNA nesta reacção deve ser ~ 30 ng / ul. O volume de reacção deve ser> 34 ul.
    Para integrar a cassete GFP em uma região diferente de KanMX4, ajuste a região de homologia de iniciadores de PCR acima para as sequências homólogas necessárias.
  2. Transformar uma tensão a-haplóide da coleção KanMX4 levedura nocaute 12 com a cassete universal GFP exclusão. Seguindo o protocolo por ul 13 Woods e Gietz 0,34 doAmostra de ADN purificado (produto de PCR ou não purificada digestão de restrição) deverá ser utilizado para cada experiência de transformação. Placa de um quinto da mistura de transformação em uma placa CAA-Ura (base de azoto de 0,67% de levedura, 2% de glucose, 0,6% de ácido casaminico, hemi-sulfato de adenina de 0,0025%, 0,005% de triptofano, e 2% de agar).
  3. Streak fora dos transformantes numa placa de CAA-Ura fresco para se obter colónias isoladas.
  4. Transferir as células de uma colónia numa placa de YPDA contendo 200 ug / ml de G418 para confirmar a ausência de crescimento. Para confirmar a integração bem sucedida da GFP, seguir os passos de (1.5) - (1.9) para efectuar PCR colónia.
  5. Adicionar células retiradas de uma colónia em 2 ul de tampão de lise (fosfato de sódio 0,1 M, pH 7,4, 1 unidade de Zymolyase ZymoResearch) num tubo de PCR de 0,2 ml ou de um poço de uma placa de 96 poços. Misturar por pipetagem da solução para dentro e para fora da ponta de uma pipeta.
  6. Overlay com uma gota (aproximadamente 20 ul) de óleo mineral utilizando um Pipetman P200 (Gilson).
  7. Incubar a mistura a 37 °C durante 20 min e em seguida a 95 ° C durante 10 min.
  8. Diluir o lisado com 50 ul de água. Misturar por pipetagem da solução para dentro e para fora de dez vezes.
  9. Analise 1 ul do ligado utilizando reacções de 10 ul de PCR com (A) um iniciador para a frente, que hibridiza para a região a montante flanqueando emparelhado com um iniciador da sequência CCTGAGAAAGCAACCTGACC (285 pb a partir do início da cassete), (B) um reverso primer que hibridiza para a região a jusante emparelhada com um iniciador do GCATTGGGTCAACAGTATAG sequência (375 pb a partir da extremidade), (C) dois iniciadores que se ligam ao KanMX4 com as sequências CGTACTCCTGATGATGCATG e GACGAAATACGCGATCGCTG (181 pb), e (D) dois iniciadores que emparelham com a sequência do tipo selvagem do gene alvo (figura 4). (D) é importante porque a cerca de 8% das estirpes nas colecções de deleção são conhecidos por conterem aneuploidia 14. Um transformante correcta deve ser positiva com (A) e (B), e negativa com (C) e (D).
  10. Para introduzir umGMToolkit no transformante, adicionar cerca de 250.000 células da estirpe transformada e 250.000 células ou de RY0146 (contendo GMToolkit-a) ou RY0148 (contendo GMToolkit-α) para um tubo Eppendorf de 1,6 ml. Vortex. Os genótipos de RY0146 e RY0148 são MATa lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-a [CMVpr-rtTA KanMX4 STE2pr-Sp-his5] e MATa lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-α [CMVpr-rtTA NatMX4 STE3pr- LEU2], respectivamente. pr denota promotor. O número de células deve ser calculado a partir da densidade óptica da cultura precedente.
  11. Centrifugar a 800 xg durante 2 min.
  12. Remover o sobrenadante.
  13. Para permitir a troca de ar, fazer um furo na tampa usando um pino tratado com etanol a 70%.
  14. Adicionar 50 ul de meio YPDA (extrato de levedura 1%, peptona a 2%, glicose a 2%, e 0,003% de adenina hemisulfate). Vortex.
  15. Centrifugar a 800 xg durante 5 min.
  16. Colocar o tubo em uma caixa húmido. Isto pode ser criado com uma caixa vazia ponta, uma banca de pequena ponta, e uma toalha de papel molhado.
  17. Incubar a caixa durante a noite a 30 ° C.
  18. Selecione diplóides acasaladas pela primeira listando as células em uma placa CAA-Ura. Incubar a placa a 30 ° C durante um dia.
  19. Tomando as células a partir da área de volume, raia-las para se colónias isoladas em placas de YPDA (extrato de levedura 1%, peptona a 2%, glicose a 2%, 0,003%, hemi-sulfato de adenina e 2% de agar) contendo 200 ug / ml de G418 para seleccionar diplóides contendo um ou GMToolkit-100 ug / ml nourseothricin (Nat) 15 para seleccionar diplóides contendo GMToolkit-α.
  20. Incubar a placa a 30 ° C durante 3 dias.
  21. A partir de uma colónia isolada, transferir a maior parte das células de 500 ul de meio de agar sem GNA (extrato de levedura 1%, 3% de caldo nutriente Disco e glucose a 5%, glicose autoclave e no resto do tele componentes separadamente como duas soluções para evitar a caramelização ×) num tubo de cultura de 5 ml com a tampa solta.
  22. Girar o tubo horizontalmente durante cinco horas a 30 ° C. O eixo de rotação tem de ser paralelo ao eixo longitudinal do tubo.
  23. Confirmam que as colónias usadas em (1.21) são Ura + listando-os em uma placa CAA-Ura.
  24. Centrifuga-se o tubo a 800 xg durante 2 min. Descartar o sobrenadante.
  25. Adicionar 500 ul de meio de esporulação mínima (acetato de potássio a 1%, acetato de zinco a 0,005%; filtro-esterilizar). Vortex.
  26. Centrifuga-se o tubo a 800 xg durante 2 min. Descartar o sobrenadante.
  27. Repita (1,25) - (1,26) duas vezes.
  28. Adicionar 1 ml de meio de esporulação mínimo suplementado com 7,5 ug / ml de lisina, 7,5 ug / ml de leucina, histidina 5 ug / ml, 5 ug / ml de metionina, e 1,25 uracil ug / ml (para aumentar a taxa de esporulação das estirpes auxotróficas) . Vortex.
  29. Girar o tubo à temperatura ambiente durante um dia.
  30. Girar o tubo a 30 ° C durante 2 dias.
  31. Centrifugar 125 ul desta mistura num tubo de Eppendorf de 1,6 ml a 800 xg durante 2 min. Descartar o sobrenadante.
  32. Adicionar 50 ul de solução de Zymolyase (100 mM de tampão de fosfato de sódio, pH 7,4, 1 M de sorbitol, e 2 unidades de Zymolyase ZymoResearch). Misturar por pipetagem da solução para dentro e para fora da ponta de uma pipeta.
  33. Incubar a 30 ° C durante 1 h.
  34. Adicionar 50 ul de 0,02% de NP-40. Misturar por pipetagem da solução para dentro e para fora da ponta de uma pipeta.
  35. Deixar o tubo à temperatura ambiente durante cinco minutos.
  36. Adicionar 500 uL de água.
  37. Colocar o tubo em gelo.
  38. Sonicar a mistura duas vezes com a configuração de saída de 1 (fraco ambiente) durante 15 segundos utilizando uma microtip de 3,2 mm com Sonifier 450 (Branson). Entre os dois ciclos de sonicação, colocar o tubo em gelo para voltar a temperatura a ~ 0 ° C.
  39. Centrifugar os tubos a 800 xg durante 5 min. Descartar o sobrenadante.
  40. Adicionar 200 ul de His-SC-Ura(A) ou SC-Ura-Leu médio (α), dependendo se a cruz é para incorporar um ou GMToolkit-GMToolkit-α. Para preparar os meios de comunicação, fazer SC-Ura-His-Leu suporte (base de azoto de 0,67% de levedura, 2% de glucose, 0,01% de arginina, 0,01% de ácido aspártico, ácido glutâmico 0,01%, 0,01% de isoleucina, 0,01% de lisina, 0,01% de metionina , 0,01%, fenilalanina, serina 0,08%, 0,04% de treonina, tirosina 0,002%, 0,03%, valina, adenina 0,0025%, 0,005% de triptofano, adenina 0,003% e 0,005% de triptofano) e completá-la com histidina leucina ou estéril antes da sua utilização para o concentração final de 0,01%.
  41. Fazer um furo na tampa usando um pino tratado com etanol a 70%.
  42. Girar o tubo horizontalmente a 30 ° C durante 2 dias. O eixo de rotação tem de ser paralelo ao eixo longitudinal do tubo.
  43. Streak as células em uma placa de agar SC-Ura-His ou SC-Ura-Leu (os mesmos ingredientes como acima, mais de 2% de agar, ácido aspártico e treonina deve ser adicionado depois de umutoclaving; adicionar histidina ou leucina antes de derramar) para fazer colônias isoladas para as amostras ProMonster.

2. Ciclismo sexual

  1. Rodar uma cultura de uma estirpe de deleção estabelecido GFP em 100 ul de SC-His (a) ou SC-Leu (α) dependendo do tipo de acasalamento, a 30 ° C durante a noite utilizando um tubo de 1,6 ml de Eppendorf. Para a troca de ar, fazer um buraco com um alfinete tratado com etanol a 70%. Gire o tubo horizontalmente. O eixo de rotação tem de ser paralelo ao eixo longitudinal do tubo. É possível cruzar várias cepas através de acasalamento en masse. Quando uma amostra é classificada directamente utilizado para este fim, a cultura das células em 200 uL a 30 ° C durante 2 dias. Para preparar o meio, adiciona-uracilo (concentração final: 0,0025%) e histidina (0,01%) ou a leucina (0,01%) para SC-Ura-His-Leu médio.
  2. Misture a-haplóides 250.000 células e 250.000 células α-haplóides de estirpes de deleção GFP em um Eppe 1,6 mltubo ndorf. Vortex.
  3. Una destas células por passos seguintes (1,11) - (1,17).
  4. Transferem-se 10 ul da mistura de acoplamento a 500 ul de meio de GNA contendo 200 ug / ml de G418 e 100 ng / ml Nat num tubo de cultura de 5 ml com uma tampa solta. O OD 600 é mais ou menos a partir de 0,1.
  5. Girar a cultura a 30 ° C durante 24 h. Isto permite a selecção de diplóides diplóides porque apenas contém tanto KanMX4 em GMToolkit-a e NatMX4 em GMToolkit-α pode crescer na presença de G418 e Nat (Figura 3).
  6. Transferir 20 uL da cultura de um dia para 500 ul de GNA fresco contendo G418 e Nat. O OD 600 é aproximadamente de partida de 0,2.
  7. Girar o tubo a 30 ° C durante 5 horas para levar as células à fase log (OD 600 de ~ 1).
  8. Siga os passos (1,24) - (1,38) para esporular os diplóides e isolar esporos.
  9. Dividir a suspensão de células em duas esporulados de 300 ulpeças e colocar cada um em uma separada tubo Eppendorf de 1,5 ml.
  10. Centrifugar os tubos a 800 xg durante 5 min. Descartar o sobrenadante.
  11. Para a pastilha de um tubo, adicionar 100 uL de meio SC-His para seleccionar uma haplóides-. Para o pellet do outro tubo, adicionar 100 uL de meio SC-Leu para seleccionar α-haplóides.
  12. Rodar os tubos a 30 ° C durante a noite. O OD 600 final, deve ser inferior a 0,5. Se OD 600 tende a ser demasiado alto, tente de cultura à temperatura ambiente.
  13. Para induzir a GFP, adicionar 100 ul de fresco SC-His (a) ou SC-Leu médio (α) contendo 20 ug / ml de doxiciclina. A concentração final de doxiciclina é de 10 ug / ml. Vortex.
  14. Rodar os tubos a 30 ° C durante 2 dias.

3. Citometria de Fluxo

  1. Adicionar 900 uL de pré-filtrada tampão TE (pH 7,5) contendo 10 ug de doxiciclina / ml para um tubo de polipropileno de 5 ml (BD Falcon # 352063) com o tampão trocado com uma célula-filtro tampa de um tubo de poliestireno de 5 ml (BD Falcon # 352235). Tubos de polipropileno são adequados para a citometria de fluxo. A tampa do filtro é desejado para a remoção de partículas grandes.
  2. Delicadamente, coloque 75 ul de tampão TE com doxiciclina sobre a tampa do filtro de células.
  3. Adicionam-se 25 ul das células induzidas para a solução na tampa.
  4. Enquanto pressiona a ponta do Pipetman contra a malha, dispara a totalidade da solução combinada através do filtro.
  5. Pressione para baixo a tampa do filtro e vórtice do tubo.
  6. Preparar os tubos de recolha (tubos de Eppendorf de 1,6 ml) contendo 200 ul de SC-His-Leu ou SC.
  7. Comece o seleccionador de células e ajustar as configurações de acordo com o manual do fabricante.
  8. Vortex tanto o tubo de recolha (para o revestimento da parede com o meio) e o tubo contendo as células antes de a colocar sobre o separador de células.
  9. Aquisição de dados de citometria de fluxo da amostra. A estirpe não contendo GFP pode ser um controlo negativo.
  10. Desenhe portas para a classificação. (A)Para evitar agregados celulares, o que poderia exibem intensidade GFP alta, descarte de outliers com largura de pulso desproporcionalmente grande para dispersão frontal (FSC), utilizando uma curva de largura de pulso e altura de pulso para MoFlo classificador ou desproporcionalmente pequena altura FSC usando um lote de altura FSC e FSC área para FACSAria classificador (Figura 5, painel superior esquerdo). (B) Uma vez que o FSC grande (área) é esperado para agregados de células, apenas retirar células na parte inferior a 20% no FSC, evitando regiões com o menor dispersão FSC e lateral (SSC) valores onde os detritos celulares são frequentemente encontrados (Figura 5, superior direito do painel). (C) SSC (área) e GFP sinal (área) muitas vezes são positivamente correlacionados. Porque simplesmente tomando as células brilhantes dadas as portas acima também enriquecer por células com um valor alto do CCD, desenhe uma porta ao longo da periferia da população, utilizando uma curva de intensidade de GFP e SSC a ter uma percentagem semelhante dos mais brilhantes as células a partir de cada ponto do eixo SSC (Figura 5, bottom-esquerdo diagrama). A população seleccionada em (C) deverá ser 0,1-1% da população seleccionada em (B).
  11. Classificar 200 células no tubo de coleta de dados os critérios de (3.10). Para um processo de massa en ou para outros projetos que requerem uma população mais complexo, classificar mais células quando necessário.
  12. Vortex do tubo de recolha para cobrir as células seleccionadas com meio.
  13. Placa um subconjunto de células (por exemplo, a 50 células) em uma placa de YPDA para genotipagem.
  14. Incubar a placa a 30 ° C durante 2 dias.
  15. Fazer um lisado para ~ 12 colónias, seguindo os passos de (1.5) - (1.8).
  16. Transferir as células residuais na ponta utilizada em (1.5) para um ponto sobre uma placa de YPDA contendo G418 e Nat por tocar suavemente a placa com a ponta. Haplóides selecionados não deve crescer nesta placa. Diplóides podem ter mais cópias GFP e pode, portanto, ser mais brilhante. Este teste pode mostrar a eficiência da seleção haplóide.
  17. Para genotipagem, analisam 1 ul do ligado utilizando um 10-ul de PCR reaction com um iniciador directo que hibridiza para a região a montante de flanco de cada gene suprimido emparelhado com um iniciador da CCTGAGAAAGCAACCTGACC sequência.
    As reacções de PCR multiplex, se possível (condições podem ser determinadas usando lisados ​​de mutantes simples). A PCR pode ser feito de um 96 - ou formato de 384 poços. Este último formato é adequado para o volume de reacção de tão pouco como 5 ul. Arraying de PCR master mixes diferindo em primers e adição de lisados ​​celulares para estas misturas podem ser levadas a cabo utilizando uma pipeta multi-canal ou um robot de manuseamento de líquidos. Dica mudanças são opcionais ao adicionar o lisado mesmo para diferentes misturas de PCR.
  18. Analisar os produtos de PCR. O Gel XL Ultra sistema V-2 de electroforese (Labnet) é compatível com a carga de amostra usando pipetas multicanal.
  19. Com base em informações a partir de (3.16) e (3.18), identificar prováveis ​​haplóides que desejadas genótipos.
  20. Estabelecer essas cepas em um prato fresco (YPDA, CAA-Ura, ou SC-Ura-His/Leu). Além disso, congelá-los em25% de glicerol a -80 ° C. Testes adicionais, tais como confirmação da ausência de sequências de tipo selvagem para os genes suprimidos e de campo pulsado de electroforese em gel são recomendados.
  21. Repita ciclismo sexual a partir de (2.1) com cepas úteis.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Quando uma tensão a-haplóide com quatro eliminações GFP-marcados (ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) foi cruzado com uma tensão α-haplóide com quatro eliminações (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ), com duas eliminações (ycl033cΔ yer042wΔ) compartilhado por duas estirpes, um representante resultado foi obtido. A mistura de acasalamento foi cultivada em meio contendo YPDA G418 e Nat para selecionar diplóides. Os diplóides resultantes foram cultivadas em meio de esporulação. Os esporos foram dispersos por tratamento Zymolyase e sonicação, e germinadas em meio de selecção haplóides. As células foram depois induzidas a expressar a GFP. Utilizando portas com um citómetro de fluxo, uma população de células seleccionada foi que é improvável que contêm os restos de células ou de agregados (Figura 5). Nesta população, mais brilhante a 1% das células foram classificados. Células classificados e não classificados células foram genodigitado após eles formaram colônias em uma placa. Quando as colônias selecionadas aleatoriamente foram semeadas em uma placa contendo YPDA G418 e Nat, células de duas das 16 colônias cresceram para a amostra não classificado, e de células a partir de 18 das 26 colônias cresceram para a amostra classificada, sugerindo que alguns diplóides ganhou a habilidade para expressar um marcador de selecção haplóide e propagado durante as fases haplóide-selecção e GFP-indução nesta experiência. Diplóides foram ainda mais enriquecido na amostra ordenada presumivelmente devido ao maior número de cópias que continha GFP. Quando haplóides foram analisados ​​por PCR, o número médio de deleções nas células seleccionadas foi de 5,1 ± 0,4 (n = 8; SEM mostrado). Quatro destas células teve seis deleções, o número máximo possível de deleções para esta cruz. Haplóides da amostra não triados tinha 3,4 ± 0,2 deleções em média (n = 14).

Em uma experiência separada, uma tensão a-haplóide com sete GFP marcadas exclusões (Yer042wΔ yer108cΔ yfr057wΔ ykl069wΔ ykr011cΔ ylr123cΔ yol118cΔ) foi cruzada com uma estirpe haplóide α-carregar oito deleções (ycl033cΔ ydl227cΔ ydl242wΔ yer042wΔ yer108cΔ yfr057wΔ ygl109wΔ ykr011cΔ), com quatro deleções comuns (yer042wΔ yer108cΔ yfr057wΔ ykr011cΔ) contidas nas duas estirpes. Quando diplóides foram seleccionadas e subsequentemente cultivadas em meio de esporulação, cerca de 20% das células esporuladas baseada na observação microscópica (n> 100). Depois de os esporos germinaram e foram dispersos, os haplóides resultantes foram induzidas a expressar a GFP e ordenadas com base na fluorescência como acima. Apenas uma das 61 células seleccionadas aleatoriamente cresceram numa placa de YPDA contendo G418 e Nat, sugerindo que as células foram classificadas, predominantemente haplóide. Quando analisado por PCR (Figura 6), as células seleccionadas tinha o número de eliminação média de 8,8 ±0,3 (n = 12; SEM mostrado), incluindo cinco células contendo 10 delecções. O número esperado de deleções para uma célula não triados resultante da segregação aleatória foi de 7,5.

Figura 1
Figura 1. Monstros verdes sob o microscópio de fluorescência. Micrografias mostram uma estirpe mutante não (esquerda), uma estirpe ProMonster (meio), e uma estirpe de monstro 16-GFP (direita). Exposição idêntica, brilho e contraste foram usados ​​para imagens.

Figura 2
Figura 2. O esquema do processo de monstro verde. Single-mutantes haplóides (luz verde) são acoplados. Recombinação meiótica durante a esporulação dos diplóides acasaladas gera uma mistura de 0-GFP células (off-white), 1-GFP células (luz verde) e 2-GFP células (verde escuro). Fluxocitometria é utilizado para seleccionar os mais verdes células enriquecidas para as células de 2-GFP. Integradas ferramentas moleculares permitem a seleção de um haplóides-(Suas +), α-haplóides (LEU +), e diplóides (G418 e Nat-resistência). Este ciclo é repetido para enriquecer para cepas que carregam um número cada vez maior de alterações.

Figura 3
Figura 3. Cassetes de deleção e de GFP. GMToolkits cassetes de deleção GFP contêm um gene repórter GFP e um marcador de transformação de levedura (URA3). O tetO 2 promotor é induzível por meio da adição de doxiciclina no meio através da acção do factor de transcrição rtTA. Se o nível de GFP atinge a capacidade máxima de células para produzir a proteína ou para tolerar qualquer efeito tóxico do mesmo, a expressão pode ser discado para baixo, baixando a concentração de doxiciclina (notar, contudo, que se fez não observar tal saturação ou efeitos de toxicidade, mesmo com 16 cópias de GFP). Esta cassete pode ser orientada para qualquer gene ou região, anexando específicos sequências homólogas utilizando PCR. Como alternativa, a cassete de eliminação universal GFP com idênticas seqüências homólogas pode ser convenientemente orientada para a almofadas de aterragem "KanMX4 em cepas da coleção nocaute fermento. YFG denota o gene favorito. Caixa com linhas verticais denota código de barras de DNA. GMToolkits estão integrados no locus de CAN1. O marcador de STE2-his5 eo marcador STE3-LEU2 são expressos de uma forma específica do tipo de acasalamento em haplóides para permitir que apenas a-haplóides de crescer na ausência de histidina e apenas α-haplóides de crescer na ausência de leucina, respectivamente. Seleccionando para resistência a G418 e Nat simultaneamente selecciona para o locus KanMX4 num GMToolkit eo locus NatMX4 no outro e, assim, selecciona para diplóides.

"fo: manter-together.within-page =" _content sempre "> Figura 4
Figura 4. Confirmando a integração correta do cassete GFP. A cassete GFP universal pode ser utilizada para converter qualquer supressão KanMX4 marcado disponível na colecção de eliminação de levedura a uma deleção GFP-marcado. Com um alelo correctamente gerados GFP supressão, a reacção de PCR com um iniciador directo que hibridiza para a região a montante flanqueando emparelhado com um iniciador reverso que hibridiza para o início da cassete (PCR A do Passo 1.9) deve fazer uma banda. PCR com um primer reverso que hibridiza com a região flanqueadora a jusante emparelhada com um iniciador directo que hibridiza para o fim da fita (PCR B) deve fazer um produto. PCR com dois primers que se ligam dentro da cassete KanMX4 (PCR C) ou com os dois iniciadores que se ligam à sequência de tipo selvagem do gene alvo (PCR D) não deve produzir uma banda. Seta vermelha indica um iniciador de PCR. Bracket mostra uma região amplificada com uma reacção de PCR. Caixa indica a cassete GFP (verde), a cassete KanMX4 (amarelo), ou o seu gene favorito (YFG, cinza). Linha preta indica uma sequência flanqueadora de um cromossoma de levedura.

Figura 5
Figura 5. A citometria de fluxo. Nesta experiência descendência, haplóide de um cruzamento de duas estirpes, um com o genótipo ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ e o outro com o genótipo ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ foram induzidas a expressar a GFP. Cada deleção do gene tinha uma cassete GFP. Por gating células com base em área de dispersão para a frente e altura de dispersão para a frente (P1), os agregados de células (que tendem a ter desproporcionalmente grande área de dispersão para a frente, foram excluídos. Por gating células com base em dispersão frontal e dispersão lateral (P2), cells na baixa de 20% em dispersão frontal foram aceitos, excluindo os detritos com a menor dispersão para a frente e dispersão lateral. Por gating células com base em dispersão lateral e sinal de GFP (P3), as células fluorescentes mais entre aqueles em um determinado intervalo de dispersão lateral foram tiradas. Para permitir a comparação da mistura meiótica e da amostra de controlo negativo que não expressam GFP, um portão idêntico ao utilizado para a selecção da população P3 é mostrada num diagrama para as células seleccionadas de modo semelhante ao controlo negativo.

Figura 6
Figura 6. A genotipagem das estirpes classificados. PCR foi realizada utilizando um iniciador reverso que hibridiza com a região flanqueadora a jusante emparelhada com um iniciador directo que hibridiza para o fim da fita. A presença de banda indica a presença da cassete de GFP. Uma experiência separada mostrou que todas as estirpes de con 12tam manter a supressão yer042w Δ eo ykr011c deleção Δ.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Como se desenvolveu a abordagem monstro verde, estávamos preocupados com a possibilidade de recombinação entre cassetes de substituição diferentes GFP, levando ao rearranjo do genoma. Mitigação contra esta possibilidade é a nossa seleção para as células que resistiram várias rodadas de acasalamento e meiose. Células portadoras de genomas rearranjados se espera que sejam menos aptos após o acasalamento para células sem um rearranjo idênticos. Na verdade, não observamos qualquer instabilidade do genoma resultante da recombinação entre cassetes GFP 11. No entanto, não podemos excluir totalmente essa possibilidade, por isso, é recomendado que os usuários testar as tensões geradas para rearranjo. De campo pulsado de electroforese em gel podem ser utilizadas para detectar bruto anormalidade. PCR com iniciadores de recozimento para sequências dentro da deleção pode ser usado para confirmar a ausência de sequências de tipo selvagem.

Com base nos níveis de fluorescência de estirpes estabelecidas, GFIntensidade P tinha uma relação quase linear com o número de deleções, sugerindo que a saturação não é um problema no intervalo testado de um a 16 eliminações 11. No entanto, mesmo em rodadas posteriores com estirpes com muitas exclusões não sobrepostos, fomos capazes de só aumentar o número médio de eliminações na população em cerca de dois em cada rodada, enquanto que, teoricamente, uma célula tendo a união de todas as exclusões no pais dois estirpes podem ser combinados de uma só vez, se rigor perfeito para selecção GFP foram alcançados. Uma limitação é a variação de célula-a-célula de intensidade entre as células GFP isogénicas. No segundo exemplo de resultados representativos, de apenas 0,8% das células na população que seria esperado ter todos os 11 deleções que eram possíveis neste cruzamento (quatro dos 11 deleções foram partilhada por ambos os haplóides parental). No entanto, os mais abundantes 10-estirpes de deleção terão uma distribuição de intensidade de GFP que se sobrepõe ao do stra 11-supressãoins. Portanto, uma parcela ainda menor da população deve ser selecionado para selecionar preferencialmente 11-exclusão cepas de cauda superior da distribuição de intensidade GFP, de 11 de apagamento-cepas. Uma solução pode ser simplesmente aumentar o limiar para classificar células raras com uma maior intensidade de GFP. Outra solução pode ser a de medir simultaneamente a um padrão interno, uma proteína fluorescente repórter de uma cor diferente, que está presente numa única cópia, expressa por meio do mesmo promotor tetO 2. Esta estratégia seria esperado para cancelar o ruído extrínseco para reduzir a variação da célula-a-célula de medição assim GFP-normalizadas de intensidade 16,17.

A dificuldade de obtenção de mutantes de multi-raras podem ser exacerbados pela taxa de crescimento potencialmente lenta destas estirpes. Multi-mutantes são enriquecidas por citometria de fluxo, mas eles podem ser superados durante o resto do processo pelo ajustador irmãos. Para minimizar o número de geraçõessubmeter-se a estirpes de leveduras, recomendamos pequenos volumes de cultura que proporcionam amplificação just-suficiente de células da ploidia desejado que são seleccionados em cada etapa.

Porque deleções múltiplas podem ser adquiridas por ciclo, o método do monstro verde pode ser usado para montar múltiplos mutantes mais rapidamente do que os métodos sequenciais 11. Se subconjuntos específicos de exclusões têm sintéticos relações letais, "morto extremidades" pode ser encontrado com abordagens seqüenciais. Esta limitação pode ser contornada pela abordagem monstro verde, que as amostras do espaço de possíveis caminhos a acumular o conjunto completo de exclusões. O mais paralelo en masse versão do processo de Monstro Verde deve ser úteis na busca de um caminho para atingir o maior número tolerável de exclusões.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Não há conflitos de interesse declarados.

Acknowledgments

Este trabalho foi financiado pela Defense Advanced Research Projects Agency EUA contrato N66001-12-C-4039 a YS, uma bolsa da Fundação Alfred P. Sloan para RSL, e Nacional dos EUA Institutos de bolsas de Saúde HG003224 R01 e R21 CA130266 para FPRFPR foi também apoiado por uma bolsa de estudos do Instituto Canadense de Pesquisas Avançadas e pelo programa de Excelência de Pesquisa do Canadá Cadeiras.

Materials

Name Company Catalog Number Comments
G418 Sigma-Aldrich A1720 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 200 mg/ml. Store at 4 °C.
ClonNAT (nourseothricin) WERNER BioAgents 5001000 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 100 mg/ml. Store at 4 °C.
Doxycycline Sigma-Aldrich D9891 Dissolve in 50% ethanol and filter-sterilize (0.2-μm filter). Stock concentration: 10 mg/ml. Make fresh every four weeks. Shield from light using aluminum foil and store at 4 °C.
Zymolyase ZymoResearch E1005
Difco yeast nitrogen base w/o amino acids BD 291940
Revolver (rotator for tubes) Labnet H5600
Enduro Gel XL electrophoresis unit Labnet E0160
Sonifier 450 Branson 101-063-198
Microtip for Sonifier 450 Branson 101-148-062
FACSAria cell sorter BD
MoFlo cell sorter Beckman-Coulter
Biomek FX or equivalent robot Beckman Coulter Optional. For setting up genotyping PCRs.

DOWNLOAD MATERIALS LIST

References

  1. Tong, A. H., et al. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science's STKE. 294, 2364-23 (2001).
  2. Hillenmeyer, M. E., et al. The chemical genomic portrait of yeast: uncovering a phenotype for all genes. Science. 320, 362-365 (2008).
  3. Beh, C. T., Cool, L., Phillips, J., Rine, J. Overlapping functions of the yeast oxysterol-binding protein homologues. Genetics. 157, 1117 (2001).
  4. Wieczorke, R., et al. Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae. FEBS letters. 464, 123-128 (1999).
  5. Alani, E., Cao, L., Kleckner, N. A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics. 116, 541-545 (1987).
  6. Akada, R., et al. PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae. Yeast. 23, 399-405 (2006).
  7. Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic acids research. 24, 2519 (1996).
  8. Delneri, D., et al. Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system. Gene. 252, 127-135 (2000).
  9. Storici, F., Lewis, L. K., Resnick, M. A. In vivo site-directed mutagenesis using oligonucleotides. Nat. Biotech. 19, 773-776 (2001).
  10. Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast. Nucl. Acids Res. 38, 2570-2576 (2010).
  11. Suzuki, Y., et al. Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection. Nat. Methods. 8, 159-164 (2011).
  12. Winzeler, E. A. Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis. Science. 285, 901-906 (1999).
  13. Woods, R. A., Gietz, R. D. High-efficiency transformation of plasmid DNA into yeast. Methods Mol. Biol. 177, 85-97 (2001).
  14. Hughes, T. R., et al. Widespread aneuploidy revealed by DNA microarray expression profiling. Nature. 25, 333-337 (2000).
  15. Goldstein, A. L., McCusker, J. H. Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast. 15, 1541-1553 (1999).
  16. Newman, J. R. S., et al. Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise. Nature. 441, 840-846 (2006).
  17. Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. Gene regulation at the single-cell level. Science. 307, 1962 (2005).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics