مجموعة أدوات لتمكين تحويل المواد الهيدروكربونية في البيئات المائية

Bioengineering
 

Summary

تم تصميم نظام السيارات المستدامة تنظم البكتيرية لعلاج التلوث النفطي باستخدام معيار أجزاء DNA للتبادل (BioBricks). وهندسيا

Cite this Article

Copy Citation | Download Citations

Brinkman, E. K., Schipper, K., Bongaerts, N., Voges, M. J., Abate, A., Wahl, S. A. A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments. J. Vis. Exp. (68), e4182, doi:10.3791/4182 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

هذا العمل يطرح مجموعة أدوات التي تمكن من تحويل الألكانات من الإشريكية القولونية، ويقدم دليلا على مبدأ إمكانية تطبيقه. مجموعة الأدوات يتكون من أجزاء متعددة قابلة للتبديل القياسية (BioBricks) 9 التصدي لتحويل الألكانات، وتنظيم التعبير الجيني والبقاء على قيد الحياة في البيئات الغنية الهيدروكربونية السامة.

تم تنفيذ مسار ثلاث خطوات لتدهور ألكان في E. الإشريكية لتمكين تحويل الألكانات متوسطة وطويلة السلسلة إلى alkanols كل منها، والأحماض alkanals alkanoic-في نهاية المطاف. ويستقلب هذا الأخير عبر مسار β للأكسدة الأصلية. لتسهيل أكسدة المتوسطة سلسلة الألكانات (C5-C13) وcycloalkanes (C5-C8)، وأربعة جينات (alkB2، rubA3، rubA4 والمطاطية) من نظام هيدروكسيلاز ألكان من Gordonia SP. تحولت TF6 8،21 في E. القولونية. لتحويلسلسلة طويلة الألكانات (C15-C36)، تم تنفيذ هذا الجين لادا من thermodenitrificans Geobacillus. لمزيد من الخطوات المطلوبة لعملية التدهور، وأدخلت ADH وALDH (القادمة من thermodenitrificans G.) 10،11. تم قياس النشاط المقايسات الخلية الراحة. لكل خطوة الأكسدة، لوحظ نشاط انزيم.

لتحسين كفاءة عملية، وكان المستحث فقط التعبير في ظل ظروف انخفاض الجلوكوز: تم استخدام الركيزة المروج التنظيم، pCaiF. pCaiF موجود في E. K12 القولونية وينظم التعبير عن الجينات المسؤولة عن تدهور مصادر الكربون غير الجلوكوز.

ونفذ باستخدام الجينات التسامح المذيبات، وPhPFDα β، وكلاهما من Pyrococcus horikoshii OT3 - الجزء الأخير من مجموعة الأدوات - استهداف البقاء. يمكن المذيبات العضوية لحث على الإجهاد وانخفاض الخلايا البقاء على قيد الحياة من قبل affectin سلباغرام من البروتين للطي. كما المحرمين، وPhPFDα β تحسين عملية مثل البروتين للطي في ظل وجود من الألكانات. وقد لوحظت التعبير عن هذه الجينات أدى إلى التسامح الذي أبداه الهيدروكربونية تحسين معدل زيادة النمو (إلى 50٪) في الوجود من 10٪ N-الهكسان في ثقافة المتوسط.

تلخيص، فإن النتائج تشير إلى أن مجموعة أدوات تمكن E. الإشريكية لتحويل وتحمل النفط والغاز في البيئات المائية. على هذا النحو، فإنه يمثل خطوة أولية نحو إيجاد حل مستدام لإصلاح النفطية باستخدام نهج البيولوجيا التركيبية.

Protocol

1. BioBrick الجمعية

  1. وتقدم BioBricks من التسجيل الأجزاء البيولوجية المعيارية من مقر iGEM. لبناء BioBrick جديدة من BioBricks القائمة، هضم BioBrick المانحة (تصل إلى 1.0 ميكروغرام) مع الانزيمات وEcoRI SpeI لتحديد المواقع المصب جزء المانحة للجزء متقبل. ملخص مع XbaI وPstI لتحديد المواقع الجزء المانحة المنبع للجزء متقبل. إضافة 1/3 انزيم تقييد المناسبة التي تقطع في العمود الفقري للالمانحين. أداء الهضم في إجمالي حجم من 20-25 مل مع المخزن المؤقت المناسبة، وفقا لمزود (تركيز النهائي 1X). استخدام 5 وحدات / DNA ميكروغرام للإنزيمات التقييد.
  2. هضم BioBrick متقبل مع أي EcoRI وXbaI أو SpeI وPstI.
  3. احتضان الهضم ل(على الأقل) واحد ساعة في 37 ° C. إبطال نشاط نوكليازات الاقتطاع الداخلية عن طريق الحرارة، الحضانة عند 80 درجة مئوية لمدة 10 دقيقة وطرد المركزي في وقت قريب.
  4. Ligate على هضم BioBrickأجزاء (المانحة ومتقبل) معا. منذ XbaI وSpeI توليد ينتهي DNA متوافق، يتم إنشاء موقع المختلطة التي لا يمكن قطع مع أي تقييد انزيم مما أدى إلى BioBrick الجديدة مجتمعة بأن يحيط بها 4 مواقع تقييد القياسية. في خليط ربط تركيز DNA النهائي هو يفضل ~ 100 نانوغرام / ميكرولتر. أداء رد فعل ربط في إجمالي حجم من 10-15 مل مع المخزن المؤقت ربط T4 (تركيز النهائي 1X) ويغاز T4 (1 وحدة / ميكروغرام DNA).
  5. احتضان الخليط في ربط C ° 16 على الأقل 3 ساعة.
  6. أداء رد فعل التحول مع نصف مزيج من حوالي ربط.
  7. تأكيد BioBrick أن يكون صحيحا مع التسلسل.
  8. لبناء BioBrick جديدة من DNA توليفها، تعديل الجينات لتخليق الأمثل للتعبير في E. القولونية عن طريق أداة الموقع JCat ( http://www.jcat.de/ ). إجراء تعديلات إضافية، وفقا لمتطلبات B ioBrick القياسية. هذا يعني أن توحيد يتكون كل BioBrick من تسلسل الحمض النووي التي تهم يسبقه البادئة ويليه لاحقة. البادئة واللاحقة هي متواليات التي تحتوي على مواقع محددة سلفا تقييد، التي هي غائبة في تسلسل البلازميد المتبقية. تقييد هذه المواقع القياسية تجعل من الممكن لتبادل وتوسيع إدراج BioBrick بمرونة 9. البادئة واللاحقة لها تسلسل التالي:
اسم تسلسل تعليق
بادئة 5 'GAATTCGCGGCCGCTTCTAG3'
5 'GAATTCGCGGCCGCTTCTAGAG 3' إذا كان الجزء التالي هو تسلسل الترميز أو أي الجزء الذي يبدأ ب "ATG"
لاحقة 5 'TACTAGTAGCGGCCGCTGCAG 3'
ove_title "> 2 تحويل ألكان. يستريح الفحص الخلوي، في الجسم الحي

تم إجراء هذا الاختبار يعتمد على الطريقة الموصوفة من قبل فوجي وآخرون (2004).

  1. ثقافة E. خلايا الإشريكية معربا عن نظام هيدروكسيلاز ألكان ( BBa_K398014 ) والخلايا يحمل ناقلات الفارغة ( BBa_J13002 ) في 5 مل المتوسطة LB مع المضادات الحيوية المناسبة بين عشية وضحاها.
  2. نقل 500 ميكرولتر من الثقافة بين عشية وضحاها في 50 مل من LB جديدة (مع مضاد حيوي) واحتضان الخلايا التعكر حتى التوصل الى OD (الكثافة الضوئية) بنسبة 0.3 في 600 نانومتر.
  3. أجهزة الطرد المركزي لمدة 10 دقيقة في 4،000 دورة في الدقيقة و resuspend بيليه في 5 مل العازلة الفوسفات 0،1 M (درجة الحموضة 7.4).
  4. أجهزة الطرد المركزي مرة أخرى لمدة 10 دقيقة في 4،000 دورة في الدقيقة و resuspend بيليه في 5 مل العازلة الفوسفات M 0،1 تحتوي على أملاح E2 الآن و0.66٪ V / V الجلسرين (النيتروجين deficienر متوسطة).
  5. قياس العكارة الخلية (OD 600).
  6. إعداد خليط الخلايا مأخوذة من 6 مل مل في 25 قوارير الزجاج المغلقة الغطاء وعدم التحكم الخلية (E2 + أملاح 0.66٪ V / V الجلسرين).
  7. إضافة 100 نانومول لكل من ألكان القارورة.
  8. احتضان مخاليط في C ° 37 لمدة 24 ساعة (تقصير عندما يتم الحصول على معدلات أعلى).
  9. قياس OD 600 بعد الحضانة.
  10. استخراج الهيدروكربونات في وسائل الإعلام الثقافة عن طريق خلات الإيثيل وتحديد تركيز المواد الهيدروكربونية في الثقافة الخلية بواسطة كروماتوغرافيا الغاز (انظر البروتوكول 3).
  11. حساب تدهور لكل وحدة من الكتلة الحيوية من خلال تقسيم المبلغ الإجمالي للألكان تحويلها من قبل الحاضر مجموع الكتلة الحيوية في كل قارورة (OD 600 إلى تحويل الوزن الجاف). تقسيم الناتج على مدة تجريبية تعطي النشاط تدهور في الكتلة الحيوية وحدة لكل وحدة الزمن. يتم أخذ المتوسط ​​من ثلاثة أشواط الفردية.

3. ألكان الفحص إنزيم تحويل، وفيالمختبر

تم إجراء هذا الفحص بشكل أساسي وفقا لطريقة وصفها لي وآخرون (2008).

  1. ثقافة E. خلايا الإشريكية التعبير عن الجينات لادا ( BBa_K398017 ) والخلايا يحمل ناقلات الفارغة ( BBa_J13002 ) في 50 مل المتوسطة بالمضادات الحيوية المناسبة LB بين عشية وضحاها.
  2. نقل 500 ميكرولتر من الثقافة بين عشية وضحاها في 50 مل من LB جديدة (مع مضاد حيوي) واحتضان الخلايا التعكر حتى التوصل إلى الكثافة البصرية بنسبة 0.6 في 600 نانومتر.
  3. أجهزة الطرد المركزي في 10 دقيقة 4،000 دورة في الدقيقة (4 ° C) و resuspend بيليه في 5 مل من 50 ملي تريس العازلة.
  4. يصوتن (خلية ديسروبتر، LA النظم البيولوجية) الخلايا في دورة عمل 40٪ مع عنصر تحكم الإخراج من 4، والحفاظ على الحل على الجليد لكامل مدة.
  5. أجهزة الطرد المركزي في الخليط الناتج لمدة 5 دقائق في 4،000 دورة في الدقيقة في 4 و دعلى سبيل المثال؛ C لإزالة الحطام الخلية. نقل طاف إلى قارورة جديدة.
  6. تحديد تركيز البروتين الكلي للخلية مقتطفات من الفحص برادفورد. ملاحظة: استخدام قوارير الزجاج لمنع زيادة الخلفية و / أو فقدان البروتين.
  7. إعداد خليط 100 مل تحتوي على 0.1٪ V / V ألكان و 50 ملي تريس، حمض الهيدروكلوريك العازلة.
  8. تسخين الخليط في 100 درجة مئوية لمدة 5 دقائق. ملاحظة: تنفيذ هذه الخطوة فقط لسلسلة الألكانات متوسطة طويلة مع ارتفاع درجة الغليان. (على سبيل المثال C 16: 287 ° C).
  9. لتحقيق الذوبان الأمثل للألكان، يصوتن لمدة 1 دقيقة في حين لا يزال دافئا حتى يتم الحصول على متجانسة، خليط لزج.
  10. إضافة 1MM من NADH، 1 ملم أحادي نوويد الفلافين، 1 ملم MgSO 4 و 0،01 ت / ت تريتون X-100.
  11. إعداد 6 مليلتر مأخوذة في 25 قوارير مغلقة غطاء مل.
  12. إضافة كميات كافية من مستخلص الخلية (يعتمد على المقايسات برادفورد، وتركيز النهائي من 5 ملغم بروتين / لتر). إعداد التحكم لم البروتين.
  13. احتضان عند 60 ° C (للبريد الأمثلnzymatic النشاط) لمدة 24 ساعة.
  14. استخراج الهيدروكربونات في وسائل الإعلام الثقافة عن طريق خلات الإيثيل وتحديد تركيز المواد الهيدروكربونية في الثقافة الخلية بواسطة كروماتوغرافيا الغاز (انظر البروتوكول 3).
  15. وأضاف حساب تدهور لكل وحدة من الكتلة الحيوية من خلال تقسيم المبلغ الإجمالي للألكان تحويلها من قبل البروتين الكلي لكل قارورة (من منحنى المعايرة برادفورد). مزيد من تقسيم مدة التجربة تعطي النشاط تدهور لكل وحدة من البروتين الخلوي لكل وحدة الزمن. يتم أخذ المتوسط ​​من ثلاثة أشواط الفردية.

4. إيثيل أسيتات استخراج النفط والغاز وقياسات تركيز

  1. يتم استخراج الألكانات من محلول مائي عن طريق إضافة 2.5 مل خلات الإيثيل (solvant عديم الأقطاب) إلى حل التجريبية 6 مل. يتم إضافة القياسي الداخلي للمذيب عند تركيز 0.1٪ (V / V). المعيار (على سبيل المثال، سيكلو ديكان) تختلف اعتمادا على مجموعة من قمم المتوقع في المصالح.
  2. اختياري: إضافة تريتونX-100 إلى خليط مائي وأجهزة الطرد المركزي العينات لمدة 10 دقيقة في 4،000 دورة في الدقيقة من أجل الحصول على المناسبة ثنائية طوري النظام.
  3. دوامة الخليط لمدة 5 ثوانى (1،500 دورة في الدقيقة) واحتضان في درجة حرارة الغرفة حتى مرحلتي منفصلة.
  4. إزالة كمية ممكنة من الطبقة العضوية (أعلى) وتجفيف المذيبات اللامائية باستخدام كبريتات المغنيسيوم.
  5. إزالة MgSO 4 من الترشيح (0.2 ميكرومتر) ونقل الراشح في قوارير الغاز اللوني للمقاييس، أو مخزن في -20 ° C.
  6. تحديد تركيز بواسطة جهاز الكروماتوجرافي الغازي باستخدام عمود CP-SIL 5CB (طول = 5 م). حقن 10 ميكرولتر من العينة في طريقة تقسيم (1:10، 230 ° C). تعيين العمود تدفق الغاز إلى 1 مل / دقيقة (الهيليوم). ويستخدم الفرن درجة حرارة التالية البرنامج:
    معدل درجة حرارة [° C] الوقت [دقيقة]
    0 50 7.5
    50 90 1.0
    50 110 2.0
    50 130 2.0
    50 145 2.0
    50 160 2.0
    50 170 2.0
    50 185 2.0
    50 210 2.0
    50 250 2.0
    50 320 2.0
  7. دمج القمم وتصحيح تركيزات فيما يتعلق القياسي الداخلي.

5. الكحول / الفحص ألدهيد نشاط إنزيم

تم إجراء هذا الفحص بشكل أساسي وفقا لطريقة وصفها آخرون كاتو.(2010).

  1. ثقافة E. الخلايا القولونية التعبير عن ADH ( BBa_K398018 ) أو ALDH ( BBa_K398030 ) الجينات والخلايا يحمل ناقلات الفارغة ( BBa_J13002 ) في 50 مل المتوسطة بالمضادات الحيوية المناسبة LB بين عشية وضحاها.
  2. نقل 500 ميكرولتر من الثقافة بين عشية وضحاها في 50 مل من LB جديدة (مع مضاد حيوي) واحتضان الخلايا التعكر حتى التوصل إلى الكثافة البصرية بنسبة 0.6 في 600 نانومتر.
  3. أجهزة الطرد المركزي في 10 دقيقة 4،000 دورة في الدقيقة في C ° 4 و resuspend بيليه في 5 مل من 50 ملي تريس العازلة.
  4. يصوتن الحل الخلية في دورة عمل 40٪ مع عنصر تحكم إخراج 4 (إبقاء الحل على الجليد خلال صوتنة).
  5. أجهزة الطرد المركزي في الخليط الناتج لمدة 5 دقائق في 4،000 دورة في الدقيقة في 4 درجات مئوية لإزالة الحطام الخلية.
  6. لتحديدتل تركيز البروتين في الخلية عن طريق الفحص مقتطفات برادفورد (ملاحظة: استخدام قارورة زجاجية لمنع ملزمة البروتين).
  7. تحميل وحة 96 ميكرولتر جيدا مع 180 57 مم جليكاين العازلة التي تحتوي على NAD (تركيز النهائي 1 ملم، ودرجة الحموضة 9.5) في كل بئر.
  8. إضافة 5 ميكرولتر من الكحول (ألدهيد) لفحصها للآبار. ملاحظة: الكحول الحرارة سلسلة طويلة قبل بدء الفحص أن يكون السائل. وينبغي أن يضاف لكل الكحول (ألدهيد) عنصر تحكم دون الركيزة (المراقبة السلبية). وبالإضافة إلى ذلك، تعد فارغة تحتوي على خليط من العازلة والركيزة دون استخراج الخلايا.
  9. سخن لوحة للقارئ لوحة (ماجلان TECAN V7.0) لمدة 15 دقيقة عند 37 درجة مئوية للسماح للموازنة للنظام.
  10. إضافة كميات كافية من مستخلص الخلية (يعتمد على المقايسات برادفورد، وتركيز النهائي من 5 ملغم بروتين / لتر). إعداد التحكم لم البروتين.
  11. قياس إنتاج NADH باستخدام الطيف في طول موجة من 340 نانومتر كل دقيقة من 2-3 1 ساعة عند 37 ° C. </ لى>
  12. حساب معدل إنتاج NADH من منحدر OD (340 نانومتر). تأخذ في الاعتبار طول مسار الضوء ومعامل انقراض NADH من 6220 سم -1 M -1. وأضاف تقسيم معدل إنتاج NADH من المبلغ الإجمالي من البروتين للتعبير عن النشاط للتفاعل نازعة في استخراج الخلايا (U / ملغم بروتين خلية كاملة). حساب متوسط ​​والانحراف المعياري من ثلاثة أشواط مستقلة.

6. pCaiF توصيف

  1. ثقافة E. خلايا الإشريكية معربا عن بناء pCaiF-GFP ( BBa_K398331 ) والخلايا التي تحمل المروج وحده ( BBa_K398326 ) بين عشية وضحاها في 5 مل المتوسطة المضادات الحيوية المناسبة LB بين عشية وضحاها.
  2. تطعيم 5 مل تحتوي على 10 M9 غرام / لتر الجلوكوز والمضادات الحيوية مع 50 ميكرولتر من الثقافة بين عشية وضحاها وتنمو بين عشية وضحاها. ثقافة فرعية 50 ميكرولتر من ثمرة بين عشية وضحاها إلى 5 مل من جديد ز with10 M9 / لتر واحتضان حتى وصلت إلى التعكر خلية الكثافة البصرية بنسبة 0.2 في 600 نانومتر.
  3. تحميل وحة 96 أيضا مع 100 ميكرولتر من M9 المتوسطة الطازجة التي تحتوي على المبلغ المطلوب من مصدر الكربون لاختبار في كل بئر. إجراء تجارب لتقييم ثلاث نسخ الإحصائية وإضافة عناصر التحكم الخاصة السلبية (البرية من نوع E. القولونية K12).
  4. إضافة 5 ميكرولتر من الثقافة بين عشية وضحاها إلى الآبار التي تحتوي على المتوسط.
  5. قياس منحنى النمو (OD 600) ومضان GFP (485 نانومتر الإثارة وانبعاث 520) باستخدام قارئ لوحة كل 10 دقيقة لمدة 18 ساعة عند 37 درجة مئوية مع الهز المستمر.
  6. حساب معدل النمو ومحتوى GFP محددة من القياسات منها وقارن بين عنصر التحكم. حساب متوسط ​​والانحراف المعياري على الأقل ثلاث تجارب مستقلة.

7. التسامح الفحص

  1. ثقافةكولاي التعبير عن الجينات وPhPFDα β ( BBa_K398406 ) بين عشية وضحاها في 5 مل المتوسطة LB والمضادات الحيوية المناسبة. E. القولونية التعبير عن الجينات لادا ( BBa_K398017 يستخدم) كما المراقبة السلبية.
  2. ثقافة فرعية 10 ميكرولتر من ثمرة بين عشية وضحاها إلى 5 مل جديدة من LB (مع مضاد حيوي) واحتضان حتى وصلت إلى التعكر خلية الكثافة البصرية من 0،3 حتي 0،4 في 600 نانومتر.
  3. تمييع الثقافات مع الطازجة المتوسطة وحتى يتم التوصل إلى OD 600 من 0.1.
  4. تحميل وحة 96 أيضا مع 180 ميكرولتر المتوسطة M9 التي تحتوي على المضادات الحيوية المناسبة والتركيز السليم النهائي للمركب سام (مثل 0، 4، 8، 10٪ من N-الهكسان) في ثلاث نسخ. لأن ألكان المياه يمكن أن يؤدي إلى خليط من مرحلتين نظم فمن الضروري أن يكون ضوابط ملائمة على لوحة (على سبيل المثال دifferent سلالات والتجارب ذات الصلة فارغة).
  5. إضافة 20 ميكرولتر من ثقافة (التحكم) في الآبار.
  6. قياس تركيز الكتلة الحيوية (OD 600) باستخدام قارئ لوحة كل 10 دقيقة لمدة 24 ساعة عند 37 درجة مئوية مع الهز المستمر.
  7. حساب معدلات النمو من القياسات منها عن تركيزات مختلفة كيل وقارن بين سيطرة سلبية. حساب متوسط ​​والانحراف المعياري على الأقل ثلاثة أشواط مستقلة.

8. Homolog التفاعل رسم الخرائط

  1. وقد وضعت تطبيق HIM لتنفيذ استعلامات البروتين في الخادم بوستجرس تشغيل قاعدة البيانات STRING (مجاني للاستخدام الأكاديمي) 20. تعيين تطبيق التفاعل نديد يحدد البروتينات المتفاعلة في الكائن الحي المضيف الأصلي باستخدام قاعدة بيانات STRING. يتم استخدام تسلسل من الجينات المعنية التفاعل في البحث للعثور على الجينات BLAST مثلي في الكائن الحي المستهدف. 4 Cytoscape https://github.com/jcnossen/InteractionHomologMapping.
  2. لإجراء رسم الخرائط، (1) دخول ID BioBrick والتطبيق سوف تحميل البيانات تلقائيا تسلسل جزء من قلم الأجزاء البيولوجية المعيارية أو (2) ENTER (لصق) البيانات تسلسل في التطبيق.
  3. استخدام الموقع قاعدة بيانات للبحث عن STRING ID STRING البروتين لتسلسل الأحماض الأمينية التي تم إدخالها.
  4. يتم تحديد البروتين مع تماثل عالية باستخدام الانفجار. بعد ذلك تطبيق تسرد كل بروتين التفاعل معروفة في الحي والبحث عن مصدر homologs في الكائن الحي المضيف (على سبيل المثال كولاي).
  5. تصدير قائمة الناتجة التفاعل المفترضة إلى نص أو Cytoscape.

Discussion

ويستخدم مبدأ BioBrick لبناء هيكل للتدهور الألكانات وتم الحصول على دليل على مبدأ واحد للمكونات مجموعة الأدوات. ويقترح عدة فحوصات لقياس في الجسم الحي والنشاط في المختبر من الانزيمات ألكان مسار المهينة. العمل المقدم يوضح بنجاح عددا من الأساليب التي يمكن استخدامها لتحديد الأنشطة انزيم والتعبير في الحي المضيف E. القولونية بعد تنفيذ BioBricks مناسبة. وعلاوة على ذلك، يظهر أن يمكن استخدام مبدأ BioBrick لتصميم كائن حي يعبر عن البروتينات اللازمة لتدهور الألكانات، ويوفر نظام التنظيمية التي تنتج هذه الإنزيمات إلا في حالة الضرورة وتقوي سماحة الكائن الحي المضيف في وجود النفط والغاز . مرة واحدة تطويرها، ويمكن استخدام هذا الهيكل لتحلل البيولوجي للنفط المتبقية، على سبيل المثال في الرمال النفطية المخلفات المياه، أو لعلاجالمياه العادمة من صناعة النفط.

فيما يتعلق تدهور ألكان، أجريت فحوصات للتوصيف الأنزيمات المشاركة في الخطوة الأولى من تدهور ألكان (AH-النظام وادا). وقد تبين أن لE. القولونية سلالة تحمل AH-نظام ليرة سورية Gordonia. كان TF6 قادرة على تحويل اوكتان في الجسم الحي. هذه النتيجة تتفق مع نتائج وآخرون فوجي. آل حيث من التحول الأحيائي N-الألكانات باستخدام E. وقد تحقق القولونية التعبير عن الجينات المكون الحد الأدنى من نظام-AH. تم قياس النشاط التحويل عن طريق دراسة مقارنة (wildtype مقابل متحولة) بعد وقت معين. لتوصيف كامل، دراسات إضافية يجب أن يتم على نشاط الجهاز-AH مع مرور الوقت والحركية للنظام.

لتحويل سلسلة طويلة الألكانات (C 15-C 36)، الجين لادا من Geobaتم تنفيذ thermodenitrificans cillus. تم اختبار نشاط انزيم في المختبر باستخدام سداسي الهيدروكربونية كمصدر طويلة السلسلة. هذا المعدل E. سلالة الإشريكية أظهرت زيادة نشاط انزيم مقارنة مع سلالة تحكم، مما يدل على البروتين المؤتلف ادا تمكن من تحويل سداسي E. القولونية. وبالإضافة إلى خاصية التحويل إلى الألكانات alkanols، E. تم تطوير سلالات القولونية مع عملية محسنة لتدهور الكحول والألدهيدات عن طريق تنفيذ ADH والجينات ALDH على التوالي. تم اختبار نشاط انزيم في الخلايا في المختبر مقتطفات من خلال قياس إنتاج NADH NAD + من. وE. وأظهرت سلالة الإشريكية معربا عن ADH زيادة بمقدار الضعف في النشاط نازعة الكحول مقارنة مع النشاط نوع البرية. زيادة التعبير عن بروتين ALDH مقارنة مع سلالة السيطرة، والنشاط نازعة dodecanal في E. سل القولونيةل مقتطفات ثلاثة أضعاف. وبما أن هذه المقايسات بوضوح زيادة نشاط انزيم في المختبر، ويمكن توقع أن تتحول E. سلالات القولونية ديهم مستويات مرتفعة من النشاط في الجسم الحي أيضا.

لاستكشاف إمكانية المضيفة التي يسببها التعبير (على سبيل المثال: عدم الاعتماد على المواد الكيميائية والحث عبء انخفاض النمو خلال)، أعرب عن مسار التدهور تحت سيطرة المروج pCaiF. هذا المروج ينشط التعبير الجيني عند مستويات الجلوكوز منخفضة، على سبيل المثال. في نهاية دفعة مرحلة النمو. كدليل على المبدأ، تم اختبار هذه المروج عبر GFP إنتاج الجلوكوز في ظل أنظمة الفرق. وقد تبين أن للpCaiF-GFP تحول E. تنتج بكتيريا أكثر GFP خلال المرحلة (الجلوكوز محدودة) ثابتة مما كانت عليه في المرحلة أسي (مستويات السكر العالية). في وجود مصدر الكربون الثانوية (على سبيل المثال. حمض اللوريك)، انخفض معدل الإنتاج GFP AGنظرا لهدم مصدر الكربون الثانوية عين.

وأظهرت التجربة التي يمكن استخدامها بفعالية هذه المروج لتمكين التحولات تقويضي من الجلوكوز لمسارات تدهور الجديدة. وهذا يتيح لتنمو بسرعة كمية هائلة من الكائنات الحية في المتوسط ​​الغنية قبل أن يتم تنشيط مسار تحلل. نقترح استخدام المروج pCaiF المنبع المنظم AlkS النسخي. في الكريهة الزائفة، AlkS تعترف C 5-C 10 N-الألكانات والمستجيبات. في وقت لاحق مستويات عالية من AlkS-ألكان مجمع المروج تفعيل PalkB مما أدى إلى التعبير عن البروتينات ترميز alkBFGHJKL OPERON المشاركة في تحويل N-الألكانات إلى الأحماض الدهنية 19.

الاستشعار وتحويل الهيدروكربونات ليست كافية للخلية أن تكون قابلة للحياة. على مستويات الهيدروكربونات زيادة في البيئة، ونمو نوع E. البرية هو تحول دون القولونية من خلال وجود المائيةالكربون في غشاء الخلية والذي يمكن أن يسبب misfolding البروتين. P. horikoshii prefoldin هو كوصي بمساعدة قابلة للطي الصحيح من البروتين في وجود الكانات 17. يستغلونه، وكان من المتوقع أن هذا البروتين يتفاعل مع E. homolog البروتينات كوصي القولونية، مما يوحي بأن overexpression من prefoldin في E. يمكن القولونية تحسين التسامح المذيبات. مع BioBrick BBa_K398406 (التي تتكون من الجينات phPFDα وphPFDβ)، والبقاء على قيد الحياة من E. تم تحسين القولونية في وجود الكانات تصل إلى 50٪. HIM هو أداة مناسبة لتحديد homologs الوظيفية المحتملة.

النظر في الأدوات ككل، يمكن أن نخلص إلى أنه يوفر الخطوة الأولى في بناء هيكل، لعلاج من النفط والغاز في البيئات المائية. هذا يمثل صغيرة، مستقلة، صاحبة تكرار وصطريقة elatively غير مكلفة. تم الحصول عليها بشكل رئيسي من خلال نتائج فحوصات الإنزيمات ويهز الثقافات فلاش وتحتاج بالتالي إلى التحقق من صحة على نطاق أوسع. وينبغي إجراء المزيد من البحوث على هذا النظام التركيز على اقتران من الإنزيمات المختلفة، والتي ثبت للعمل بشكل فردي هنا من أجل توليد نظام تصوره لتدهور النفط والغاز. وعلاوة على ذلك، يمكن إضافة مسارات بديلة لتدهور الملوثات الأخرى كذلك التوسع في استخدام هذا الهيكل إلى ما بعد المعالجة البيولوجية للمواد الهيدروكربونية وحده لأوسع نطاق من الملوثات، وربما تنفيذ مسارات المنتج يمكن استخدام هذا النظام حتى لإنتاج قيمة المواد الكيميائية. نتائجنا تؤكد مدى ملاءمة استراتيجية الجمعية BioBricks في البيولوجيا التركيبية لبناء الكائنات الجديدة التي تستطيع أن تتعامل مع التلوث النفطي، وبالإضافة إلى ذلك قد يكون من المفيد وضع مجموعة واسعة من التطبيقات الأخرى.

Disclosures

الإعلان عن أي تضارب في المصالح.

Acknowledgments

وقد وضعت التجارب التي أجريت في هذه المادة عن طريق الفيديو للمسابقة الدولية آلة المعدلة وراثيا 9. والكتاب أود أن أشكر أعضاء الفريق لوقا iGEM Bergwerff، بيتر فان TM Boheemen، Cnossen Jelmer، هوغو F. روخاس كويتو ورامون فان دير فالك ل المساعدة في البحث. نشكر هان دي Winde، ستيفان دي كوك ويلدرم Esengül للمناقشات مفيدة واستضافة هذا البحث. وأيد هذا العمل من قبل وزارة TU جامعة دلفت للتكنولوجيا الحيوية، والمعلوماتية الحيوية مختبر دلفت، TU دلفت إدارة Bionanoscience، زيت ساندز القيادة مبادرة (OSLI)، studentenuitzendbureau مسمار، هولندا مبادرة الجينوم، مركز Kluyver، Nederlandse Vereniging Biotechnologische (مؤسسة Stichting التكنولوجيا الحيوية هولندا) ، DSM، Geneart، غرينر الحيوي واحدة وGenencor.

Materials

Name Company Catalog Number Comments
E. coli K12 New England Biolabs C2523H
Octane Fluka 74822
Hexadecane Fluka 52209
octanol-1 Fluka 95446
dodecanol-1 Sigma-Aldrich 126799
Hexane Sigma-Aldrich 296090
NADH Sigma-Aldrich N4505
FMN Sigma-Aldrich F2253
MgSO4 J.T. Baker Casno 7487 889
Triton X-100 Sigma-Aldrich T8787
T4 ligase New England Biolabs M0202L
Gas chromatograph
Cell disrupter LA Biosystems CD-019
Spectrophotometer Amersham pharmacia spec 2000
Plate reader Tecan Group Ltd. Magellan v7.0
Incubator Innova, 44
BioBrickTM K398014: BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398014 Alkane Hydroxylase System
Resistance: Chloramphenicol
BioBrickTM K398027: BBa_R0040-BBa_B0034-ladA Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398027 ladA Protein Generator
Resistance: Chloramphenicol
BioBrickTM K398018: BBa_J23100-BBa_J61101-ADH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398018 ADH generator
Resistance: Chloramphenicol
BioBrickTM K398030: BBa_R0040-BBa_B0034-ALDH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398030 ALDH generator
Resistance: Chloramphenicol
BioBrickTM K398326: pCaiF Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398326 pCaiF promoter
Resistance: Chloramphenicol
BioBrickTM K398331: pCaiF-BBa_B0032-BBa_I13401 Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398331 pCaiF measurement device
Resistance: Chloramphenicol
BioBrickTM K398406: BBa_J23002-BBa_J61107-phPFDα-BBa_J61107- Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398406 Solvent tolerance cluster
Resistance: Chloramphenicol

DOWNLOAD MATERIALS LIST

References

  1. Allen, E. W. Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives. J. Environ. Eng. Sci. 7, 123-138 (2008).
  2. Alon, U. An Introduction to Systems Biology: Design Principles of Biological Circuits. CRC Press. (2007).
  3. Center, O. P. Understanding Oil Spills and Oil Spill Response. (1999).
  4. Cytoscape. An Open Source Platform for Complex Network Analysis and Visualization [Internet]. Available from: http://www.cytoscape.org (2012).
  5. Non-Invasive Biomass Monitor with Wide Linear Range [Internet]. Available from: http://www.buglab.com/docs/OnLineODMeasurement.pdf (2012).
  6. Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli. J. Bacteriol. 178, 1248-1257 (1995).
  7. Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir. Proc. Natl. Acad. Sci. U.S.A. 104, (13), 5602-5607 (2007).
  8. Fujii, T., Narikawa, T., Takeda, K., Kato, J. Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6. Biosci. Biotechnol. Biochem. 68, (10), 2171-2177 (2004).
  9. iGEM. Registry of Standard Biological Parts [Internet]. Available from: http://partsregistry.org/Main_Page (2012).
  10. Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23. J. Biosci. Bioeng. 91, (1), 100-102 (2001).
  11. Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23. Extremophiles. 14, 33-39 (2010).
  12. Kieboom, J., De Bont, J. aM. Bacterial Stress Responses. ASM Press. Washington, D.C. (2000).
  13. Kotte, O., Zaugg, J. B., Heinemann, M. Bacterial adaptation through distributed sensing of metabolic fluxes. Mol Syst Biol. 6, 355 (2010).
  14. Kremling, A., Bettenbrock, K., Gilles, E. D. Analysis of global control of Escherichia coli carbohydrate uptake. BMC Syst. Biol. 1, (2007).
  15. Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase. J. Mol. Biol. 376, (2), 453-465 (2008).
  16. Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli. Biotechnol. Bioeng. 73, (5), 347-357 (2001).
  17. Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance. Appl. Microbiol. Biotechnol. 79, (3), 443-449 (2008).
  18. Rehm, H. J., Reiff, I. Mechanisms and occurrence of microbial oxidation of long-chain alkanes. Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).
  19. Rojo, F. Degradation of alkanes by bacteria. Environ. Microbiol. 11, (10), 2477-2490 (2009).
  20. STRING 9.0 Known and Predicted Protein-Protein Interactions [Internet]. Available from: http://string-db.org/newstring_cgi/show_download_page.pl (2012).
  21. Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes. Microbiology. 147, 1621-1630 (2001).
  22. Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes. Extremophiles. 10, (4), 347-356 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics