The Green Monster Werkwijze voor de generatie van giststammen dragen Meerdere gendeleties

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

De Green Monster methode kan de snelle montage van meerdere deleties gemarkeerd met een reportergen codeert groen fluorescent eiwit. Deze methode is gebaseerd op een giststammen door herhaalde cycli van seksuele assortiment van deleties en fluorescentie gebaseerde verrijking van cellen die meer deleties.

Cite this Article

Copy Citation | Download Citations

Suzuki, Y., Stam, J., Novotny, M., Yachie, N., Lasken, R. S., Roth, F. P. The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions. J. Vis. Exp. (70), e4072, doi:10.3791/4072 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Fenotypes voor gendeletie vaak onthuld wanneer de mutatie getest in een bepaalde genetische achtergrond of omgevingsconditie 1,2. Er zijn voorbeelden waar veel genen moeten worden verwijderd om te ontmaskeren verborgen genfuncties 3,4. Ondanks het potentieel voor belangrijke ontdekkingen, zijn genetische interacties met drie of meer genen grotendeels onontgonnen. Uitputtende zoekopdrachten van multi-mutant interacties zou onpraktisch zijn als gevolg van het grote aantal mogelijke combinaties van verwijderingen. Zou echter studies van geselecteerde sets van genen, zoals sets van paralogen met meer a priori kans van een gemeenschappelijke functie informatief.

In de gist Saccharomyces cerevisiae is knockout bewerkstelligd door vervanging van een gen met een selecteerbare merker via homologe recombinatie. Omdat het aantal markers beperkt zijn werkwijzen ontwikkeld voor het verwijderen en opnieuw de sam e marker 5,6,7,8,9,10. Echter achtereenvolgens techniek meerdere mutaties met deze methoden is tijdrovend omdat de tijdschalen lineair vereist met het aantal deleties te genereren.

Hier beschrijven we de Green Monster methode voor routinematig engineering van meerdere deleties in gist 11. In deze methode wordt een groen fluorescerend eiwit (GFP) reporter geïntegreerd in deleties gebruikt om kwantitatief label stammen volgens het aantal deleties in elke stam (figuur 1). Herhaalde rondes van het assortiment van GFP-gemerkt deleties via gist mating en meiose gekoppeld met flow-cytometrische verrijking van stammen die meer van deze deleties leiden tot de ophoping van deleties in stammen (figuur 2). Het uitvoeren van meerdere processen in parallel met elk proces waarin een of meer deleties per ronde minder tijd nodig voor stam constructie.

inhoud "> De eerste stap is de voorbereiding van haploïde single-mutanten genoemd 'ProMonsters,' die elk draagt ​​een GFP reporter in een verwijderde locus en een van de 'toolkit' loci-ofwel Green Monster GMToolkit-a of GMToolkit-α in de . can1Δ locus (Figuur 3) Gebruik stammen van de gist deletie collectie 12 kan GFP-gemerkte deleties eenvoudig worden gegenereerd door het vervangen van de gemeenschappelijke KanMX4 cassette bestaande in deze stammen met een universele GFP - URA3 fragment Elke GMToolkit bevat:. hetzij de a - of α-mating-type-specifieke haploïde selectiemerker 1 en precies een van de twee markers die, wanneer beide GMToolkits aanwezig zijn, samen zorgen voor selectie van diploïde.

De tweede stap is het uitvoeren van de seksuele fietsen waardoor deletie loci kunnen in een cel worden gecombineerd door de willekeurige sortering en / of meiotische Recombination dat elke cyclus van de paring en sporulatie begeleidt.

Protocol

1. Generatie ProMonsters

  1. Bereid de universele GFP vervanging cassette door het amplificeren van een tetO 2-GFP marker en de URA3 marker uit het plasmide pYOGM012 (ampicillineresistentie) met behulp van primers met sequenties:
    GGATCCCCGGGTTAATTAAGGCGCGCCAGATCTGTTTAGCTTGCC CAAGCTCCTCGAGTAATTCG en GGCGTTAGTATCGAATCGACAGCAGTATAGCGACCAGCATTCAC GTACCGGGTAATAACTGATATAAT (vetgedrukt regio bieden homologie met de flankerende gebieden van de cassette zodat KanMX4 gerichte vervangen). De PCR-reactie worden uitgevoerd met Phusion polymerase, HF buffer en 3% dimethylsulfoxide (New England BioLabs) vanaf het matrijs-DNA concentratie van 0,5 ng / pl. Het PCR programma 98 ° C gedurende 30 sec en 35 cycli van 98 ° C gedurende 10 sec, 49 ° C gedurende 30 sec en 72 ° C gedurende 1,5 minuten. Het reactievolume moet> 50 pi zijn om voldoende DNA voorzien elke transformatie experiment. We zuiverenhet product met een QIAquick PCR purification kit (Qiagen) met ~ 50 pi van de PCR reactie verwerkt per kolom, maar slaan de zuiveringsstap kan de opbrengst van transformanten.
    Alternatief laat een fragment dat de tetO 2-GFP en URA3 markers, evenals homologe gebieden voor KanMX4 targeting door digestie van het plasmide pYOGM057 (ampicillineresistentie) met het restrictie-enzym EcoRI (New England Biolabs). De DNA-concentratie in deze reactie moet ~ 30 ng / ul. Het reactievolume moet> 34 pi zijn.
    Voor integratie van de GFP cassette in een ander gebied dan KanMX4 Pas de homologiegebied van de PCR primers boven de juiste homologe sequenties.
  2. Transformeer een a-haploïde stam van de KanMX4 gist knock-out collectie 12 met de universele GFP verwijdering cassette. Naar aanleiding van het protocol door de Woods en Gietz 13 0,34 pl van deDNA (gezuiverd PCR product of niet-gezuiverde restrictie digest) worden gebruikt voor elk transformatie experiment. Plaat een vijfde van de transformatie mengsel op een CAA-Ura plate (0,67% giststikstofbase, 2% glucose, 0,6% casaminozuur, 0,0025% adenine hemisulfaat, 0,005% tryptofaan, en 2% agar).
  3. Streak uit de transformanten op een frisse CAA-Ura plaat om geïsoleerde kolonies te verkrijgen.
  4. Breng cellen van een kolonie op een YPDA plaat met 200 ug / ml G418 het ontbreken van groei bevestigen. Om succesvol te GFP-integratie te bevestigen, volgt u de stappen (1,5) - (1,9) naar kolonie PCR uit te voeren.
  5. Toevoegen cellen van een kolonie in 2 ui lysis buffer (0,1 M natriumfosfaat, pH 7,4, 1 eenheid zymolyase van ZymoResearch) in een 0,2 ml PCR-buis of een putje van een 96-well plaat. Mix door pipetteren de oplossing in en uit een pipetpunt.
  6. Overlay met een druppel (ongeveer 20 ul) van minerale olie met behulp van een P200 Pipetman (Gilson).
  7. Incubeer het mengsel bij 37 °C gedurende 20 minuten en vervolgens bij 95 ° C gedurende 10 minuten.
  8. Verdun het lysaat met 50 ul water. Meng door pipetteren de oplossing en tien keer.
  9. Analyseer 1 pi van het lysaat met 10 pi PCR reacties met (A) een voorwaartse primer die bindt met de stroomopwaartse flankerende gebied gekoppeld aan een primer van sequentie CCTGAGAAAGCAACCTGACC (285 bp vanaf het begin van de cassette), (B) een omgekeerde primer die bindt met de downstream regio gekoppeld aan een primer van sequentie GCATTGGGTCAACAGTATAG (375 bp vanaf het einde), (C) twee primers die hybridiseren aan KanMX4 met de sequenties CGTACTCCTGATGATGCATG en GACGAAATACGCGATCGCTG (181 bp) en (D) twee primers die hybridiseren aan de wild-type sequentie van het gerichte gen (figuur 4). (D) is belangrijk omdat ongeveer 8% van de stammen in de deletie collecties bekend aneuploïdie 14 bevatten. Een correcte transformant positief zijn met (A) en (B), en negatief met (C) en (D).
  10. Om een ​​te introducerenGMToolkit in de transformant, voeg ongeveer 250.000 cellen uit de getransformeerde stam en 250.000 cellen ofwel RY0146 (met GMToolkit-a) of RY0148 (met GMToolkit-α) in een 1,6 ml Eppendorf-buis. Vortex. De genotypen van RY0146 en RY0148 zijn MATα lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-a [CMVpr-rtTA KanMX4 STE2pr-Sp-his5] en MATα lyp1Δ his3Δ1 leu2Δ0 ura3Δ0 met15Δ0 can1Δ :: GMToolkit-α [CMVpr-rtTA NatMX4 STE3pr- LEU2] respectievelijk. pr geeft promotor. Celaantal worden bepaald optische dichtheid van de voorgaande cultuur.
  11. Centrifugeer bij 800 xg gedurende 2 minuten.
  12. Verwijder het supernatant.
  13. Om rekening te houden luchtverversing, maak een gat in het deksel met behulp van een punaise behandeld met 70% ethanol.
  14. Voeg 50 ul YPDA medium (1% gistextract, 2% pepton, 2% glucose en 0,003% adenine hemisulfate). Vortex.
  15. Centrifugeer bij 800 xg gedurende 5 minuten.
  16. Plaats de buis in een vochtige doos. Dit kan worden gemaakt met een lege tip box, een kleine fooi standaard, en een natte papieren handdoek.
  17. 'S nachts incubeer het vat bij 30 ° C.
  18. Selecteer gedekt diploïden door eerst strepen uit de cellen op een CAA-Ura plaat. Incubeer de plaat bij 30 ° C gedurende een dag.
  19. Waarbij cellen van de bulk gebied streak ze om geïsoleerde kolonies op YPDA-platen (1% gistextract, 2% pepton, 2% glucose, 0,003% adenine hemisulfaat en 2% agar) bevattende 200 ug / ml G418 voor de selectie maken diploïde met GMToolkit-a of 100 ug / ml nourseothricin (Nat) 15 voor het selecteren diploïden met GMToolkit-α.
  20. Incubeer de plaat bij 30 ° C gedurende 3 dagen.
  21. Uitgaande van een geïsoleerde kolonie overdragen meeste cellen tot 500 pi GNA medium zonder agar (1% gistextract, 3% Difco kweekbouillon, en 5% glucose, glucose autoclaaf en de rest van thij componenten afzonderlijk als 2 × oplossingen karamelisatie vermijden) in een 5 ml kweekbuis met het deksel los.
  22. Horizontaal draaien de buis gedurende vijf uur bij 30 ° C. De as van de rotatie moet parallel aan de lengteas van de buis.
  23. Bevestig dat de volken die gebruikt in (1.21) zijn Ura + door uitstrijken ze uit op een CAA-Ura plaat.
  24. Centrifugeer het buisje bij 800 xg gedurende 2 minuten. Verwijder het supernatant.
  25. Voeg 500 ul minimaal sporulatie medium (1% kaliumacetaat, 0,005% zinkacetaat, filter-gesteriliseerd). Vortex.
  26. Centrifugeer het buisje bij 800 xg gedurende 2 minuten. Verwijder het supernatant.
  27. Repeat (1,25) - (1.26) twee keer.
  28. Voeg 1 ml van minimaal sporulatie medium aangevuld met 7,5 ug / ml lysine, 7,5 ug / ml leucine, 5 ug / ml histidine, 5 ug / ml methionine en 1,25 ug / ml uracil (de sporulatie snelheid van de auxotrofe stammen verbeteren) . Vortex.
  29. Draai de buis bij kamertemperatuur gedurende een dag.
  30. Draai de buis bij 30 ° C gedurende 2 dagen.
  31. Centrifuge 125 ul van dit mengsel in een 1,6 ml Eppendorf buisje bij 800 xg gedurende 2 minuten. Verwijder het supernatant.
  32. Voeg 50 ul zymolyase-oplossing (100 mM natriumfosfaat buffer, pH 7,4, 1 M sorbitol en 2 eenheden zymolyase van ZymoResearch). Mix door pipetteren de oplossing in en uit een pipetpunt.
  33. Incubeer bij 30 ° C gedurende 1 uur.
  34. Voeg 50 ul van 0,02% NP-40. Mix door pipetteren de oplossing in en uit een pipetpunt.
  35. Laat de buis bij kamertemperatuur gedurende vijf minuten.
  36. Voeg 500 pl water.
  37. Plaats de buis op ijs.
  38. Twee keer Sonificeer dit mengsel aan de uitgang instelling van 1 (zwakste instelling) gedurende 15 sec met behulp van een 3,2-mm microtip met Sonifier 450 (Branson). Tussen de beide van sonificatie, plaats de buis op ijs om de temperatuur weer ~ 0 ° C.
  39. Centrifugeer de buisjes bij 800 xg gedurende 5 minuten. Verwijder het supernatant.
  40. Voeg 200 pl SC-Ura-His(A) of SC-Ura-Leu (α) medium, naargelang het kruis is voor het opnemen GMToolkit-a of GMToolkit-α. De media bereiden, maak SC-Ura-His-Leu medium (0,67% giststikstofbase, 2% glucose, 0,01% arginine, asparaginezuur 0,01%, 0,01% glutaminezuur, 0,01% isoleucine, 0,01% lysine, methionine 0,01% , 0,01% fenylalanine, serine 0,08%, 0,04% threonine, tyrosine 0,002%, 0,03% valine, 0,0025% adenine, 0,005% tryptofaan, 0,003% adenine en 0,005% tryptofaan) en met steriele histidine of leucine vullen vóór gebruik de eindconcentratie van 0,01%.
  41. Maak een gat op het deksel met behulp van een punaise behandeld met 70% ethanol.
  42. Horizontaal draaien de buis bij 30 ° C gedurende 2 dagen. De as van de rotatie moet parallel aan de lengteas van de buis.
  43. Streak de cellen op een SC-Ura-His of SC-Ura-Leu agarplaat (dezelfde ingrediënten als hierboven plus 2% agar, threonine en asparaginezuur worden toegevoegd na eenutoclaving, voeg histidine of leucine voor het storten) om geïsoleerde kolonies voor de ProMonster stammen te maken.

2. Seksuele Fietsen

  1. Draai een cultuur van een vastgestelde GFP deletiestam in 100 pl SC-His (a) of SC-Leu (α) afhankelijk mating type bij 30 ° C gedurende de nacht met een 1,6 ml Eppendorf buis. Voor de uitwisseling van lucht, maak een gat met behulp van een punaise behandeld met 70% ethanol. Horizontaal Draai de buis. De as van de rotatie moet parallel aan de lengteas van de buis. Het is mogelijk om over meerdere stammen via massaal paring. Wanneer een monster wordt gesorteerd direct voor dit doel cultuur de cellen in 200 ul bij 30 ° C gedurende 2 dagen. Om het medium te bereiden, voeg uracil (eindconcentratie: 0,0025%) en histidine (0,01%) of leucine (0,01%) tot SC-Ura-His-Leu medium.
  2. Meng 250.000 per-haploïde cellen en 250.000 α-haploïde cellen van GFP deletiestammen in een 1,6-ml Eppendorf buis. Vortex.
  3. Paren deze cellen door stap (1.11) - (1.17).
  4. Breng 10 pl van de parende mengsel 500 pl GNA medium dat 200 ug / ml G418 en 100 ug / ml Nat in een 5 ml kweekbuis met een losse deksel. Het uitgangspunt OD 600 is ongeveer 0,1.
  5. Draai de cultuur bij 30 ° C gedurende 24 uur. Dit maakt de selectie van diploïde omdat slechts diploïden met zowel KanMX4 in GMToolkit-a en NatMX4 in GMToolkit-α kunnen groeien in aanwezigheid van G418 en Nat (figuur 3).
  6. Breng 20 pl van de eendaagse cultuur 500 pl vers GNA met G418 en Nat. Het uitgangspunt OD 600 is ongeveer 0,2.
  7. Draai de buis bij 30 ° C gedurende 5 uur om cellen brengen de logfase (OD 600 van ~ 1).
  8. Volg de stappen (1,24) - (1.38) om de diploïde sporuleren en sporen te isoleren.
  9. Splitsing van de opschorting van gesporuleerde cellen in twee 300-uldelen en zet elk in een aparte 1,5 ml Eppendorf buis.
  10. Centrifugeer de buisjes bij 800 xg gedurende 5 minuten. Verwijder het supernatant.
  11. De pellet van een tube, 100 pl SC-His-medium een haploïden selecteren. De pellet van de andere buis, 100 pl SC-Leu medium tot α-haploiden selecteren.
  12. Draai de buizen bij 30 ° C geroerd. De uiteindelijke OD 600 lager moeten zijn dan 0,5. Als OD600 neiging te hoog, probeer kweken bij kamertemperatuur.
  13. Om GFP induceren, 100 pl vers SC-His (a) of SC-Leu (α) medium dat 20 ug / ml doxycycline. De eindconcentratie van doxycycline is 10 ug / ml. Vortex.
  14. Draai de buizen bij 30 ° C gedurende 2 dagen.

3. Flow Cytometry

  1. Voeg 900 ul van voorgefilterde TE buffer (pH 7,5) die 10 ug / ml doxycycline een 5-ml polypropyleen buis (BD Falcon # 352063) met de dop verwisseld met een cel-schroefdop van een 5-ml polystyreen buis (BD Falcon # 352235). Polypropyleenbuisjes geschikt voor flowcytometrie. De schroefdop is gewenst voor het verwijderen van grote deeltjes.
  2. Plaats voorzichtig 75 ul van TE-buffer met doxycycline op de mobiele zeef cap.
  3. Voeg 25 ul van de geïnduceerde cellen aan de oplossing van de dop.
  4. Houd de punt van Pipetman tegen het gaas, schiet alle van de gecombineerde oplossing door de zeef.
  5. Druk de schroefdop en vortex de tube.
  6. Bereid verzamelbuizen (1,6 ml Eppendorf buisjes) gevuld met 200 pl SC-His-Leu of SC.
  7. Start de cel sorteerder en instellingen aan te passen in overeenstemming met de handleiding van de fabrikant.
  8. Vortex zowel de verzamelbuis (het bekleden van de muur met het medium) en de buis met cellen voordat ze op de celsorteerder.
  9. Verwerven flowcytometrie data van het monster. Een stam zonder GFP kan een negatieve controle.
  10. Teken poorten voor het sorteren. (A)Naar cel aggregaten, die een hoge GFP intensiteit kunnen vertonen te vermijden, gooi uitschieters met onevenredig grote pulsbreedte voor voorwaartse verstrooiing (FSC) met behulp van een perceel van pulsbreedte en pulse hoogte voor MoFlo sorteerder of onevenredig klein FSC hoogte met behulp van een perceel van FSC hoogte en FSC gebied FACSAria sorter (Figuur 5, panel linksboven). (B) Aangezien grote FSC (gebied) wordt verwacht celaggregaten, alleen cellen in de onderste 20% in FSC en vermijdt gebieden met de laagste FSC en zijwaartse verstrooiing (SSC) waarden wanneer celresten vaak gevonden (figuur 5, top-rechter paneel). (C) SSC (gebied) en GFP-signaal (gebied) worden vaak positief gecorreleerd. Omdat uitsluitend het helderste cellen gezien de poorten bovenstaande zou verrijken voor cellen met een hoge waarde SSC, opneming van een opening aan de omtrek van de populatie met een plot van GFP intensiteit en SSC een vergelijkbaar percentage van de helderste cellen uit elk punt van de SSC as (figuur 5, bottom-linker diagram). De populatie geselecteerd in (C) 0,1-1% van de bevolking geselecteerd in (B).
  11. Sorteer 200 cellen in de verzamelbuis gegeven aan de criteria in (3.10). Voor een massaal proces of voor andere projecten die een meer complexe bevolking, sorteren meer cellen als nodig is.
  12. Vortex de collectie buis naar de gesorteerde cellen met medium te dekken.
  13. Plaat een subset van cellen (bijvoorbeeld 50 cellen) op YPDA plaat voor genotypering.
  14. Incubeer de plaat bij 30 ° C gedurende 2 dagen.
  15. Een lysaat van ~ 12 kolonies na stappen (1,5) - (1,8).
  16. Breng de resterende cellen van de gebruikte tip in (1,5) naar een plek op een YPDA plaat met G418 en Nat door voorzichtig aanraken van de plaat met de tip. Geselecteerde haploiden mag niet groeien op deze plaat. Diploïden kunnen meer GFP kopieën en kan daarom helderder. Deze test kan aantonen van de efficiëntie van haploïde selectie.
  17. Voor genotypering, analyseren 1 ul van het lysaat met een 10-pl PCR reaction met een voorwaartse primer die bindt met de stroomopwaartse flankerende gebied van elke verwijderde gen gekoppeld aan een primer van de sequentie CCTGAGAAAGCAACCTGACC.
    Multiplex PCR reacties indien mogelijk (voorwaarden kan worden bepaald met lysaten van enkele mutanten). PCR kan op een 96 - of 384-wells formaat. De laatste formaat is geschikt voor de reactie volume van slechts 5 ui. Rangschikken van PCR mastermengsels verschillen in primers en toevoeging van cellysaten deze mengsels kunnen worden uitgevoerd met een multi-kanaal pipet of een vloeistofverwerking robot. Tip veranderingen zijn optioneel bij het toevoegen van hetzelfde lysaat aan verschillende PCR mixen.
  18. PCR-producten te analyseren. De Gel XL Ultra V-2 elektroforese systeem (Labnet) is compatibel met het monster laden met behulp van multi-channel pipetten.
  19. Gebaseerd op informatie van (3.16) en (3.18), te identificeren waarschijnlijk haploiden die gewenste genotypen.
  20. Vaststellen van deze stammen op een verse plaat (YPDA, CAA-Ura, of SC-Ura-His/Leu). Ook invriezen in25% glycerol bij -80 ° C. Aanvullende tests zoals een bevestiging van de afwezigheid van wild-type sequenties voor verwijderde genen en pulsed-field gelelektroforese worden aanbevolen.
  21. Herhaal seksuele fietsen uit (2.1) met handige stammen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Wanneer een a-haploïde stam die vier GFP-gemerkte deleties (ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ) werd gekruist met een α-haploïde stam die vier deleties (ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ) met twee deleties (ycl033cΔ yer042wΔ) gedeeld door twee stammen, representant resultaat verkregen. De paring mengsel werd gekweekt in YPDA medium dat G418 en Nat te diploïden te selecteren. De resulterende diploïden werden gekweekt in de sporulatie medium. De sporen werden verspreid door zymolyase behandeling en sonicatie, en ontkiemd in haploïde selectiemedium. De cellen werden vervolgens geïnduceerd om GFP expressie. Met poorten met een flowcytometer werd een populatie van cellen geselecteerd die waarschijnlijk vuil of celaggregaten (figuur 5) bevatten. In deze populatie werd de helderste 1% van de cellen gesorteerd. Gesorteerd cellen en ongesorteerd cellen genogetypt nadat ze gevormd kolonies op een bord. Bij willekeurig geselecteerde kolonies werden uitgestreken op een YPDA plaat met G418 en Nat, cellen van 2 van de 16 kolonies groeiden voor het ongesorteerde monster, en cellen van 18 van de 26 kolonies groeiden voor het gesorteerd monster, wat suggereert dat sommige diploïden de mogelijkheid gekregen een haploïde-selectie marker expressie en gepropageerd in het haploïde-selectie en GFP-inductie fasen in dit experiment. Diploïden werden verder verrijkt in de gesorteerde monster waarschijnlijk door het grotere aantal GFP kopieert ze bevatten. Wanneer haploïden werden geanalyseerd met PCR, het gemiddelde aantal deleties in de gesorteerde cellen was 5,1 ± 0,4 (n = 8; SEM getoond). Vier van deze cellen zes deleties, het maximaal mogelijke aantal deleties hadden voor deze kruising. Haplotypen van het ongesorteerde monster had 3,4 ± 0,2 deleties gemiddeld (n = 14).

In een afzonderlijk experiment, een a-haploïde stam die zeven GLM-gemarkeerde deleties (yer042wΔ yer108cΔ yfr057wΔ ykl069wΔ ykr011cΔ ylr123cΔ yol118cΔ) werd gekruist met een α-haploïde stam die acht deleties (ycl033cΔ ydl227cΔ ydl242wΔ yer042wΔ yer108cΔ yfr057wΔ ygl109wΔ ykr011cΔ), met vier gemeenschappelijke deleties (yer042wΔ yer108cΔ yfr057wΔ ykr011cΔ) in de twee stammen. Wanneer diploïden werden geselecteerd en vervolgens gekweekt in de sporulatie medium, ongeveer 20% van de cellen gesporuleerde gebaseerd op microscopische waarneming (n> 100). Nadat de sporen werden gedispergeerd en ontkiemd, werden de resulterende haploïden geïnduceerd GFP tot expressie en gesorteerd op basis van fluorescentie als hierboven. Slechts een van 61 willekeurig gekozen cellen groeiden op een YPDA plaat met G418 en Nat, wat suggereert dat gesorteerde cellen voornamelijk werden haploïde. Wanneer geanalyseerd met PCR (Figuur 6), de gesorteerde cellen was de gemiddelde verwijdering aantal 8,8 ±0,3 (n = 12; SEM getoond) waaronder vijf cellen die tien deleties. Het verwachte aantal verwijderingen voor een ongesorteerde cel als gevolg van willekeurige segregatie bedroeg 7,5.

Figuur 1
Figuur 1. Monsters groen onder de microscoop. Fluorescence microfoto tonen een niet-mutante stam (links), een ProMonster stam (midden) en een 16-GFP monster stam (rechts). Identieke belichting, helderheid en contrast instellingen werden gebruikt voor afbeeldingen.

Figuur 2
Figuur 2. De regeling van de Green Monster proces. Single-mutant haploiden (lichtgroen) zijn gekoppeld. Meiotische recombinatie tijdens sporulatie van de paarde diploïde genereert een mengsel van 0-GFP-cellen (gebroken wit), 1-GFP-cellen (lichtgroen), en 2-GFP-cellen (donkergroen). Stroomcytometrie wordt gebruikt om de groene cellen verrijkt voor de 2-GFP cellen. Geïntegreerde moleculaire technieken kan de selectie van een haploïden-(His +), α-haploiden (Leu +) en diploïden (G418 en Nat-weerstand). Deze cyclus wordt herhaald om te verrijken voor stammen voorzien van een steeds toenemend aantal wijzigingen.

Figuur 3
Figuur 3. GFP verwijderen cassettes en GMToolkits. GFP verwijdering cassettes bevatten een GFP-reporter-gen en een gist transformatie marker (URA3). De tetO 2 promoter induceerbaar is door de toevoeging van doxycycline in het medium door de werking van de rtTA transcriptiefactor. Als het GFP niveau bereikt de maximale capaciteit van de cellen om het eiwit te stellen of enig toxisch effect tolereren ervan, de expressie kan worden gekozen door het verlagen van de concentratie doxycycline (echter op dat we niet te houden aan dergelijke verzadiging of toxiciteitseffecten zelfs met 16 exemplaren van GFP). Deze cassette kan worden gericht naar elk gen of regio verbinden van specifieke homologe sequenties met PCR. Als alternatief kan de universele GFP deletie cassette met identieke homologe sequenties geschikt worden gericht op KanMX4 'landingsplaatsen' in stammen van de gist knockout collectie. YFG geeft uw favoriete gen. Doos met verticale lijnen geeft DNA barcode. GMToolkits zijn geïntegreerd in de CAN1 locus. De STE2-his5 marker en STE3-LEU2 marker worden uitgedrukt in een mating type specifieke wijze haploïden om alleen a-haploïden te groeien in de afwezigheid van histidine en alleen α-haploiden te groeien in de afwezigheid van leucine, respectievelijk. Selectie op resistentie tegen G418 en Nat gelijktijdig selecteert de KanMX4 locus in een GMToolkit en NatMX4 locus in de andere en derhalve selecteert voor diploïde.

_content "fo: keep-together.within-page =" always "> Figuur 4
Figuur 4. Bevestiging van de correcte integratie van het GFP cassette. Een universele GFP cassette kan worden gebruikt om KanMX4 gemarkeerde deletie in de gist deletie verzameling een GFP-gemerkte deletie zetten. Een GFP kunnen gegenereerd deletie allel, PCR reactie met een voorwaartse primer die bindt met de stroomopwaartse flankerende gebied gekoppeld aan een reverse primer die bindt met het begin van de cassette (PCR A van stap 1.9) moet een band maken. PCR met een reverse primer die bindt met de stroomafwaartse flankerend gebied gepaard met een voorwaartse primer die bindt met het uiteinde van de cassette (PCR B) dient een product. PCR met twee primers die hybridiseren in de KanMX4 cassette (PCR C) of met twee primers die hybridiseren aan de wild-type sequentie van het gerichte gen (PCR D) mag produceren band. Rode pijl vertegenwoordigt een PCR primer. Bracmarkt toont een gebied geamplificeerd met PCR reactie. Box geeft de GFP cassette (groen), de KanMX4 cassette (geel), of je favoriete gen (YFG, grijs). Zwarte lijn geeft een flankerende sequentie in een gist chromosoom.

Figuur 5
Figuur 5. Flowcytometrie. In dit experiment haploïde nakomelingen uit een kruising van twee stammen, een met de genotype ycl033cΔ yer042wΔ ykl069wΔ yol118cΔ en de andere met de genotype ycl033cΔ ydl242wΔ ydl227cΔ yer042wΔ werden geïnduceerd om GFP expressie. Elk gen deletie had een GFP cassette. Door gating cellen op basis van voorwaartse verstrooiing stippellijn forward scatter hoogte (P1), celaggregaten (die de neiging hebben onevenredig grote voorwaartse verstrooiing gebied werden uitgesloten. Door gating cellen op basis van voorwaartse verstrooiing en zijwaartse verstrooiing (P2), ceLLS in de onderste 20% in voorwaartse verstrooiing werden geaccepteerd, terwijl met uitzondering van puin met de laagste voorwaartse verstrooiing en zijwaartse verstrooiing. Door gating cellen op basis van zijwaartse verstrooiing en GFP signaal (P3), werden de fluorescerende cellen onder die in een bepaalde zijde strooigoedbreedte genomen. De vergelijking van de meiotische mix en de negatieve controle monster dat geen uitdrukkelijke GFP, een poort identiek aan die gebruikt voor het selecteren van de populatie P3 weergegeven in een schema voor de eveneens geselecteerde cellen van de negatieve controle mogelijk.

Figuur 6
Figuur 6. Genotypering de gesorteerde stammen. PCR werd uitgevoerd met een reverse primer die bindt met de stroomafwaartse flankerend gebied gepaard met een voorwaartse primer die bindt met het uiteinde van de cassette. De aanwezigheid van band geeft de aanwezigheid van het GFP cassette. Een afzonderlijk experiment toonde aan dat alle twaalf stammen conTain het yer042w Δ verwijderen en de ykr011c Δ verwijderen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Bij het ontwikkelen van de Green Monster benadering zijn we bezig met de mogelijkheid van recombinatie tussen verschillende GFP vervangen cassettes, waardoor genoom omlegging. Verzachten tegen deze mogelijkheid is onze selectie voor cellen die succes hebben ondergaan meerdere ronden van paring en meiose. Cellen die herschikt genomen naar verwachting minder geschikt na koppeling met een identieke cellen zonder omlegging. Inderdaad, we hebben niet in acht te nemen genoom instabiliteit als gevolg van recombinatie tussen GFP cassettes 11. We kunnen echter niet volledig uit te sluiten deze mogelijkheid, dus het is aangeraden dat gebruikers de gegenereerde stammen voor herschikking te testen. Pulsed-field gelelektroforese kan worden gebruikt om grove afwijking detecteren. PCR met primers hechten aan sequenties in de verwijdering kan worden gebruikt om de afwezigheid van wild-type sequenties te bevestigen.

Gebaseerd op de fluorescentieniveaus van gevestigde stammen, GFP intensiteit had een bijna lineair verband met het aantal deleties, suggereert dat verzadiging geen probleem binnen het geteste bereik van een tot 16 deleties 11. Zelfs in latere rondes met stammen met veel niet-overlappende deleties, konden we het gemiddelde aantal deleties alleen maar toenemen in de populatie met ongeveer twee per ronde, dat theoretisch een cel die de vereniging van alle deleties in de twee ouderlijke stammen kunnen tegelijkertijd worden gecombineerd als perfect stringentie voor GFP selectie bereikt. Een beperking is de cel-tot-cel variant van GFP-intensiteit tussen isogene cellen. In het tweede voorbeeld in Representatieve resultaten, slechts 0,8% van cellen in de populatie worden verwacht dat alle 11 deleties dat mogelijk was in deze kruising (vier van de 11 deleties werden gedeeld door beide ouders haploïden) hebben. Echter de overvloediger tien deletiestammen een verdeling van GFP intensiteit die samenvalt met die van de 11-deletie strains. Daarom moet een nog kleiner deel van de bevolking worden gekozen voorkeur selecteren 11 deletiestammen van de hogere staart van de GFP intensiteitsverdeling van 11-deletiestammen. Een mogelijke oplossing is eenvoudig die drempel om zeldzame cellen te sorteren met hogere intensiteit GFP. Een andere oplossing kan zijn voor het gelijktijdig meten van een interne standaard, een fluorescerend eiwit reporter van een andere kleur die aanwezig is in een enkel exemplaar uitgedrukt via dezelfde tetO 2 promoter. Deze strategie zou worden verwacht op te heffen extrinsieke ruis de cel-tot-cel variant van GFP aldus genormaliseerde lichtsterkte 16,17 verminderen.

De moeilijkheid van het verkrijgen van zeldzame multi-mutanten kan worden verergerd door de potentieel trage groei van deze stammen. Multi-mutanten worden verrijkt met behulp van flowcytometrie, maar ze kunnen worden geconcurreerd gedurende de rest van het proces installateur siblings. Als u het aantal generaties te minimaliserengiststammen ondergaan, raden kleine kweekvolumes dat net voldoende versterking van cellen van de gewenste ploïdie die zijn geselecteerd bij elke stap.

Omdat meerdere deleties kan worden verkregen per cyclus kan de Green Monster werkwijze worden gebruikt om multi-mutanten assembleren sneller dan sequentiële werkwijzen 11. Indien specifieke subsets van deleties hebben synthetische dodelijke relaties, kan 'doodlopende' worden ondervonden met sequentiële benaderingen. Deze beperking kan worden omzeild door het Groene Monster aanpak, die monsters van de ruimte van mogelijke paden in de richting van het verzamelen van de volledige set van verwijderingen. Hoe meer parallel massaal versie van de Green Monster proces moet nuttig zijn bij het ​​vinden van een pad naar de grootste toegestane aantal verwijderingen te bereiken.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Geen belangenconflicten verklaard.

Acknowledgments

Dit werk werd ondersteund door de US Defense Advanced Research Projects Agency contract N66001-12-C-4039 aan YS, een subsidie ​​van de Alfred P. Sloan Foundation om RSL, en de Amerikaanse National Institutes of Health subsidies R01 HG003224 en R21 CA130266 te FPRFPR was ook ondersteund door een beurs van de Canadese Institute for Advanced Research en door de Canada Excellence Research Chairs programma.

Materials

Name Company Catalog Number Comments
G418 Sigma-Aldrich A1720 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 200 mg/ml. Store at 4 °C.
ClonNAT (nourseothricin) WERNER BioAgents 5001000 Dissolve in water and filter-sterilize (0.2-μm filter). Stock concentration: 100 mg/ml. Store at 4 °C.
Doxycycline Sigma-Aldrich D9891 Dissolve in 50% ethanol and filter-sterilize (0.2-μm filter). Stock concentration: 10 mg/ml. Make fresh every four weeks. Shield from light using aluminum foil and store at 4 °C.
Zymolyase ZymoResearch E1005
Difco yeast nitrogen base w/o amino acids BD 291940
Revolver (rotator for tubes) Labnet H5600
Enduro Gel XL electrophoresis unit Labnet E0160
Sonifier 450 Branson 101-063-198
Microtip for Sonifier 450 Branson 101-148-062
FACSAria cell sorter BD
MoFlo cell sorter Beckman-Coulter
Biomek FX or equivalent robot Beckman Coulter Optional. For setting up genotyping PCRs.

DOWNLOAD MATERIALS LIST

References

  1. Tong, A. H., et al. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science's STKE. 294, 2364-23 (2001).
  2. Hillenmeyer, M. E., et al. The chemical genomic portrait of yeast: uncovering a phenotype for all genes. Science. 320, 362-365 (2008).
  3. Beh, C. T., Cool, L., Phillips, J., Rine, J. Overlapping functions of the yeast oxysterol-binding protein homologues. Genetics. 157, 1117 (2001).
  4. Wieczorke, R., et al. Concurrent knock-out of at least 20 transporter genes is required to block uptake of hexoses in Saccharomyces cerevisiae. FEBS letters. 464, 123-128 (1999).
  5. Alani, E., Cao, L., Kleckner, N. A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics. 116, 541-545 (1987).
  6. Akada, R., et al. PCR-mediated seamless gene deletion and marker recycling in Saccharomyces cerevisiae. Yeast. 23, 399-405 (2006).
  7. Guldener, U., Heck, S., Fielder, T., Beinhauer, J., Hegemann, J. H. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic acids research. 24, 2519 (1996).
  8. Delneri, D., et al. Exploring redundancy in the yeast genome: an improved strategy for use of the cre-loxP system. Gene. 252, 127-135 (2000).
  9. Storici, F., Lewis, L. K., Resnick, M. A. In vivo site-directed mutagenesis using oligonucleotides. Nat. Biotech. 19, 773-776 (2001).
  10. Noskov, V. N., Segall-Shapiro, T. H., Chuang, R. Tandem repeat coupled with endonuclease cleavage (TREC): a seamless modification tool for genome engineering in yeast. Nucl. Acids Res. 38, 2570-2576 (2010).
  11. Suzuki, Y., et al. Knocking out multigene redundancies via cycles of sexual assortment and fluorescence selection. Nat. Methods. 8, 159-164 (2011).
  12. Winzeler, E. A. Functional Characterization of the S. Genome by Gene Deletion and Parallel Analysis. Science. 285, 901-906 (1999).
  13. Woods, R. A., Gietz, R. D. High-efficiency transformation of plasmid DNA into yeast. Methods Mol. Biol. 177, 85-97 (2001).
  14. Hughes, T. R., et al. Widespread aneuploidy revealed by DNA microarray expression profiling. Nature. 25, 333-337 (2000).
  15. Goldstein, A. L., McCusker, J. H. Three new dominant drug resistance cassettes for gene disruption in Saccharomyces cerevisiae. Yeast. 15, 1541-1553 (1999).
  16. Newman, J. R. S., et al. Single-cell proteomic analysis of S. cerevisiae reveals the architecture of biological noise. Nature. 441, 840-846 (2006).
  17. Rosenfeld, N., Young, J. W., Alon, U., Swain, P. S., Elowitz, M. B. Gene regulation at the single-cell level. Science. 307, 1962 (2005).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics