The Green Monster Verfahren zur Erzeugung von Hefestämmen Buchwert Multiple Deletionen

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Das Green Monster Verfahren ermöglicht die schnelle Montage mehrerer Deletionen mit einem Reporter-Gen kodiert grün fluoreszierendes Protein markiert. Dieses Verfahren basiert auf der Fahrt Hefestämme durch wiederholte Zyklen von sexueller Sortiment von Deletionen und Fluoreszenz-basierter Anreicherung von Zellen, die mehrere Deletionen basiert.

Cite this Article

Copy Citation | Download Citations

Suzuki, Y., Stam, J., Novotny, M., Yachie, N., Lasken, R. S., Roth, F. P. The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions. J. Vis. Exp. (70), e4072, doi:10.3791/4072 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Phänotypen für eine Gendeletion angesehen offenbart nur, wenn die Mutation in einem bestimmten genetischen Hintergrund oder Umgebungsbedingung 1,2 getestet wird. Es gibt Beispiele, wo viele Gene müssen gelöscht zu entlarven versteckte Genfunktionen 3,4 werden. Trotz des Potenzials für wichtige Entdeckungen werden genetische Interaktionen mit drei oder mehr Gene weitgehend unerforscht. Ausgiebige Recherchen Multi-Mutante Interaktionen wäre unpraktisch aufgrund der schieren Anzahl der möglichen Kombinationen von Deletionen. Jedoch würde Untersuchungen ausgewählter Sätze von Genen wie Sätze von Paraloge mit einer größeren Wahrscheinlichkeit von vornherein mit einer gemeinsamen Funktion, informativ sein.

In der Hefe Saccharomyces cerevisiae, wird Gen-Knockout durch Ersetzen eines Gens mit einem selektierbaren Marker über homologe Rekombination erfolgt. Da die Anzahl der Markierungen begrenzt ist, wurden Verfahren zum Entfernen und Wiederverwenden des sam entwickelt e Marker 5,6,7,8,9,10. Jedoch ist sequentiell Engineering multiple Mutationen unter Verwendung dieser Verfahren zeitaufwendig, da die Zeit linear mit der Anzahl der Löschungen zu erzeugenden erforderlich.

Hier beschreiben wir die Green Monster Verfahren für die routinemäßige Engineering multiple Deletionen in Hefe 11. In diesem Verfahren wird ein grün fluoreszierendes Protein (GFP) Reporters in Deletionen integriert quantitativ Etikett Stämme gemäß der Anzahl von Deletionen in jedem Stamm enthielten (Abb. 1) verwendet. Wiederholte Runden des Sortiments von GFP-markierten Deletionen über Hefe Paarung und Meiose mit durchflusszytometrische Anreicherung von Stämmen mit mehreren dieser Deletionen führen zu einer Anhäufung von Deletionen in Stämmen (Abbildung 2) gekoppelt ist. Durchführen mehrerer Prozesse parallel mit jedem Prozess, die eine oder mehrere Deletionen pro Runde, verringert die für die Stamm Konstruktion erforderlich.

Inhalt "> Der erste Schritt zur Vorbereitung haploid Single-Mutanten genannt ist 'ProMonsters,' von denen jeder trägt einen GFP-Reporter in einem gelöschten Locus und einer der" Toolkit "loci, entweder Green Monster GMToolkit-a oder GMToolkit-α an der . can1Δ Locus (Abbildung 3) Verwenden von Stämmen aus der Hefe Deletion Sammlung 12 kann GFP-markierten Deletionen zweckmäßigerweise durch Ersetzen des existierenden gemeinsamen kanMX4 Kassette in diesen Stämmen mit einem Universal-GFP generiert - URA3 Fragment Jeder GMToolkit enthält:. entweder der a - oder α-Mating-typspezifischen haploiden Selektionsmarker 1 und genau eine der beiden Marker, dass, wenn beide GMToolkits vorhanden sind, kollektiv für die Auswahl der Diploide ermöglichen.

Der zweite Schritt besteht in der Durchführung der sexuellen Rad durch die Deletion Loci innerhalb einer einzelnen Zelle durch den zufälligen Auswahl und / oder meiotischen Recomb kombinierbarination, die jeden Zyklus der Paarung und Sporulation begleitet.

Protocol

Ein. Erzeugung ProMonsters

  1. Bereiten Sie die universelle GFP Austauschkassette durch Verstärken eines tetO 2-GFP-Marker und den URA3-Marker aus dem Plasmid pYOGM012 (Ampicillin-Resistenz) unter Verwendung der Primer mit Sequenzen:
    GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCC CAAGCTCCTCGAGTAATTCG und GGCGTTAGTATCGAATCGACAGCAGTATAGCGACCAGCATTCAC GTACCGGGTAATAACTGATATAAT (bolded Regionen bereitzustellen Homologie zu den flankierenden Regionen des kanMX4 Kassette ermöglicht gezielten Austausch). Die PCR-Reaktion sollte mit Phusion Polymerase, HF-Puffer und 3% Dimethylsulfoxid (New England BioLabs), beginnend mit der Matrizen-DNA-Konzentration von 0,5 ng / ul durchgeführt werden. Das PCR-Programm bei 98 ° C für 30 sec und 35 Zyklen von 98 ° C für 10 sec, 49 ° C für 30 sec, und 72 ° C für 1,5 min. Das Reaktionsvolumen sollte> 50 ul sein, um genügend DNA für jede Transformation Experiment liefern. Wir reinigendas Produkt mit einem QIAquick PCR Purification Kit (Qiagen) mit ~ 50 ul der PCR-Reaktion pro Spalte verarbeitet, aber das Überspringen der Reinigungsschritt kann die Ausbeute von Transformanten.
    Alternativ freizugeben ein Fragment, das den tetO 2-GFP und URA3-Marker sowie zur homologen Regionen kanMX4 Targeting, das durch Verdauen des Plasmids pYOGM057 (Ampicillinresistenz) mit dem Restriktionsenzym EcoRI (New England BioLabs). Die DNA-Konzentration in dieser Reaktion sollte ~ 30 ng / ul sein. Das Reaktionsvolumen sollte> 34 ul sein.
    Zum Integrieren des GFP-Kassette in einem anderen Bereich als kanMX4, passen die Homologieregion der PCR-Primer über den entsprechenden homologen Sequenzen.
  2. Transformieren eines a-haploiden Stamm von der kanMX4 Hefe knockout Sammlung 12 mit dem Universal-GFP Deletionskassette. Nach dem Protokoll von Woods und Gietz 13 0,34 ul derDNA-Probe (gereinigtes PCR Produkt oder nicht-gereinigten Restriktionsverdau) sind für jede Transformation Experiment verwendet werden. Platte ein Fünftel des Transformationsansatzes auf einen CAA-Ura Platte (0,67% Hefe-Stickstoff-Base, 2% Glucose, 0,6% Casaminosäure, 0,0025% Adenin Hemisulfat, 0,005% Tryptophan und 2% Agar).
  3. Streak aus den Transformanten auf einem frischen CAA-Ura Platte isolierte Kolonien zu erhalten.
  4. Übertragen von Zellen aus einer Kolonie auf ein YPDA Platte, enthaltend 200 ug / ml G418, um das Fehlen von Wachstum zu bestätigen. Um eine erfolgreiche GFP Integration zu bestätigen, folgen Sie den Schritten (1,5) - (1,9) zum Kolonie-PCR durchzuführen.
  5. Hinzufügen von Zellen aus einer Kolonie in 2 ul Lysepuffer (0,1 M Natriumphosphat, pH 7,4, 1 Einheit aus ZymoResearch Zymolyase) in einer 0,2-ml-PCR-Röhrchen oder eine Vertiefung einer 96-Well-Platte entnommen. Mischung durch Pipettieren der Lösung in und aus einer Pipettenspitze.
  6. Overlay mit einem Tropfen (etwa 20 ul) von Mineralöl mit einem P200 Pipetman (Gilson).
  7. Inkubieren der Mischung bei 37 °C für 20 min und dann bei 95 ° C für 10 min.
  8. Verdünnen Sie das Lysat mit 50 ul Wasser. Mix durch Pipettieren die Lösung in und aus zehnmal.
  9. Analysieren 1 ul des Lysats unter Verwendung von 10-ul PCR-Reaktionen mit (A) einem Vorwärtsprimer daß annealt an die stromaufwärts flankierenden Region mit einem Primer der Sequenz CCTGAGAAAGCAACCTGACC (285 bp vom Beginn der Kassette) gepaart, (B) einem Reverse Primer annealt, dass an dem stromabwärts gelegenen Bereich mit einem Primer der Sequenz GCATTGGGTCAACAGTATAG (375 bp aus dem Ende) gepaart ist, (C), die zu zwei Primer mit den Sequenzen kanMX4 CGTACTCCTGATGATGCATG und GACGAAATACGCGATCGCTG (181 bp) anlagern, und (D) zwei Primern, dass Ausheilen der Wildtyp-Sequenz des Zielgens (Abbildung 4). (D) ist wichtig, weil etwa 8% der Stämme in den Löschvorgang Sammlungen bekannt sind Aneuploidie 14 enthalten. Eine korrekte Transformante sollte positiv mit (A) und (B) und mit negativen (C) und (D).
  10. Um die EinführungGMToolkit in die Transformante, fügen etwa 250.000 Zellen aus dem transformierten Stamm und 250.000 Zellen entweder RY0146 (enthaltend GMToolkit-a) oder RY0148 (enthaltend GMToolkit-α) in einem 1,6-ml-Eppendorf-Röhrchen. Vortex. Die Genotypen RY0146 und RY0148 sind MATa lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-a [CMVpr-rtTA kanMX4 STE2pr-Sp-his5] und MATa lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-α [CMVpr-rtTA NatMX4 STE3pr- LEU2] tragen. pr bezeichnet Promotor. Zellzahl sollte die optische Dichte der vorhergehenden Kultur geschätzt werden.
  11. Zentrifugation bei 800 xg für 2 min.
  12. Entfernen Sie den Überstand.
  13. Um den Luftaustausch zu ermöglichen, ein Loch auf dem Deckel mit einem Druckbolzen mit 70% Ethanol behandelt werden.
  14. Dann werden 50 ul YPDA Medium (1% Hefeextrakt, 2% Pepton, 2% Glucose und 0,003% Adenin hemisulfate). Vortex.
  15. Zentrifugation bei 800 xg für 5 min.
  16. Das Röhrchen wird in einem feuchten Box. Dies kann mit einem leeren Kasten Spitze, eine kleine Spitze Ständer und einem nassen Papiertuch erstellt werden.
  17. Inkubieren Sie die Box über Nacht bei 30 ° C.
  18. Wählen gepaart Diploide durch erste Streifen einige der Zellen auf einem CAA-Ura Platte. Inkubieren Sie die Platte bei 30 ° C für einen Tag.
  19. Entnehmen von Zellen aus der Bulk-Bereich, streifenfreie sie aus, um isolierte Kolonien auf YPDA Platten (1% Hefeextrakt, 2% Pepton, 2% Glucose, 0,003% Adenin Hemisulfat, und 2% Agar) mit 200 ug / ml G418 zum Selektieren Diploide machen enthaltenden GMToolkit-a oder 100 pg / ml Nourseothricin (Nat) 15 zum Auswählen Diploide enthaltenden GMToolkit-α.
  20. Inkubieren Sie die Platte bei 30 ° C für 3 Tage.
  21. Ausgehend von einer isolierte Kolonie, übertragen die meisten Zellen zu 500 ul GNA Mediums ohne Agar (1% Hefeextrakt, 3% Difco Nährbrühe und 5% Glucose; Autoklaven Glucose und der Rest von ter Komponenten separat als 2 × Lösungen Karamelisierung vermeiden) in einem 5-ml-Kultur Rohr mit dem Deckel gelöst wird.
  22. Drehen Sie den Schlauch horizontal fünf Stunden bei 30 ° C. Die Achse der Rotation benötigt, um parallel zur Längsachse des Rohres.
  23. Bestätigen Sie, dass Kolonien in (1,21) sind Ura + durch Ausstreichen sie auf einem CAA-Ura Platte.
  24. Zentrifugieren bei 800 xg für 2 min. Überstand verwerfen.
  25. Add 500 ul minimalen Sporulationsmedium (1% Kaliumacetat, 0,005% Zinkacetat; Filter-sterilisiert). Vortex.
  26. Zentrifugieren bei 800 xg für 2 min. Überstand verwerfen.
  27. Repeat (1,25) - (1,26) zweimal.
  28. 1 ml minimal Sporulationsmedium mit 7,5 ug / ml Lysin, 7,5 pg / ml Leucin, 5 pg / ml Histidin, 5 pg / ml Methionin und 1,25 pg / ml Uracil (die Sporulationsrate der auxotrophen Stämme erhöhen) ergänzt . Vortex.
  29. Drehen des Rohrs bei Raumtemperatur für einen Tag.
  30. Drehen des Rohres bei 30 ° C für 2 Tage.
  31. Zentrifuge 125 ul dieser Mischung in einer 1,6-ml-Eppendorf-Röhrchen bei 800 xg für 2 min. Überstand verwerfen.
  32. Fügen Sie 50 ul Zymolyase Lösung (100 mM Natrium-Phosphat-Puffer, pH 7,4, 1 M Sorbit und 2 Einheiten Zymolyase von ZymoResearch). Mischung durch Pipettieren der Lösung in und aus einer Pipettenspitze.
  33. Inkubieren bei 30 ° C für 1 Stunde.
  34. Fügen Sie 50 ul von 0,02% NP-40. Mischung durch Pipettieren der Lösung in und aus einer Pipettenspitze.
  35. Verlassen die Röhrchen bei Raumtemperatur für fünf Minuten.
  36. Add 500 ul Wasser.
  37. Das Röhrchen auf Eis.
  38. Beschallen Sie diese Mischung zweimal am Ausgang Einstellung von 1 (schwächsten Einstellung) für 15 sec mit einem 3,2-mm Mikrospitze mit Sonifier 450 (Branson). Zwischen den beiden Runden der Beschallung, legte die Tube auf Eis, um die Temperatur auf ~ 0 ° C zurück
  39. Zentrifugieren bei 800 × g für 5 min. Überstand verwerfen.
  40. Fügen Sie 200 ul SC-Ura-His(A) oder SC-Ura-Leu (α)-Medium, je nachdem, ob das Kreuz ist zum Einarbeiten GMToolkit-a oder GMToolkit-α. Um die Medien herzustellen, stellen SC-Ura-His-Leu-Medium (0,67% Yeast Nitrogen Base, 2% Glucose, 0,01% Arginin, 0.01% Asparaginsäure, 0,01% Glutaminsäure, 0,01% Isoleucin, 0,01% Lysin, 0,01% Methionin , 0,01% Phenylalanin, Serin 0,08%, 0,04% Threonin, Tyrosin 0,002%, 0,03% Valin, 0,0025% Adenin, 0,005% Tryptophan, Adenin 0,003% und 0,005% Tryptophan) und ergänzt es mit sterilem Histidin oder Leucin vor Gebrauch der Endkonzentration von 0,01%.
  41. Machen Sie ein Loch auf dem Deckel mit einer Reißzwecke mit 70% Ethanol behandelt.
  42. Drehen Sie den Schlauch horizontal bei 30 ° C für 2 Tage. Die Achse der Rotation benötigt, um parallel zur Längsachse des Rohres.
  43. Streak aus den Zellen auf einem SC-Ura-His-oder SC-Ura-Leu-Agar-Platte (die gleichen Zutaten wie oben plus 2% Agar, Threonin und Asparaginsäure muss nach a hinzugefügt werdenutoclaving, fügen Histidin oder Leucin vor dem Gießen), um isolierte Kolonien für die ProMonster Stämme zu machen.

2. Sexuelle Radfahren

  1. Drehen Sie eine Kultur eines etablierten GFP Deletionsstamm in 100 ul SC-His (a) oder SC-Leu (α) in Abhängigkeit von Paarungstyp bei 30 ° C über Nacht mit einer 1,6-ml Eppendorf-Röhrchen. Für den Luftaustausch, machen Sie ein Loch mit einem Pin mit 70% Ethanol behandelt. Drehen Sie den Schlauch horizontal. Die Achse der Rotation benötigt, um parallel zur Längsachse des Rohres. Es ist möglich, mehrere Stämme über en masse zusammenpassenden überqueren. Wenn ein sortierten Probe wird direkt für diesen Zweck, die Zellen in Kultur 200 ul eingesetzt bei 30 ° C für 2 Tage. Um das Medium herzustellen, fügen Uracil (Endkonzentration: 0,0025%) und Histidin (0,01%) oder Leucin (0,01%) auf SC-Ura-His-Leu-Medium.
  2. Mix 250.000 a-haploide Zellen und 250.000 α-haploiden Zellen GFP Deletionsstämme in einem 1,6-ml Eppendorf Röhre. Vortex.
  3. Paaren diese Zellen durch folgende Schritte (1,11) - (1,17).
  4. Übertragen 10 ul der Paarung Mischung 500 ul GNA-Medium mit 200 ug / ml G418 und 100 ug / ml Nat in einem 5-ml-Kultur Rohr mit einer gelockerten Deckel. Das Ausgangsmaterial OD 600 ist etwa 0,1.
  5. Drehen Sie die Kultur bei 30 ° C für 24 Stunden. Dies ermöglicht die Auswahl von Diploide weil nur Diploide enthaltend sowohl kanMX4 in GMToolkit-a und NatMX4 in GMToolkit-α kann in Gegenwart von G418 und Nat (Abbildung 3) wachsen.
  6. Übertragen 20 ul der eintägigen Kultur zu 500 ml frisches GNA mit G418 und Nat. Das Ausgangsmaterial OD 600 ist etwa 0,2.
  7. Drehen des Rohres bei 30 ° C für 5 Stunden, um Zellen auf der log-Phase (OD 600 von ~ 1) zu bringen.
  8. Folgen Sie den Schritten (1,24) - (1,38), die Diploiden sporulieren und isolieren Sporen.
  9. Split die Aussetzung der sporenbildenden Zellen in zwei 300-ulTeile und setzen jeweils in einen separaten 1,5-ml Eppendorf-Röhrchen.
  10. Zentrifugieren bei 800 × g für 5 min. Überstand verwerfen.
  11. Um das Pellet aus einem Rohr, mit 100 ul der SC-Sein Medium, um ein-Haploiden wählen. Zum Pellet des anderen Rohres, werden 100 ul SC-Leu-Medium zu α-Haploiden auszuwählen.
  12. Drehen Sie die Röhrchen bei 30 ° C über Nacht. Die endgültige OD 600 soll weniger als 0,5. Wenn OD 600 neigt dazu, zu hoch sein, versuchen Kultivieren bei Raumtemperatur.
  13. Um GFP zu induzieren, mit 100 ml frisches SC-His (a) oder SC-Leu (α)-Medium mit 20 ug / ml Doxycyclin. Die Endkonzentration von Doxycyclin ist 10 ug / ml. Vortex.
  14. Drehen Sie die Röhrchen bei 30 ° C für 2 Tage.

3. Durchflusszytometrie

  1. Zusatz von 900 ul vorgefilterten TE-Puffer (pH 7,5), enthaltend 10 ug / ml Doxycyclin zu einem 5-ml-Polypropylenröhrchen (Falcon # 352.063 BD) mit der Kappe mit einer Zelle vertauscht-Schmutzfänger Kappe aus einem 5-ml Polystyrol-Röhrchen (BD Falcon # 352235). Polypropylen Röhrchen sind geeignet für die Durchflusszytometrie. Das Sieb Kappe zum Entfernen von großen Partikeln gewünscht.
  2. Sanft legen 75 ul TE-Puffer mit Doxycyclin auf die Zelle Schmutzfänger Kappe.
  3. Zugeben von 25 ul der induzierten Zellen zu der Lösung auf der Kappe.
  4. Halten Sie die Spitze des Pipetman gegen die Gitter, schießen alle der kombinierten Lösung durch das Sieb.
  5. Drücken Sie das Sieb Kappe und das Röhrchen vortexen.
  6. Bereiten Sammelröhrchen (1,6-ml-Eppendorf-Röhrchen) mit 200 ul SC-His-oder SC-Leu gefüllt.
  7. Starten Sie den Zellsortierer und die Einstellungen nach Angaben des Herstellers Handbuch.
  8. Vortex sowohl das Sammelgefäß (zum Beschichten der Wand mit dem Medium) und das Rohr mit mehreren Zellen vor dem Einlegen auf dem Zellsortierer.
  9. Erwerben durchflusszytometrischen Daten der Probe. Ein Stamm nicht mit GFP kann eine negative Kontrolle.
  10. Zeichnen Tore für Sortierung. (A)Um Zellaggregate, die hohe GFP Intensität aufweisen könnten, zu vermeiden, werfen Ausreißer mit unverhältnismäßig großen Impulsbreite für Vorwärtsstreuung (FSC) mit einem Grundstück von Pulsbreite und Höhe für MoFlo Sortierer oder unverhältnismäßig gering FSC Höhe mit einem Grundstück von FSC Höhe und FSC Bereich für FACSAria Sortierer (Abbildung 5, top-links). (B) Da große FSC (Fläche) ist für Zellaggregate erwartet, nur Zellen in der unteren 20% in FSC, bei gleichzeitiger Vermeidung Regionen mit dem niedrigsten FSC und side scatter (SSC)-Werte, wobei Zelltrümmer oft gefunden wird (Abbildung 5, Top-rechts). (C) SSC (Fläche) und GFP-Signal (Fläche) werden oft positiv korreliert. Weil man einfach die hellsten Zellen gegeben die Gates oberhalb würde auch für Zellen mit einem hohen Wert SSC anzureichern Ziehung einer Gate entlang der Peripherie der Bevölkerung über eine Parzelle von GFP Intensität und SSC einen ähnlichen Prozentsatz der hellsten Zellen aus jeder Punkt ergreifen der SSC-Achse (Abbildung 5, bottom-linkes Diagramm). Die Bevölkerung in (C) ausgewählt wird, sollte 0,1-1% der Bevölkerung in (B) ausgewählt werden.
  11. Sortieren 200 Zellen in das Sammelröhrchen angesichts der Kriterien in (3,10). Für ein en masse Prozess oder für andere Projekte erfordern eine komplexere Bevölkerung, sortieren mehr Zellen nach Bedarf.
  12. Vortex das Sammelröhrchen zur Deckung der sortierten Zellen mit Medium.
  13. Platte eine Teilmenge von Zellen (beispielsweise 50-Zellen) auf einer Platte für YPDA Genotypisierung.
  14. Inkubieren Sie die Platte bei 30 ° C für 2 Tage.
  15. Machen Sie eine Lysat für ~ 12 Kolonien nach den Schritten (1,5) - (1,8).
  16. Übertragen der verbleibenden Zellen auf der Spitze im verwendet (1,5) auf einen Fleck auf einem YPDA Platte mit G418 und Nat durch leichte Berührung der Platte mit der Spitze. Ausgewählte Haploiden sollte nicht auf dieser Platte zu wachsen. Diploide kann mehr GFP Kopien und können daher heller. Dieser Test kann zeigen die Effizienz von haploiden Auswahl.
  17. Für die Genotypisierung, analysieren 1 ul des Lysats mit einem 10-ul PCR reaction mit einem Vorwärtsprimer, dass der stromaufwärts flankierenden Region jeder deletierte Gen mit einem Primer der Sequenz CCTGAGAAAGCAACCTGACC gepaarten annealt.
    Multiplex-PCR-Reaktionen, wenn möglich (Bedingungen kann anhand Lysaten von einzelnen Mutanten werden). Oder 384-Well-Format - PCR kann in einem 96 erfolgen. Das letztgenannte Format ist geeignet für die Reaktionsvolumen von so wenig wie 5 ul. Anordnen von PCR Mastermixen unterschiedlicher Primer und Zugabe von Zelllysaten zu diesen Mischungen durchgeführt werden kann unter Verwendung einer Mehrkanal-Pipette oder einer Flüssigkeit Handhabungsroboter. Tipp Änderungen sind optional, wenn Sie den gleichen Lysat auf unterschiedliche PCR-Mischungen.
  18. PCR-Produkte analysiert. Das Gel XL Ultra V-2-Elektrophorese-System (Labnet) ist kompatibel mit Probenbeladung mit Mehrkanal-Pipetten.
  19. Gestützt auf Informationen von (3,16) und (3,18), identifizieren wahrscheinlich Haploiden die Genotypen gewünscht haben.
  20. Richten Sie diese Stämme auf eine frische Platte (YPDA, CAA-Ura oder SC-Ura-His/Leu). Auch frieren sie in25% Glycerin bei -80 ° C. Weitere Tests wie Bestätigung der Abwesenheit von Wildtyp-Sequenzen für gelöschte Gene und Puls-Feld-Gelelektrophorese werden empfohlen.
  21. Wiederholen sexuelle Fahrrad von (2,1) mit nützlichen Stämmen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Wenn eine a-haploide Stamm, der vier GFP-markierten Deletionen (ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) wurde mit einem α-haploide Stamm, der vier Deletionen gekreuzt (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ), mit zwei Deletionen (ycl033cΔ yer042wΔ) von zwei Stämmen, ein Vertreter geteilt Ergebnis wurde erzielt. Die Paarung Mischung wurde in YPDA Medium mit G418 und Nat Diploiden wählen kultiviert. Die resultierenden Diploide wurden in Sporulationsmedium kultiviert. Die Sporen wurden durch Zymolyase Behandlung und Ultraschallbehandlung dispergiert und gekeimt in haploiden Selektionsmedium. Die Zellen wurden dann veranlaßt GFP exprimieren. Verwendung Gatter mit einem Durchflußzytometer, wurde eine Population von Zellen ausgewählt, ist unwahrscheinlich, Trümmer oder Zellaggregate (Abbildung 5) enthalten. Innerhalb dieser Population wurden die hellsten 1% der Zellen sortiert. Sortierten Zellen und unsortierten Zellen waren genotypisiert nachdem sie Kolonien auf einer Platte ausgebildet ist. Wenn zufällig ausgewählte Kolonien wurden auf einer Platte mit YPDA G418 und Nat, Zellen aus 2 von 16 Kolonien wuchsen für den unsortierten Probe, und Zellen aus 18 von 26 Kolonien wuchsen zum sortierten Probe ausgestrichen, was darauf hindeutet, dass einige Diploide die Fähigkeit erworben einen haploiden-Selektionsmarker exprimieren und vermehrt in den haploiden-Auswahl und GFP-Induktion Phasen in diesem Experiment. Diploide wurden weiter in der sortierten Probe vermutlich aufgrund der größeren Anzahl von GFP kopiert sie enthielten angereichert. Wenn Haploiden mit PCR analysiert wurden, war die durchschnittliche Zahl der Löschungen in der sortierten Zellen 5,1 ± 0,4 (n = 8; SEM gezeigt). Vier dieser Zellen hatten sechs Deletionen, die maximal mögliche Anzahl von Löschungen für diese Kreuzung. Haploide des unsortierten Probe hatte 3,4 ± 0,2 Deletionen im Mittel (n = 14).

In einem separaten Experiment, eine a-haploide Stamm mit sieben GFP-markierten Deletionen (yer042wΔ yer108cΔ yfr057wΔ ykl069wΔ ykr011cΔ ylr123cΔ yol118cΔ) wurde mit einem α-haploiden Stamm, der acht LÖSCHUNGEN (ycl033cΔ ydl227cΔ ydl242wΔ yer042wΔ yer108cΔ yfr057wΔ ygl109wΔ ykr011cΔ), mit vier gemeinsamen Deletionen (yer042wΔ yer108cΔ yfr057wΔ ykr011cΔ), die in den beiden Stämmen. Wenn Diploide ausgewählt wurden kultiviert und anschließend im Sporulationsmedium, sporulierten etwa 20% der Zellen auf der Basis mikroskopischer Beobachtung (n> 100). Nachdem die Sporen wurden dispergiert und gekeimt wurden die resultierenden Haploiden zu exprimieren GFP induziert und sortiert am Fluoreszenz wie oben. Nur einer von 61 zufällig ausgewählten Zellen wuchsen auf einem YPDA Platte mit G418 und Nat, was darauf hindeutet, dass sortierten Zellen überwiegend wurden haploid. Wenn es mit PCR (Abbildung 6) analysiert, mussten die sortierten Zellen die durchschnittliche Zahl der Löschung 8,8 ±0,3 (n = 12; SEM gezeigt), einschließlich fünf Zellen mit zehn Deletionen. Die erwartete Anzahl von Löschungen für eine unsortierte Zelle aus zufälligen Segregation lag bei 7,5.

Abbildung 1
Abbildung 1. Grüne Monster unter dem Mikroskop. Fluoreszenz-Aufnahmen zeigen eine nicht-mutierte Stamm (links), eine ProMonster Stamm (Mitte) und eine 16-GFP Monster Stamm (rechts). Identische Belichtung, Helligkeit und Kontrast-Einstellungen wurden für Bilder verwendet.

Abbildung 2
Abbildung 2. Die Regelung des Green Monster Prozess. Single-Mutanten Haploiden (hellgrün) zusammengesteckt werden. Meiotischen Rekombination während der Sporulation der gesteckten Diploiden erzeugt eine Mischung aus 0-GFP-Zellen (off-white), 1-GFP-Zellen (hellgrün) und 2-GFP-Zellen (dunkelgrün). FlussZytometrie wird verwendet, um die Zellen für die grünsten 2-GFP Zellen angereichert auszuwählen. Integrierte molekulare Werkzeuge ermöglichen die Auswahl von a-Haploiden (His +), α-Haploiden (Leu +) und Diploiden (G418-und Nat-Widerstand). Dieser Zyklus wird wiederholt, um für Stämme tragen eine immer größere Anzahl von Änderungen zu bereichern.

Abbildung 3
Abbildung 3. GFP Deletionskassetten und GMToolkits. GFP Deletionskassetten enthalten eine GFP-Reporter-Gen und eine Hefe Transformationsmarker (URA3). Die tetO 2 Promotor induzierbar ist durch die Zugabe von Doxycyclin in dem Medium durch die Wirkung des rtTA Transkriptionsfaktor. Wenn die GFP-Ebene erreicht die maximale Kapazität der Zellen, um das Protein zu machen oder eine toxische Wirkung von tolerieren, kann der Ausdruck durch Absenken der Doxycyclin-Konzentration gewählt werden (beachten Sie jedoch, dass wir das gemacht haben nicht beobachten wie Sättigung oder toxische Wirkungen sogar mit 16 Kopien GFP). Diese Kassette kann jedes Gen oder einer Region durch das Anbringen spezifische homologe Sequenzen mittels PCR ausgerichtet sein. Alternativ kann die universelle GFP Deletionskassette mit identischen homologe Sequenzen günstig in kanMX4 'Landeplätzen' in Stämme der Hefe Knockout Sammlung ausgerichtet sein. YFG bedeutet Ihre Lieblings-Gen. Box mit vertikalen Linien bezeichnet DNA Barcode. GMToolkits in den CAN1 Locus integriert. Die STE2-his5 Markierung und das STE3-LEU2-Marker werden in einer Paarungstyp spezifischen Weise in Haploiden, damit nur ein-Haploiden in Abwesenheit von Histidin und nur α-Haploiden in Abwesenheit von Leucin wachsen, wachsen jeweils ausgedrückt. Auswählen zur Resistenz gegenüber G418 und Nat gleichzeitig auswählt für die kanMX4 Locus in ein und dem GMToolkit NatMX4 Locus in der anderen und wählt somit für Diploide.

_CONTENT "fo: keep-together.within-page =" always "> Abbildung 4
Abbildung 4. Bestätigt die korrekte Integration der GFP Kassette. Eine universelle GFP Kassette kann verwendet werden, um jede kanMX4 markierten Löschung in der Hefe Löschung Sammlung auf eine GFP-markierten Löschung umzuwandeln. Bei richtig generiert GFP Deletionsallel, PCR-Reaktion mit einem Vorwärtsprimer, dass annealt an die stromaufwärts flankierenden Region mit einem Rückwärtsprimer daß annealt an den Anfang der Kassette (PCR A von Stufe 1.9) sollte einer Band machen gepaart. PCR-Primer mit einer reversen daß annealt an die stromabwärts flankierenden Region mit einem Vorwärtsprimer, dass annealt dem Ende der Kassette (PCR B) sollte ein Produkt herzustellen gepaart. PCR mit zwei Primern, die innerhalb des kanMX4 Kassette (PCR C) oder mit zwei Primern, die mit dem Wildtyp-Sequenz des Zielgens (PCR D) Glühen annealen sollte nicht zu einem Band. Roter Pfeil bezeichnet einen PCR-Primer. BracMarkt zeigt eine Region mit einer PCR-Reaktion amplifiziert. Box zeigt die GFP Kassette (grün), die kanMX4 Kassette (gelb), oder Ihre Lieblings-Gen (YFG, grau). Schwarze Linie eine flankierende Sequenz in einer Hefe-Chromosom.

Abbildung 5
Abbildung 5. Durchflusszytometrie. In diesem Experiment haploiden Nachkommen aus einer Kreuzung von zwei Stämmen, einer mit dem Genotyp ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ und der andere mit dem Genotyp ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ induziert wurden mit GFP exprimieren. Jedes Gendeletion hatte eine GFP-Kassette. Durch Gating-Zellen auf der Basis der Vorwärtsstreuung an und Vorwärtsstreuung Höhe (P1), Zellaggregate (die zu haben überproportional Vorwärtsstreuung Bereich ausgeschlossen wurden neigen. Durch Gating-Zellen auf der Basis der Vorwärtsstreuung und seitliche Streuung (P2), cells in der unteren 20% in Vorwärtsstreuung angenommen wurden unter Ausschluss Schmutz mit dem niedrigsten Vorwärtsstreuung und side scatter. Durch Gating-Zellen auf der Basis der Seitenstreuung und GFP-Signal (P3), wurden die mehreren fluoreszierenden Zellen unter den in einer gegebenen Seite Streubereich entnommen. Zum Vergleich des meiotischen Mischung und der negativen Kontrollprobe, die nicht ausdrücklich GFP, ein Gate identisch mit dem für die Auswahl des verwendeten nicht P3 Population wird in einem Diagramm für die ähnlich ausgewählten Zellen der negativen Kontrolle gezeigt zu ermöglichen.

Abbildung 6
Abbildung 6. Genotypisierung der sortierten Stämme. PCR wurde unter Verwendung eines Reverse-Primer annealt, dass der stromabwärts flankierenden Region mit einem Vorwärtsprimer gepaarten daß annealt an das Ende der Kassette. Das Vorhandensein von Band anzeigt, das Vorhandensein des GFP-Kassette. Ein separaten Experiment zeigte, dass alle der zwölf Stämme conTain die yer042w Δ Löschung und die ykr011c Δ Löschung.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Als wir das Green Monster Ansatz entwickelt, wurden wir mit der Möglichkeit der Rekombination zwischen verschiedenen GFP Ersatzkassetten betroffenen, was zu Genom-Umlagerung. Milderung gegen diese Möglichkeit ist unsere Auswahl für Zellen, die erfolgreich mehrere Runden der Paarung und Meiose durchlaufen haben. Zellen, die umgeordnet Genome sind voraussichtlich weniger fit nach der Paarung zu Zellen ohne eine identische Umlagerung. In der Tat haben wir nicht beobachten Genominstabilität aus Rekombination zwischen GFP Kassetten 11. Allerdings können wir nicht ganz ausschließen diese Möglichkeit, so empfiehlt es sich, dass die Nutzer die erzeugten Stämme zur Umlagerung zu testen. Puls-Feld-Gelelektrophorese kann verwendet werden, um grobe Abnormalität zu detektieren. PCR mit Primern Annealen an Sequenzen innerhalb der Deletion kann verwendet werden, um die Abwesenheit von Wildtyp-Sequenzen zu bestätigen.

Basierend auf den Fluoreszenz-Ebenen der etablierten Stämme, GFP Intensität hatten einen nahezu linearen Zusammenhang mit der Anzahl der Löschungen, was darauf hindeutet, dass die Sättigung nicht ein Problem in dem getesteten Bereich von einem bis 16 Deletionen 11. Aber auch in späteren Runden mit Stämmen mit vielen nicht-überlappenden Deletionen, konnten wir nur erhöhen die durchschnittliche Anzahl der Löschungen in der Bevölkerung um rund zwei in jeder Runde, während theoretisch eine Zelle, die die Vereinigung aller Deletionen in beiden elterlichen Stämme konnten auf einmal kombiniert werden, wenn perfekte Stringenz für GFP Auswahl erreicht wurden. Eine Einschränkung ist die Zell-zu-Zell-Variante von GFP Intensität unter isogenen Zellen. In dem zweiten Beispiel in Repräsentative Ergebnisse, nur 0,8% der Zellen in der Population zu erwarten, um alle 11 möglichen Deletionen in dieser Kreuzung (vier der 11 Deletionen wurden von beiden elterlichen Haploiden geteilt) waren aufweisen. Allerdings werden die häufiger zehn Deletionsstämme haben eine Verteilung von GFP Intensität, mit der von der 11-Deletion straIns. Daher muss ein noch kleinerer Anteil der Bevölkerung ausgewählt, um vorzugsweise auszuwählen 11-Deletionsstämme vom höheren Schwanz des GFP Intensitätsverteilung 11-Deletionsstämme werden. Eine Lösung kann sein, einfach erhöhen die Schwelle zur seltener Zellen mit höherer GFP Intensität sortieren. Eine andere Lösung kann darin bestehen, gleichzeitig zu messen, einen internen Standard, einem fluoreszierenden Protein-Reportermolekül von einer anderen Farbe, die in einer einzelnen Kopie ist, über dieselbe tetO 2-Promotor exprimiert. Diese Strategie würde voraussichtlich aufheben extrinsischen Rauschens, um die Zelle zu Zelle Änderung der damit normalisierte GFP Intensitätsmessungen 16,17 verringern.

Die Schwierigkeiten bei der Beschaffung seltener multi-Mutanten können durch die potentiell langsame Wachstum dieser Stämme noch verschärft werden. Multi-Mutanten sind mittels Durchflusszytometrie angereichert, aber sie können während der Rest des Prozesses durch Monteur Geschwister werden outcompeted. Um die Anzahl der Generationen minimierenHefestämme unterziehen, empfiehlt es kleine Kulturvolumina, die gerade ausreicht,-Amplifikation von Zellen des gewünschten Ploidie, die bei jedem Schritt ausgewählte bereitzustellen.

Da mehrere Deletionen pro Zyklus erworben werden kann, kann das Green Monster Verfahren verwendet werden, um Multi-Mutanten schneller als sequentielle Methoden 11 zusammenzubauen sein. Wenn spezifische Teilmengen von Deletionen synthetisch letale Beziehungen haben kann "Sackgassen" mit sequentieller Ansätze begegnet werden. Diese Einschränkung kann durch das Green Monster Ansatz umgangen werden die Proben aus dem Raum der möglichen Wege zu akkumulieren den vollen Satz von Löschungen. Je mehr parallel en masse Version des Green Monster Prozess sollte als nützlich erweisen Finden eines Pfades, um den größten tolerierbaren Anzahl an Deletionen erreichen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Keine Interessenskonflikte erklärt.

Acknowledgments

Diese Arbeit wurde von der US Defense Advanced Research Projects Agency Vertrag N66001-12-C-4039 um YS, einen Zuschuss von der Alfred P. Sloan Foundation, RSL, und US-amerikanischen National Institutes of Health Zuschüsse R01 HG003224 und R21 CA130266 um FPRFPR unterstützt wurde auch durch ein Stipendium vom kanadischen Institut für Advanced Research und von der Canada Exzellenzinitiative Forschung Chairs-Programm unterstützt.

Materials

Name Company Catalog Number Comments
G418 Sigma-Aldrich A1720 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 200 mg/ml. Store at 4 °C.
ClonNAT (nourseothricin) WERNER BioAgents 5001000 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 100 mg/ml. Store at 4 °C.
Doxycycline Sigma-Aldrich D9891 Dissolve in 50% ethanol and filter-sterilize (0.2-μm filter). Stock concentration: 10 mg/ml. Make fresh every four weeks. Shield from light using aluminum foil and store at 4 °C.
Zymolyase ZymoResearch E1005
Difco yeast nitrogen base w/o amino acids BD 291940
Revolver (rotator for tubes) Labnet H5600
Enduro Gel XL electrophoresis unit Labnet E0160
Sonifier 450 Branson 101-063-198
Microtip for Sonifier 450 Branson 101-148-062
FACSAria cell sorter BD
MoFlo cell sorter Beckman-Coulter
Biomek FX or equivalent robot Beckman Coulter Optional. For setting up genotyping PCRs.

DOWNLOAD MATERIALS LIST

References

  1. Tong, A. H., et al. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science's STKE. 294, 2364-23 (2001).
  2. Hillenmeyer, M. E., et al. The chemical genomic portrait of yeast: uncovering a phenotype for all genes. Science. 320, 362-365 (2008).
  3. Beh, C. T., Cool, L., Phillips, J., Rine, J. Overlapping functions of the yeast oxysterol-binding protein homologues. Genetics. 157, 1117 (2001).
  4. Wieczorke, R., et al. Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae. FEBS letters. 464, 123-128 (1999).
  5. Alani, E., Cao, L., Kleckner, N. A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics. 116, 541-545 (1987).
  6. Akada, R., et al. PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae. Yeast. 23, 399-405 (2006).
  7. Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic acids research. 24, 2519 (1996).
  8. Delneri, D., et al. Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system. Gene. 252, 127-135 (2000).
  9. Storici, F., Lewis, L. K., Resnick, M. A. In vivo site-directed mutagenesis using oligonucleotides. Nat. Biotech. 19, 773-776 (2001).
  10. Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast. Nucl. Acids Res. 38, 2570-2576 (2010).
  11. Suzuki, Y., et al. Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection. Nat. Methods. 8, 159-164 (2011).
  12. Winzeler, E. A. Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis. Science. 285, 901-906 (1999).
  13. Woods, R. A., Gietz, R. D. High-efficiency transformation of plasmid DNA into yeast. Methods Mol. Biol. 177, 85-97 (2001).
  14. Hughes, T. R., et al. Widespread aneuploidy revealed by DNA microarray expression profiling. Nature. 25, 333-337 (2000).
  15. Goldstein, A. L., McCusker, J. H. Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast. 15, 1541-1553 (1999).
  16. Newman, J. R. S., et al. Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise. Nature. 441, 840-846 (2006).
  17. Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. Gene regulation at the single-cell level. Science. 307, 1962 (2005).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics