Çoklu Gen Delesyonlar Taşıma Maya Suşlarında Nesil için Yeşil Canavar Süreci

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Yeşil Canavar yöntemi bir muhabir gen kodlaması yeşil flüoresan protein ile işaretlenmiş birden silme hızlı montaj sağlar. Bu yöntem, tekrarlanan delesyonlar cinsel çeşit döngüleri ve daha fazla silme taşıyan hücrelerin floresan merkezli zenginleştirme yoluyla maya suşu sürüş dayanmaktadır.

Cite this Article

Copy Citation | Download Citations

Suzuki, Y., Stam, J., Novotny, M., Yachie, N., Lasken, R. S., Roth, F. P. The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions. J. Vis. Exp. (70), e4072, doi:10.3791/4072 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Bir gen delesyonu için fenotipleri sık mutasyon belirli bir genetik arka plan veya çevre koşulu 1,2 test olduğunda ortaya çıkar. Birçok gen gizli gen fonksiyonlarının 3,4 maskesini düşürmeye silinmesi gerekir örnekleri vardır. Önemli buluşlar için potansiyeline rağmen, üç veya daha fazla geni içeren genetik etkileşimler büyük oranda araştırılmamıştır. Multi-mutant etkileşimleri kapsayan taramalar delesyonlar olası kombinasyonların çokluğu nedeniyle pratik olmaz. Bununla birlikte, böyle bir ortak işlev şekilde daha büyük bir önsel şans ile paraloglarına setleri gibi genler, seçilmiş kümelerinin çalışmalar bilgilendirici olacaktır.

Mayası Saccharomyces cerevisiae, gen nakavt homolog rekombinasyon yoluyla, seçilebilir bir işaretleyici gen ile değiştirilmesi ile gerçekleştirilir. Belirteçlerinin sayısı sınırlı olduğundan, yöntemler sam kaldırılması ve yeniden kullanmak için geliştirilmiştir e işaretleyici 5,6,7,8,9,10. Zaman elde edilmesi için silme sayısı ile doğrusal ölçekler gereken Bununla birlikte, bu yöntemler kullanılarak ardışık olarak çoklu mutasyonlarla mühendislik zaman alıcıdır.

Burada rutin maya 11 birden silme mühendisliği için Yeşil Canavar yöntem açıklanmaktadır. Bu yöntemde, silmeler içine entegre bir yeşil flöresanlı protein (GFP) raportör her bir suş içinde yer silme sayısı (Şekil 1) 'e göre kantitatif etiket suşları için kullanılır. Maya çiftleşme ve mayoz ile GFP işaretlenmiş delesyonlar ürün yelpazesine Tekrarlanan mermi suşlarında delesyonlar birikimi (Şekil 2) neden bu delesyonlar fazla taşıyan suşlarının akış sitometrik zenginleştirme ile birleştiğinde. , Tur başına bir veya daha fazla silme içeren her işlem ile paralel olarak çoklu süreçleri Sahne suşu yapımı için gereken süreyi azaltır.

content "> İlk adım haploit tek mutantlar adlandırdığı hazırlamaktır 'ProMonsters,' bir GFP silinmiş bir odağı muhabiri ve 'araç birini taşıyan her biri lokus-Ya Yeşil Canavar GMToolkit-Bir ya GMToolkit-α .. can1Δ yerinin (Şekil 3) maya silme toplama 12 den suşu kullanılarak, GFP-işaretli silmeler uygun bir evrensel GFP ile bu suşların içinde mevcut ortak KanMX4 kaset değiştirerek elde edilebilir - URA3 fragmanı her GMToolkit içerir: bir ya da - ya da α-çiftleşme-tipi-spesifik haploid seçim işaretleyici her ikisi de 1 ve tam olarak GMToolkits mevcut olduğunda, toplu olarak diploid seçimine izin veren, bu iki belirteçlerinden biri.

İkinci adım, silme loci rasgele yelpazesine ve / veya mayotik recomb ile tek bir hücre içinde kombine edilebilir yoluyla cinsel bisiklet gerçekleştirmek için olançiftleşme ve sporlanma her döngüsünde eşlik asÙ.

Protocol

1. ProMonsters Üretimi

  1. Bir Teto 2-GFP işaretleyici ve dizileri ile primerler kullanılarak plazmid pYOGM012 (ampisilin direnci) dan URA3 işareti yükselterek evrensel GFP yedek kaset hazırlayın:
    GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCC CAAGCTCCTCGAGTAATTCG ve GGCGTTAGTATCGAATCGACAGCAGTATAGCGACCAGCATTCAC GTACCGGGTAATAACTGATATAAT (kalın bölgeler hedeflenen değiştirme sağlayarak KanMX4 kaset komşu bölgelere homoloji sağlamak). PCR reaksiyonu Phusion polimeraz, HF tampon, ve 0.5 ng / ml 'den, şablon DNA konsantrasyonu ile başlayarak% 3 dimetil sülfoksit (New England Biolabs) ile yapılmalıdır. PCR programı 98 10 sn 30 sn ve 98 ° C 35 döngüleri ° C, 49 ° 30 sn için C ve 1.5 dakika boyunca 72 ° C'dir. Reaksiyon hacim, her bir deney için yeterli dönüşüm DNA sağlamak için> 50 ul olmalıdır. Biz arındırmakSütun başına işlemden PCR reaksiyon ~ 50 ul ile bir QIAquick PCR saflaştırma kiti (Qiagen) kullanılarak, fakat saflaştırma adımı atlama ürün transformantlar verimini artırır.
    Alternatif olarak, kısıtlama enzimi EcoRI (New England Biolabs) kullanarak, plazmid pYOGM057 (ampisilin direnci) ile sindirerek, hedefleme Teto 2-GFP ve KanMX4 için homolog URA3 belirteçler, hem de bölgeler içeren bir parça serbest bırakın. Bu reaksiyon için DNA konsantrasyonu yaklaşık 30 ng / ul olması gerekir. Reaksiyon hacmi> 34 ul olmalıdır.
    KanMX4 başka bir bölgeye GFP kaset entegre etmek için, uygun homolog dizileri yukarıdaki PCR primerleri, bir homoloji bölgesi ayarlayın.
  2. Evrensel GFP silme kaset ile KanMX4 maya nakavt koleksiyonu 12 bir bir-haploid zorlanma Transform. Woods ve Gietz 13 .34 ul protokolü takibenDNA örneği (arıtılmış PCR ürünleri ya da non-saflaştırılmış kısıtlama digest) her bir deney için dönüşüm kullanılır. Levha bir CAA-Ura plaka üzerine dönüşüm karışımının beşincisi (% 0.67 maya azot baz,% 2 glikoz,% 0.6 casamino asit,% 0.0025 adenin hemisulfate,% 0.005 triptofan ve% 2 agar).
  3. Izole koloniler elde etmek için taze CAA-Ura plaka transformantlar dışarı Streak.
  4. Büyüme eksikliği teyit etmek için 200 ug / ml G418 içeren bir YPDA plaka üzerine bir koloniden hücre transfer edin. (1.9) koloni PCR işlemi gerçekleştirmek için - Başarılı GFP entegrasyonu onaylamak için, adımları (1.5) izleyin.
  5. Bir 0.2-mL PCR tüp veya bir 96-kuyulu plakanın bir kuyu içinde lizis tamponu 2 ul (0.1 M sodyum fosfat, pH 7.4, ZymoResearch 1 birim zymolyase) içine bir koloniden alınan hücreler ekleyin. Bir pipet içinde ve dışında çözüm pipetleme karıştırın.
  6. Bir P200 Pipetman (Gilson) kullanılarak mineral yağ, bir damla (yaklaşık 20 ul) ile Kaplama.
  7. 37 ° karışımı inkübe95 dakika sonra 20 ° ve 10 dakika süreyle C'de.
  8. 50 ul su ile lizat seyreltin. On kez ve çözüm pipetleme karıştırın.
  9. Yukan doğru komşu bölgeye anneals sıra CCTGAGAAAGCAACCTGACC (kaset başlangıcından itibaren 285 bp), bir astar ile eşleştirilmiş (A) bir ileri primer ile 10 ul PCR reaksiyonları kullanılarak lizat 1 ul, (B), bir ters analiz Astar, sıralı GCATTGGGTCAACAGTATAG (ucundan 375 bp), bir astar ile eşleştirilmiş aşağı bölge için anneals (C) iki dizileri CGTACTCCTGATGATGCATG ve (181 bp) ile GACGAAATACGCGATCGCTG KanMX4 için tavlama primerler, ve (D) iki primer ki hedef geni (Şekil 4) ve vahşi tip sıra ile tavlama. Silme koleksiyonlarında suşların yaklaşık% 8 anöploidi 14 içerdiği bilinmektedir, çünkü (D) çok önemlidir. Doğru bir transformant ile pozitif olması gerekir (A) ve (B), ve negatif ile (C) ve (D).
  10. Bir tanıtmakTransformatant içine GMToolkit, bir 1.6 ml Eppendorf tüpüne dönüştürülmüş suşundan yaklaşık 250,000 hücre ve ya RY0146 (GMToolkit-a içeren) ya da RY0148 (GMToolkit-α içeren), 250.000 hücre ekleyin. Vortex. RY0146 ve RY0148 bir genotip olan MATα lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-a [CMVpr-rtTA KanMX4 STE2pr-SP-his5] ve MATα lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-α [CMVpr-rtTA NatMX4-STE3pr LEU2], sırasıyla. pr organizatörü gösterir. Hücre sayısı, yukarıdaki kültür optik yoğunluk ile tahmin edilir olmalıdır.
  11. 2 dakika süreyle 800 xg'de santrifüjleyin.
  12. Süpernatantı.
  13. Hava değişimi için izin vermek için,% 70 etanol ile muamele bir raptiye kullanarak kapağı üzerinde bir delik açın.
  14. YPDA ortamı (% 1 maya özü,% 2 pepton,% 2 glikoz, ve ağırlıkça% 0.003 'adenin hemisulfat 50 ul eklee). Vortex.
  15. 5 dakika boyunca 800 xg'de santrifüjleyin.
  16. Nemli bir kutuda tüpü yerleştirin. Bu boş bir ipucu kutusu, küçük bir ipucu standı ve ıslak bir kağıt havlu ile oluşturulabilir.
  17. 30 geceleme kutu inkübe ° C.
  18. Ilk CAA-Ura plaka hücreleri sürerek evlendirilen diploidlerin seçin. Bir gün için, 30 ° C plaka inkübe edin.
  19. Diploid seçilmesi için 200 ug / ml G418 içeren YPDA plakalar üzerinde koloniler izole (% 1 maya özü,% 2 pepton,% 2 glikoz,% 0.003 'adenin hemisulfate ve% 2 agar) yapmak için toplu alanı, iz bunları hücre dışı bırakılması içeren GMToolkit-a ya da 100 ug / ml nourseothricin (Nat) GMToolkit-α içeren diploid seçilmesi için 15.
  20. 3 gün için 30 ° C 'de plaka inkübe edin.
  21. Izole edilmiş bir koloniden başlayarak, agar olmaksızın GNA ortam 500 ul için en hücrelerin aktarmak (% 1 maya ekstresi,% 3 Difco besin et suyu ve% 5 glükoz; otoklav glikoz ve t geri kalanıO bileşenleri ayrı olarak kapaklı bir 5 ml kültür tüpüne karamelizasyon önlemek için 2 × çözümler) gevşetti.
  22. 30. az beş saat için yatay olarak tüp döndürme ° C. Dönme ekseni borunun uzunlamasına eksenine paralel olması gerekir.
  23. Kullanılan bu koloniler onaylayın (1.21) Ura olan + a CAA-Ura plaka üzerinde onları sürerek.
  24. 2 dakika boyunca 800 xg'de tüp santrifüjleyin. Süpernatantı atın.
  25. Minimal sporlanma orta (; filtresi sterilize% 1 potasyum asetat, 0.005% çinko asetat) 500 ul ekleyin. Vortex.
  26. 2 dakika boyunca 800 xg'de tüp santrifüjleyin. Süpernatantı atın.
  27. Tekrarlama (1.25) - (1.26) iki kez.
  28. 7.5 ug / ml lizin, 7.5 ug / ml lösin, 5 ug / ml histidin, 5 ug / ml, metiyonin, ve 1.25 ug / ml urasil (okzotrofik soylar arasında sporlanma oranını artırmak için) ilave edilmiş asgari sporlanma orta 1 ml ekleyin . Vortex.
  29. Bir gün için oda sıcaklığında tüp döndürün.
  30. 2 gün boyunca 30 ° C'de tüp döndürün.
  31. 2 dakika boyunca 800 x g, 1.6 ml'lik Eppendorf tüpü içinde bu karışımdan 125 ul santrifüjleyin. Süpernatantı atın.
  32. Zymolyase çözeltisi (100 mM sodyum fosfat tamponu, pH 7.4, sorbitol 1 M, ve ZymoResearch 2 adet zymolyase) 50 ul ekle. Bir pipet içinde ve dışında çözüm pipetleme karıştırın.
  33. 1 saat boyunca 30 ° C'de inkübe edin.
  34. % 0.02 NP-40 50 ul ekle. Bir pipet içinde ve dışında çözüm pipetleme karıştırın.
  35. Beş dakika için oda sıcaklığında bırakın tüp.
  36. Su 500 ul ekleyin.
  37. Buz üzerinde tüp yerleştirin.
  38. Sonifier 450 (Branson) ile 3.2 mm mikrotip kullanarak 15 saniye için 1 çıkış ayarı (zayıf ayar) iki kez bu karışım sonikasyon. Sonikasyon ve iki tur arasında, ~ 0 ° C'ye kadar ısı geri dönmek için buz üzerinde tüp yerleştirmek
  39. 5 dakika boyunca 800 xg'de tüpler santrifüjleyin. Süpernatantı atın.
  40. SC-Ura-His 200 ul ekleyin(A) ya da çapraz-GMToolkit bir ya da GMToolkit-α içeren için olmasına bağlı olarak SC-Ura-Leu (α) ortam. Ortam hazırlamak için, SC-Ura-His-Leu ortam (% 0.67 maya azot baz,% 2 glikoz,% 0.01 'arginin, aspartik asit,% 0.01,% 0.01' glütamik asit, izolösin% 0.01,% 0.01 lisin, metiyonin% 0.01 yapmak ,% 0.01 fenilalanin,% 0.08 serin,% 0.04 treonin,% 0.002 tirozin,% 0.03 valin, 0.0025% adenin,% 0.005 triptofan, 0.003% adenin ve 0.005% triptofan) ve steril histidin veya lösin ile ek Kullanmadan önce % 0.01 nihai konsantrasyonu.
  41. % 70 etanol ile muamele bir raptiye kullanarak kapağı üzerine bir delik açın.
  42. 2 gün için 30 ° C 'de yatay boru döndürün. Dönme ekseni borunun uzunlamasına eksenine paralel olması gerekir.
  43. Bir SC-Ura-His veya SC-Ura-Leu agar (yukarıdaki gibi aynı maddeleri artı% 2 agar hücreleri Streak, treonin ve aspartik asit bir süre sonra eklenmesi gerekirutoclaving; ProMonster suşları için izole koloniler yapmak) dökülmeden önce histidin veya lösin ekleyin.

2. Cinsel Bisiklete binme

  1. 100 SC-His ul (a) ya da 30 çiftleşme tipine bağlı olarak SC-Leu (α) kurulu bir GFP silme gerginlik bir kültür döndürme ° C de bir gece, 1.6 ml'lik Eppendorf tüpü kullanılarak. Hava değişimi için,% 70 etanol ile tedavi edilen bir raptiye kullanarak bir delik açın. Yatay tüp döndürün. Dönme ekseni borunun uzunlamasına eksenine paralel olması gerekir. Bu topluca çiftleşme yoluyla birden suşları geçmek mümkündür. Sıralanmış bir örnek, doğrudan 2 gün için 30 ° C 'de 200 ul Bu amaçla, kültür hücreleri için kullanıldığı zaman. SC-Ura-His-Leu-orta ve histidin (% 0.01) ya da lösin (0.01%): orta hazırlamak için, urasil (0.0025 ile% nihai konsantrasyon) ilave edilir.
  2. 1.6 ml Eppe 250.000 a-haploid hücrelerin ve GFP silinmesi suşların 250,000 α-haploid hücrelerin Mixndorf tüpü. Vortex.
  3. (1.17) - aşağıdaki adımları (1.11) tarafından bu hücrelerin çiftleşirler.
  4. Gevşeyen bir kapak içeren bir 5 ml'lik kültür tüpü içinde 200 ug / ml G418 ve 100 ug / ml Nat ihtiva eden 500 ul ortam GNA ile çiftleşme karışım 10 ul aktarın. Başlangıç ​​OD 600 kabaca 0.1.
  5. 24 saat süre ile 30 ° C 'de kültür döndürün. Tek diploid hem de KanMX4 içeren, çünkü bu diploid bir seçimine olanak tanıyan GMToolkit-a GMToolkit-α ve NatMX4 G418 ve Nat varlığında (Şekil 3) büyüyebilir.
  6. Ve G418 içeren taze Nat GNA 500 ul için bir günlük kültür 20 ul aktarın. Başlangıç ​​OD 600 kabaca 0.2.
  7. Log faz (~ 1 OD 600) hücre getirmek için 5 saat boyunca 30 ° C'de tüp döndürün.
  8. Diploidlerin biçime girdiklerinde ve sporlar izole etmek (1.38) - adımları (1.24) izleyin.
  9. İki 300-ul içine sporlu hücre süspansiyonu bölmekparça ve ayrı 1.5 ml Eppendorf tüp içine her koydu.
  10. 5 dakika boyunca 800 xg'de tüpler santrifüjleyin. Süpernatantı atın.
  11. Bir tüp pelet için, bir-haploidlerin seçmek için SC-His ortam 100 ul ilave edin. Diğer tüp pelet için, α-haploidlerin seçmek için SC-Leu ortam 100 ul ilave edin.
  12. 30 ° C'da gece boyunca tüp döndürün. Nihai OD 600 0.5 'den daha az olmalıdır. OD 600 çok yüksek olması durumunda, oda sıcaklığında kültüre deneyin.
  13. GFP indüklemek için, taze SC-His (a) veya 20 ug / ml içeren doksisiklin SC-Leu (α) ortamı. 100 ul ekle Doksisiklin nihai konsantrasyon 10 ug / ml 'dir. Vortex.
  14. 2 gün boyunca 30 ° C'de tüp döndürün.

3. Akış Sitometri

  1. Kapak ile birlikte bir 5-ml polipropilen tüp (BD Falcon # 352063) ile 10 ug / ml doksisiklin içeren ön-filtre TE tamponu, 900 ul (pH 7.5) ekleme ile değiştirilir hücre5 ml polistiren tüp süzgeç başlığı (BD Falcon # 352235). Polipropilen tüplere akış sitometrisi için uygundur. Süzgeç kapak büyük partikülleri için tercih edilir.
  2. Yavaşça hücre-süzgeç kapağı doksisiklin TE tampon 75 ul yerleştirin.
  3. Kapak üzerinde çözelti ile indüklenen hücre 25 ul ekle.
  4. Örgü karşı Pipetman ucu basarken, süzgeç vasıtasıyla birleştirilmiş çözeltinin her vur.
  5. Süzgeçli kap ve vorteks tüpü aşağı doğru bastırın.
  6. SC-Onun veya SC-Leu 200 ul dolu toplama tüpleri (1.6 ml Eppendorf tüpleri) hazırlayın.
  7. Hücre sıralayıcı başlatın ve üreticinin kılavuzuna göre ayarlar.
  8. Vorteks toplama tüpü (mont orta duvara) ve hücre sıralayıcı üzerine yerleştirmeden önce hücreleri içeren tüp hem.
  9. Örnek akım sitometri verileri edinin. GFP içermeyen A cins bir negatif kontrol edilebilir.
  10. Sıralama için kapıları çizin. (A)Yüksek GFP yoğunluğu sergilerler ki hücre agrega, önlemek için, FSC yüksekliği arsa ve FSC kullanarak darbe genişliği ve darbe yükseklik MoFlo sıralayıcı veya orantısız küçük FSC yükseklikte bir komplo kullanarak ileri saçılım (FSC) için orantısız büyük darbe genişliği ile sapan atmak FACSAria sıralayıcı (Şekil 5, sol üst panel) alanı. (B) büyük FSC (bölge) hücre agregatları için beklendiği için, en düşük FSC ve yan saçılma (SSC) hücre artıkları sık sık bulunan değerlere sahip bölgeler kaçınarak sadece FSC, daha düşük% 20 hücreleri alır (Şekil 5, sağ üst panel). (C) SSC (bölge) ve GFP sinyali (bölge) genellikle pozitif bir korelasyon vardır. Sadece yukarıda verilen giriş kapıları parlak hücrelerin alma için de yüksek bir değer SSC olan hücreler için zenginleştirmek ki, her bir nokta en parlak hücrelerin benzer bir yüzdesi almak için GFP yoğunluk ve SSC, bir arsa kullanılarak nüfusun çevresi boyunca bir geçit çekmek SSC ekseni (Şekil 5, Bott arasında) diyagramı om-sol. (C) olarak seçilmiş nüfus (B) 'de seçilen nüfusun% 0.1-1 olması gerekir.
  11. (3.10) deki kriterlere verilen toplama tüpüne 200 hücre sıralayın. Gerektiği gibi topluca süreci için veya daha karmaşık bir nüfus gerektiren diğer projeler için, daha fazla hücre sıralayabilirsiniz.
  12. Vorteks toplama tüpü orta kriteri hücreleri kapsayacak.
  13. Levha genotipleme için bir YPDA plaka üzerinde hücrelerinin bir alt kümesi (örneğin, 50 hücreleri).
  14. 2 gün boyunca, 30 ° C plaka inkübe edin.
  15. (1.8) - adımları (1.5) takip ~ 12 sömürgeler için bir lizat olun.
  16. Nazikçe ucu ile plaka dokunarak G418 ve Nat içeren bir YPDA plaka üzerinde bir nokta için kullanılan ucu (1.5) üzerinde kalan hücreler aktarın. Seçilmiş haploidlerin Bu plaka üzerinde büyümesini değil. Diploid daha GFP kopya sahip olabilir ve bu nedenle daha parlak olabilir. Bu test haploid seçimi verimliliği gösterebilir.
  17. Genotipleme için, 10-ul PCR r kullanarak lizat 1 ul analizdizisi CCTGAGAAAGCAACCTGACC bir astar ile eşleştirilmiş Silinen her genin memba komşu bölgeye anneals bir ileri astar ile eaction.
    Multiplex PCR reaksiyonları mümkünse (koşulların tek mutantlar lizatları kullanılarak tespit edilebilir). Ya da 384-kuyucuklu biçim - PCR, 96 içinde yapılabilir. Bu ikinci biçim az 5 ul'lik reaksiyon hacmi için uygundur. PCR usta Arraying primerler ve bu karışımları ile hücre lizatları ayrıca bir çok kanallı bir pipet ya da bir sıvı taşıma robot ile gerçekleştirilebilir farklılaşan bir araya getirmektedir. Farklı PCR karışımları ile aynı lizat eklerken kriteri değişiklikler isteğe bağlıdır.
  18. PCR ürünleri analiz edin. Jel XL Ultra V-2 elektroforez sistemi (Labnet) çok kanallı pipetler kullanılarak numune yükleme ile uyumludur.
  19. Bilgi (3.16) ve (3.18) göre, genotipler istenen var olasılıkla haploidlerin tespit.
  20. Taze bir tabak (YPDA, CAA-Ura, ya SC-Ura-His/Leu) bu suşların oluşturulması. Ayrıca, bunları dondurmak-80 Az% 25 gliserol ° C. Bu silinen genler ve pulsed-field jel elektroforezi için vahşi tip dizilerinin yokluğu onayı gibi ek testler önerilmektedir.
  21. Kullanışlı suşları ile cinsel bisiklet (2.1) tekrarlayın.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Dört GFP işaretli delesyonlar (ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) taşıyan bir-haploid zorlanma dört delesyonlar taşıyan bir α-haploid zorlanma ile geçti edildiğinde (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ), iki silme ile (ycl033cΔ yer042wΔ) iki suş, bir temsilcisi tarafından paylaşılan sonucu elde edilmiştir. Çiftleşme karışımı diploidlerin seçmek için G418 ve Nat içeren YPDA ortamda kültüre edildi. Elde edilen diploid sporlanma ortam içinde kültür edildi. Sporlar zymolyase tedavi ve sonication tarafından dağıtıldı, ve haploid seçimi medya çimlendirilmiştir. Hücreler daha sonra GFP ifade etmek için oluşturuldu. Bir akış sitometresinin kapıları kullanarak, hücre populasyonunun enkaz veya hücre agrega (Şekil 5) barındırması muhtemel olduğunu seçildi. Bu popülasyonda, hücrelerin en parlak% 1 dizildi. Sıralama hücreleri ve ayrılmamış olan hücreler genotipionlar bir plaka üzerinde koloniler kurdu sonra yazdınız. Rastgele seçilen koloniler bazı diploidlerin yeteneğini kazanmış olduğunu düşündüren, G418 ve Nat, sıralanmamış örnek için büyüdü 16 kolonilerin 2 üzerinden gelen hücreler ve kriteri örnek için büyüdü 26 kolonilerin 18 üzerinden hücreleri içeren bir YPDA plaka üzerinde çizgili edildiğinde haploit seçim işaretleyici ifade ve bu deneyde haploit seçim ve GFP-indüksiyon aşamasında bulaşan. Diploidlerin daha büyük GFP sayıda fakat içerdikleri kopyalar tahminen nedeniyle kriteri örnek zenginleştirilmiştir. Haploidlerin PCR ile analiz edildiğinde, kriteri hücrelerde delesyonların ortalama sayısı ± 0.4 5.1 (n = 8; SEM gösterilir). Bu hücrelerin dördü bu çapraz altı delesyonlar, silme maksimum mümkün numarası vardı. Sıralanmamış örnek haploidlerin 3.4 vardı ± ortalama 0.2 silmeler (n = 14).

Ayrı bir deneyde, yedi GFP işaretli delesyonlar (ye taşıyan bir-haploid gerilimler042wΔ yer108cΔ yfr057wΔ ykl069wΔ ykr011cΔ ylr123cΔ yol118cΔ) sekiz delesyonlar taşıyan bir α-haploid zorlanma ile çizilmişti (ycl033cΔ ydl227cΔ ydl242wΔ yer042wΔ yer108cΔ yfr057wΔ ygl109wΔ ykr011cΔ), dört ortak delesyonlar ile (yer042wΔ yer108cΔ yfr057wΔ ykr011cΔ) iki suş yer. Diploid sporlanma ortam içinde seçilmiş ve daha sonra kültüre edildikten sonra, hücrelerin yaklaşık% 20'si mikroskopik gözlem (n> 100) esas sporlu. Sporlar dağınık ve çimlendirilmiştir sonra, elde edilen haploidlerin ekspres GFP ile indüklenen edildi ve yukarıdaki gibi floresan göre sıralanır. 61 rastgele seçilen hücrelerin sadece bir kriteri hücreler ağırlıklı haploid olduğunu düşündüren, G418 ve Nat içeren bir YPDA plaka üzerinde büyüdü. PCR (Şekil 6) ile incelendiğinde, sıralanmış hücreleri 8.8 ortalama silinmesi numarası vardı ±0,3 (n = 12; SEM gösterilir), on silmeleri ihtiva eden beş hücreleri dahil olmak üzere. Rastgele segregasyon kaynaklanan Sıralanmamış bir hücre için delesyonların beklenen sayısı 7.5 idi.

Şekil 1
Şekil 1. Mikroskop altında yeşil canavarlar. Floresans mikroskop olmayan bir mutant suşu (solda), bir ProMonster suşu (orta) ve 16-GFP canavar suşu (sağda) gösterir. Özdeş pozlama, parlaklık ve kontrast ayarlarını görüntüler için kullanılmıştır.

Şekil 2,
Şekil 2. Yeşil Canavar süreci. Tek mutant haploidlerin (açık yeşil) düzeni şeklindeki vardır. Şeklindeki bir diploid sporlanma sırasında Mayotik rekombinasyon 0-GFP hücreleri (off-white), 1-GFP hücrelerinin (açık yeşil) ve 2-GFP hücreleri (koyu yeşil) oluşan bir karışım oluşturur. Akışsitometrisi 2-GFP hücreleri için zenginleştirilmiş yeşil hücreleri seçmek için kullanılır. Entegre moleküler araçlar-haploidlerin (O'nun +), α-haploidlerin (Leu +) ve diploid (G418-ve Nat-direnç) seçilmesine olanak tanır. Bu döngü değişikliklerin giderek artan numarasını taşıyan suşlar için zenginleştirmek için tekrarlanır.

Şekil 3
Şekil 3,. GFP silme kasetleri ve GMToolkits. GFP silme kasetlerin bir GFP muhabiri gen ve bir mantar dönüşüm belirteci (URA3) içerir. Teto 2 promotör rtTA transkripsiyon faktörünün hareket yoluyla orta içinde doksisiklin ilavesiyle indüklenebilir olup. GFP düzeyde protein yapmak için veya herhangi bir toksik etkisi tolere hücrelerin maksimum kapasitenin ulaşırsa, ifade doksisiklin konsantrasyonunu düşürerek basılı tutularak aranabilir (yaptığımız Ancak unutmayın Hatta GFP 16 kopya) ile bu doygunluk veya toksisite etkileri uygulamıyor. Bu kaset PCR kullanarak belirli homolog dizileri takarak herhangi bir genin veya bölgeye hedeflenebilir. Alternatif olarak, aynı homolog sekansları ile evrensel GFP etme kasetinin uygun maya nakavt koleksiyonu suşlarında KanMX4 'açılış yastıkları' için hedef olabilir. YFG favori gen gösterir. Dikey çizgilerle Kutu DNA barkod gösterir. GMToolkits CAN1 odağı entegre edilmiştir. STE2-his5 işaretleyici ve STE3-LEU2 işaretleyici sadece bir haploidlerin-histidin ve sırasıyla, lösin yokluğunda büyüme sadece α-haploidlerin yokluğunda uzamasına izin vermek haploidlerin bir eşleşme tip özel bir şekilde ifade edilir. G418 ve Nat karşı direnç için seçme eşzamanlı olarak bir GMToolkit içinde KanMX4 lokus ve diğer NatMX4 lokusu için seçilir ve bu nedenle diploid için seçilir.

_content "fo: keep-together.within-page =" always "> Şekil 4,
Şekil 4. GFP kaset doğru bir şekilde entegre doğrulanması. Evrensel bir GFP kaset bir GFP-işaretli silme için maya silme toplama içinde mevcut olan herhangi bir KanMX4-işaretli silme dönüştürmek için kullanılabilir. Memba sınırdaş bölgeye anneals kaset başında (Adım 1.9 PCR A) anneals bir bant yapmak gerektiğini bir ters astar ile eşleştirilmiş bir ileri astar ile doğru oluşturulan GFP silinmesi alleli ile, PCR reaksiyonu. Aşağı komşu bölgeye anneals kaset (PCR B) sonuna anneals bir ürün yapmak gerektiğini ileri astar ile eşleştirilmiş bir ters astar ile PCR. KanMX4 kaset (PCR C) içerisinde ya da hedef gen PCR (D) vahşi tip sıra için iki primer tavlama ile tavlama iki primer ile PCR bir grup üretmek gerekmektedir. Kırmızı ok bir PCR primer gösterir. Bracket bir PCR reaksiyonu ile amplifiye bir bölgesini göstermektedir. Kutu GFP kaset (yeşil), KanMX4 kaset (sarı) ya da favori gen (YFG, gri) gösterir. Siyah çizgi bir maya kromozomu bir taarruzda sırayı gösterir.

Şekil 5,
Şekil 5,. Flow sitometri. Iki suş, genotip ile bir bir haç, bu denemeyi, haploit döl yılında ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ ve genotipi ile diğer ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ GFP ifade oluşturuldu. Her gen delesyonu bir GFP kaset vardı. Forward scatter alanı ve forward scatter yüksekliği (P1), orantısız büyük forward scatter alanı dışı bırakıldı sahip olma eğilimindedir hücre agrega (dayanarak gating hücreleri tarafından. Forward scatter ve yan dağılım (P2), ce dayanarak gating hücreleri tarafındandüşük ileri saçılım ve yana saçılım ile enkaz hariç ise forward scatter daha düşük% 20 lls kabul edildi. Yan saçılma ve GFP sinyali (P3) temelinde gating hücreler tarafından, belirli bir yan dağılım aralık içinde olanlar arasında daha flöresanlı hücre alınmıştır. Ekspres GFP, P3 nüfus seçilmesi için kullanılan ile aynı bir kapı negatif kontrol benzer bir şekilde seçilen hücreler için bir diyagramı gösterilmiştir etmez mayotik karışımı ve negatif kontrol numunesi ile karşılaştırılması izin verilmesi.

Şekil 6
Şekil 6. Kriteri suşları genotipleme. PCR alt-komşu bölgeye anneals bir ileri primer ile eşleştirilmiş bir ters primer kullanılarak gerçekleştirildi ki kaset sonuna anneals. Bant varlığı GFP kasetin varlığını gösterir. Ayrı bir deney, oniki suşları con tümyer042w Δ silinmesi ve ykr011c Δ silme tain.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Biz Yeşil Canavar yaklaşım geliştirdi olarak, genom düzenlenmesi giden, farklı GFP yedek kasetler arasındaki rekombinasyon olasılığı ile ilgiliydi. Bu olasılığa karşı Azaltıcı başarıyla çiftleşme ve mayoz çok sayıda mermi geçirmiş hücreleri için bizim seçimdir. Düzenlenmeyecek genomları taşıyan hücreler özdeş düzenlenmesi olmadan hücrelerine çiftleşme sonrası daha az uyumlu olması beklenmektedir. Nitekim, biz GFP kasetler 11 arasındaki rekombinasyon kaynaklanan herhangi bir genom istikrarsızlık dikkat etmedi. Ancak, biz tamamen bu durum gözardı edilemez, bu nedenle kullanıcıların yeniden düzenlenmesi için oluşturulan suşların sınamanız önerilir. Atımlı-alan jel elektroforezi brüt anormallik tespit etmek için de kullanılabilir. Silme içinde dizileri için tavlama primerlerle PCR yabani-tip sekansların yokluğunu doğrulatmak üzere kullanılabilir.

Kurulan suşları, GF floresans seviyeleri dayanarakP yoğunluğu doygunluk birine 16 silme 11 test aralığında bir sorun olmadığını düşündüren, silme sayısı ile yakın bir doğrusal bir ilişki vardı. Ancak, hatta birçok olmayan örtüşen delesyonu olan suşlar ile sonraki turlarda, biz iki ebeveyn tüm delesyonlar birliği taşıyan teorik bir hücre ise, kabaca iki her turda tarafından nüfus delesyonların ortalama sayısını artırmak sadece başardık GFP seçimi için mükemmel sertlik elde olsaydı suşları seferde kombine edilebilir. Bir sınırlama izogenik hücreleri arasında GFP yoğunluğu hücre-hücre çeşididir. Temsilcisi Sonuçlar, ikinci örnekte, nüfus içerisindeki hücrelerin sadece% 0.8 bu çapraz (11 delesyonlar dört ebeveyn haploidlerin ikisi tarafından paylaşıldı) mümkün olan tüm 11 delesyonlar olması beklenir. Bununla birlikte, daha bol on-silme suşları GFP bir yoğunluk dağılımına sahip olacaktır üzerine binen 11 silme stra kiins. Bu nedenle, nüfusun da küçük bir kısmı tercihen 11 silme suşu GFP yoğunluk dağılımının daha yüksek bir kuyruk 11 silme suşları seçmek için seçilmelidir. Bir çözüm basitçe yüksek GFP yoğunluğu ile nadir hücreleri sıralamak eşiğini yükseltmek olabilir. Başka bir çözüm, aynı anda aynı Teto 2 promotör ile ifade dahili bir standart tek bir kopya olarak mevcut olan bir başka rengi bir flüoresan raportör protein, ölçmek için olabilir. Bu strateji böylece normalize GFP yoğunluğu ölçümleri 16,17 hücre-hücre varyasyon azaltmak için dışsal gürültüleri beklenir.

Nadir çoklu mutantlar elde zorluk bu suşların potansiyel olarak yavaş büyüme oranı da şiddetlenir. Çok-mutantları akış sitometresi ile zenginleştirilmiş, ancak bunlar montajcı tarafından kardeşler işleminin geri kalanı boyunca outcompeted edilebilir. Nesiller sayısını en aza indirmek içinmaya suşları geçmesi, her aşamada seçilen istenilen ploidi hücrelerinin sadece yeterli amplifikasyon sağlayan küçük kültür hacimleri öneriyor.

Birden çok silme çevrim başına elde edilebildiği için, Yeşil Canavar yöntem daha hızlı bir şekilde ardışık yöntem 11'den daha çok mutant monte etmek için de kullanılabilir. Delesyonlar belirli altkümelerini sentetik ölümcül ilişkiler varsa, 'çıkmaz' sıralı yaklaşımları ile karşılaştı olabilir. Bu sınırlama Yeşil Canavar yaklaşım ile atlatılabilir delesyonların tam set biriken yönelik olası yollardan uzaydan hangi örnekler. Yeşil Canavar sürecinin daha paralel topluca sürümünü silme büyük tolere numaraya ulaşmak için bir yol bulmada faydalı ispatlamak zorundadır.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Çıkar çatışması ilan etti.

Acknowledgments

Bu çalışma FPRFPR için YS, rsl Alfred P. Sloan Vakfı tarafından sağlanan hibe ve Sağlık hibe US National Institutes R01 HG003224 ve R21 CA130266 için ABD Savunma Bakanlığı İleri Araştırma Projeleri Ajansı sözleşme N66001-12-C-4039 tarafından desteklenen oldu Ayrıca İleri Araştırma Kanada Enstitüsü bir burs ile ve Kanada Mükemmellik Araştırma Sandalyeler program tarafından desteklenmektedir.

Materials

Name Company Catalog Number Comments
G418 Sigma-Aldrich A1720 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 200 mg/ml. Store at 4 °C.
ClonNAT (nourseothricin) WERNER BioAgents 5001000 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 100 mg/ml. Store at 4 °C.
Doxycycline Sigma-Aldrich D9891 Dissolve in 50% ethanol and filter-sterilize (0.2-μm filter). Stock concentration: 10 mg/ml. Make fresh every four weeks. Shield from light using aluminum foil and store at 4 °C.
Zymolyase ZymoResearch E1005
Difco yeast nitrogen base w/o amino acids BD 291940
Revolver (rotator for tubes) Labnet H5600
Enduro Gel XL electrophoresis unit Labnet E0160
Sonifier 450 Branson 101-063-198
Microtip for Sonifier 450 Branson 101-148-062
FACSAria cell sorter BD
MoFlo cell sorter Beckman-Coulter
Biomek FX or equivalent robot Beckman Coulter Optional. For setting up genotyping PCRs.

DOWNLOAD MATERIALS LIST

References

  1. Tong, A. H., et al. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science's STKE. 294, 2364-23 (2001).
  2. Hillenmeyer, M. E., et al. The chemical genomic portrait of yeast: uncovering a phenotype for all genes. Science. 320, 362-365 (2008).
  3. Beh, C. T., Cool, L., Phillips, J., Rine, J. Overlapping functions of the yeast oxysterol-binding protein homologues. Genetics. 157, 1117 (2001).
  4. Wieczorke, R., et al. Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae. FEBS letters. 464, 123-128 (1999).
  5. Alani, E., Cao, L., Kleckner, N. A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics. 116, 541-545 (1987).
  6. Akada, R., et al. PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae. Yeast. 23, 399-405 (2006).
  7. Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic acids research. 24, 2519 (1996).
  8. Delneri, D., et al. Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system. Gene. 252, 127-135 (2000).
  9. Storici, F., Lewis, L. K., Resnick, M. A. In vivo site-directed mutagenesis using oligonucleotides. Nat. Biotech. 19, 773-776 (2001).
  10. Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast. Nucl. Acids Res. 38, 2570-2576 (2010).
  11. Suzuki, Y., et al. Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection. Nat. Methods. 8, 159-164 (2011).
  12. Winzeler, E. A. Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis. Science. 285, 901-906 (1999).
  13. Woods, R. A., Gietz, R. D. High-efficiency transformation of plasmid DNA into yeast. Methods Mol. Biol. 177, 85-97 (2001).
  14. Hughes, T. R., et al. Widespread aneuploidy revealed by DNA microarray expression profiling. Nature. 25, 333-337 (2000).
  15. Goldstein, A. L., McCusker, J. H. Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast. 15, 1541-1553 (1999).
  16. Newman, J. R. S., et al. Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise. Nature. 441, 840-846 (2006).
  17. Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. Gene regulation at the single-cell level. Science. 307, 1962 (2005).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics