En Toolkit til Aktiver carbonhydridomdannelse i vandige miljøer

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

En bæredygtig auto regulering bakterielt system til rensning af olie forureninger blev konstrueret ved hjælp af standard-udskiftelige DNA dele (BioBricks). Et konstrueret

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Brinkman, E. K., Schipper, K., Bongaerts, N., Voges, M. J., Abate, A., Wahl, S. A. A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments. J. Vis. Exp. (68), e4182, doi:10.3791/4182 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Dette arbejde foreslås en værktøjskasse, der muliggør omdannelse af alkaner af Escherichia coli og præsenterer en proof of principle for dets anvendelighed. Værktøjskassen består af flere standard udskiftelige dele (BioBricks) 9 behandler konvertering af alkaner, regulering af genekspression og overlevelse i toksiske kulbrinte-rige miljøer.

En tre-trins vej for alkan nedbrydning blev gennemført i E. coli for at muliggøre omdannelse af mellem-og langkædede alkaner til deres respektive alkanoler, alkanals og i sidste ende alkan-syrer. Sidstnævnte blev metaboliseret via det native β-oxidation pathway. For at lette oxidation af mellemlange kæder alkaner (C5-C13) og cycloalkaner (C5-C8), fire gener (alkB2, rubA3, rubA4 og Rabb) af alkan-hydroxylase-systemet fra Gordonia sp. TF6 8,21 blev transformeret ind i E. coli. Til omdannelsen aflangkædede alkaner (C15-C36), blev LADA genet fra Geobacillus thermodenitrificans gennemført. For de nødvendige yderligere skridt i nedbrydningen processen blev ADH og ALDH (stammer fra G. thermodenitrificans) indført 10,11. Aktiviteten blev målt ved hvile celleassays. For hvert Oxidationen blev enzymaktivitet observeres.

For at optimere processen effektivitet blev ekspressionen kun induceres under lave glucosebetingelser: et substrat-reguleret promoter, pCaiF, blev anvendt. pCaiF er til stede i E. coli K12 og regulerer ekspressionen af generne involveret i nedbrydningen af ikke-glucose carbonkilder.

Den sidste del af toolkit - targeting overlevelse - blev gennemført ved hjælp af opløsningsmidler tolerance gener, PhPFDα og β, både fra Pyrococcus horikoshii OT3. Organiske opløsningsmidler kan fremkalde celle stress og reduceret overlevelsesevne ved negativt affecting proteinfoldning. Som chaperoner, forbedre PhPFDα og β proteinet foldeproces fx i nærværelse af alkaner. Ekspressionen af disse gener har ført til en forbedret carbonhydrid tolerance vist ved en forøget væksthastighed (op til 50%) i nærværelse af 10% n-hexan i dyrkningsmediet blev observeret.

Opsummerer de resultater indikerer, at toolkit muliggør E. coli til at konvertere og tolerere kulbrinter i vandige miljøer. Som sådan udgør det et første skridt hen imod en bæredygtig løsning for olie-oprydning ved hjælp af en syntetisk biologi tilgang.

Protocol

1. BioBrick Assembly

  1. BioBricks fra Registry of Standard Biologiske dele er leveret af iGEM hovedkvarter. For at konstruere en ny BioBrick fra eksisterende BioBricks, fordøje donor BioBrick (op til 1,0 ug) med enzymerne EcoRI og SpeI til placering af donor-del nedstrøms for acceptor del. Fordøjelse med XbaI og PstI til positionering af donor del opstrøms for acceptor del. Tilføje en tredje passende restriktionsenzym, der skærer i skelettet af donoren. Udføre fordøjelser i et totalt volumen på 20-25 ml med den passende puffer, ifølge leverandørens (slutkoncentration 1x). Anvend 5 enheder / ug DNA for restriktionsenzymerne.
  2. Fordøje den acceptor BioBrick med enten EcoRI og Xbal eller Spel og PstI.
  3. Inkubér fordøjelser for (mindst) en time ved 37 ° C. Inaktivere restriktionsendonukleaserne af varme, inkubering ved 80 ° C i 10 minutter og centrifugeres kort tid.
  4. Ligere den fordøjede BioBrickdele (donor og acceptor) sammen. Da XbaI og SpeI generere kompatible DNA-ender, er en blandet site oprettet, der ikke kan skæres med en restriktionsenzym resulterende i en ny "kombineret" BioBrick at flankeret af de fire standard-restriktionssteder. I ligeringsblandingen den endelige DNA-koncentration er fortrinsvis ~ 100 ng / ul. Udfør ligeringsreaktionen i et samlet volumen på 10-15 ml med T4-ligeringsbuffer (slutkoncentration 1 x) og T4-ligase (1 enhed / pg DNA).
  5. Inkuber ligeringsblandingen ved 16 ° C i mindst 3 timer.
  6. Udføre transformation omsætning med cirka halvdelen af ​​ligeringsblandingen.
  7. Bekræft BioBrick at være korrekt med sekventering.
  8. For at konstruere en ny BioBrick fra syntetiseret DNA, modificere generne for syntese til optimal ekspression i E. coli ved hjælp af den JCat website værktøjet ( http://www.jcat.de/ ). Foretage yderligere modifikationer i overensstemmelse med kravene i B ioBrick standard. Denne standardisering betyder, at hver BioBrick er sammensat af en DNA-sekvens af interesse, efterfulgt af et præfiks, og efterfulgt af et suffiks. The præfiks og suffiks er sekvenser, der indeholder foruddefinerede restriktionssteder, som er fraværende i den resterende plasmidsekvens. Disse ensartede restriktionssites gør det muligt at udskifte og udvide BioBrick skær fleksibelt 9. Den præfiks og suffiks har følgende sekvenser:
Navn Sekvens Kommentar
Præfiks 5 'GAATTCGCGGCCGCTTCTAG3'
5'GAATTCGCGGCCGCTTCTAGAG 3' Hvis den følgende del er en kodende sekvens eller en del, der starter med "ATG"
Suffix 5'TACTAGTAGCGGCCGCTGCAG 3'
ove_title "> 2. Alkane Conversion Resting celleassay, In Vivo

Dette assay blev udført baseret på fremgangsmåden beskrevet af Fujii et al. (2004).

  1. Kultur E. coli-celler, der udtrykker Alkane hydroxylase system ( BBa_K398014 ), og celler, der bærer en tom vektor ( BBa_J13002 ) i 5 ml LB-medium med passende antibiotika natten over.
  2. Overfør 500 pi af overnatskulturen i 50 ml frisk LB (med antibiotika) og inkuber indtil cellen turbiditet nåede en OD (optisk densitet) på 0,3 ved 600 nm.
  3. Centrifuger i 10 minutter ved 4.000 rpm, og pellet resuspenderes i 5 ml 0,1 M phosphatpuffer (pH 7,4).
  4. Der centrifugeres igen i 10 minutter ved 4.000 rpm, og pellet resuspenderes i 5 ml 0,1 M phosphatpuffer nu indeholder E2 salte og 0,66% v / v glycerol (nitrogen-deficient medium).
  5. Måle celle turbiditet (OD600).
  6. Fremstille celle-blanding alikvoter af 6 ml i 25 ml lukkede cap glaskolber og ikke-celle-kontrol (E2 salte + 0,66% v / v glycerol).
  7. Tilsættes 100 nmol alkan til hver kolbe.
  8. Inkuber blandingen ved 37 ° C i 24 timer (forkorte når højere opnås).
  9. Måle OD600 efter inkubation.
  10. Udtrække carbonhydrider i dyrkningsmediet af ethylacetat og bestemme kulbrintekoncentration i cellekultur ved gaschromatografi (se protokol 3).
  11. Beregne nedbrydning pr biomasse ved at dividere den totale mængde af alkan konverteret af den samlede biomasse findes i hver kolbe (konvertere OD600 på tørvægt). Dividere resultatet med den eksperimentelle varighed giver nedbrydningen aktivitet pr biomasse per tidsenhed. Gennemsnittet tages fra tre individuelle kørsler.

3. Alkan Conversion enzymassay, iVitro

Dette assay udførtes i det væsentlige ifølge fremgangsmåden beskrevet af Li et al. (2008).

  1. Kultur E. coli-celler, der udtrykker LADA genet ( BBa_K398017 ) og celler, der bærer en tom vektor ( BBa_J13002 ) i 50 ml LB-medium med passende antibiotika natten over.
  2. Overfør 500 pi af overnatskulturen i 50 ml frisk LB (med antibiotika) og inkuber indtil cellen turbiditet nåede en optisk densitet på 0,6 ved 600 nm.
  3. Centrifugeres 10 minutter ved 4000 rpm (4 ° C), og pellet resuspenderes i 5 ml 50 mM Tris-puffer.
  4. Sonikat (Cell forstyrrelse, LA Biosystems) cellerne ved 40% duty cycle med en effekt styring af 4, holde løsningen på is for hele programmets varighed.
  5. Centrifugeres den resulterende blanding i 5 minutter ved 4.000 rpm ved 4 & df. eks C for at fjerne cellerester. Overfør supernatanten til en frisk hætteglas.
  6. Bestemme den totale proteinkoncentration i celleekstrakterne ved Bradford-assay. Bemærk: Anvend hætteglas til at forhindre stigningen i baggrunden og / eller tab af proteiner.
  7. Der fremstilles en 100 ml blanding indeholdende 0,1% v / v alkan og 50 mM Tris-HCl puffer.
  8. Blandingen opvarmes ved 100 ° C i 5 minutter. Bemærk: Udfør kun dette trin for mellemstore langkædede alkaner med højt kogepunkt. (Fx C 16: 287 ° C).
  9. At opnå en optimal opløselighed af alkan, sonikeres i 1 minut, mens stadig varm, indtil en homogen, viskøs blanding.
  10. Tilsættes 1 mM NADH, 1 mM FMN, 1 mM MgSO4 og 0,01 v / v Triton X-100.
  11. Gør 6 ml alikvoter i 25 ml lukket cap kolber.
  12. Tilsættes tilstrækkelige mængder af celleekstrakt (afhængig af Bradford assays, slutkoncentration på 5 mg protein / l). Forbered en no-protein kontrol.
  13. Inkuber ved 60 ° C (for optimal enzymatic aktivitet) i 24 timer.
  14. Udtrække carbonhydrider i dyrkningsmediet af ethylacetat og bestemme kulbrintekoncentration i cellekultur ved gaschromatografi (se protokol 3).
  15. Beregne nedbrydning pr biomasse ved at dividere den totale mængde af alkan konverteret af totalt protein tilsat til hver kolbe (ved Bradford kalibreringskurve). Yderligere dividere med varighed af eksperimentet giver nedbrydningen aktivitet pr cellulært protein per tidsenhed. Gennemsnittet tages fra tre individuelle kørsler.

4. Ethyl Acetate udvinding af kulbrinter og koncentrationsmålinger

  1. Alkaner ekstraheres fra den vandige opløsning ved tilsætning af 2,5 ml ethylacetat (apolær solvant) til 6 ml eksperimentelle opløsning. En intern standard sættes til opløsningsmidlet ved en koncentration på 0,1% (volumen / volumen). Den standard (fx cyclo-decan) varieres afhængigt af den forventede interval af toppene af interesse.
  2. Valgfrit: Tilføj TritonX-100 til den vandige blanding og centrifugeres prøverne i 10 minutter ved 4000 rpm for at få en korrekt tofasede system.
  3. Vortex blandingen i 5 sek (1.500 rpm), og der inkuberes ved stuetemperatur, indtil de to faser adskilt.
  4. Fjerne en maksimal mængde af det organiske lag (øverst) og tør opløsningsmidlet anvendelse af vandfrit magnesiumsulfat.
  5. Fjern MgSO 4 ved filtrering (0,2 um) og overføre filtratet i gaskromatograf hætteglas for målinger, eller opbevares ved -20 ° C.
  6. Bestemme koncentrationen ved gaskromatografi under anvendelse af en CP-SIL 5CB kolonne (længde = 5 m). Injicer 10 gl prøve i split-funktion (1:10, 230 ° C). Sætte søjlen gasstrømmen til 1 ml / min (helium). Følgende ovntemperatur program bruges:
    Rate Temperatur [° C] Time [min]
    0 50 7,5
    50 90 1,0
    50 110 2,0
    50 130 2,0
    50 145 2,0
    50 160 2,0
    50 170 2,0
    50 185 2,0
    50 210 2,0
    50 250 2,0
    50 320 2,0
  7. Integrere toppe og rette koncentrationer i forhold til den interne standard.

5. Alkohol / aldehyd-dehydrogenase-aktivitet-assay

Dette assay udførtes i det væsentlige ifølge fremgangsmåden beskrevet af Kato et al.(2010).

  1. Kultur E. coli-celler, der udtrykker ADH ( BBa_K398018 ) eller ALDH ( BBa_K398030 ) genet og celler, der bærer en tom vektor ( BBa_J13002 ) i 50 ml LB-medium med passende antibiotika natten over.
  2. Overfør 500 pi af overnatskulturen i 50 ml frisk LB (med antibiotika) og inkuber indtil cellen turbiditet nåede en optisk densitet på 0,6 ved 600 nm.
  3. Centrifugeres 10 minutter ved 4.000 rpm ved 4 ° C, og pellet resuspenderes i 5 ml 50 mM Tris-puffer.
  4. Sonikeres cellen opløsning ved 40% arbejdscyklus med en output-4 (holde opløsningen på is under sonication).
  5. Centrifugeres den resulterende blanding i 5 minutter ved 4.000 rpm ved 4 ° C for at fjerne cellerester.
  6. Bestem tiltal proteinkoncentration celleekstrakterne ved Bradford-assay (Bemærk: bruge et hætteglas til at forhindre proteinbinding).
  7. Indlæse en plade med 96 brønde med 180 gl 57 mM glycinpuffer indeholdende NAD (slutkoncentration 1 mM, pH 9,5) i hver brønd.
  8. Der tilsættes 5 ul af alkoholen (aldehyd), der skal testes til brøndene. Bemærk: Heat langkædede alkoholer før starten af ​​assayet for at få en væske. For hver alkohol (aldehyd) en kontrol uden substrat bør tilføjes (negativ kontrol). Desuden fremstille et råemne, der indeholder en blanding af puffer og substrat uden celleekstrakt.
  9. Forvarme pladen af ​​pladeaflæser (Tecan Magellan v7.0) i 15 minutter ved 37 ° C for at tillade ækvilibrering af systemet.
  10. Tilsættes tilstrækkelige mængder af celleekstrakt (afhængig af Bradford assays, slutkoncentration på 5 mg protein / l). Forbered en no-protein kontrol.
  11. Måle NADH produktion anvendelse af et spektrofotometer ved en bølgelængde på 340 nm hver 2-3 min i 1 time ved 37 ° C. </ Li>
  12. Beregne NADH produktionshastighed fra hældningen af ​​OD (340 nm). Tage hensyn lyset vejlængde og ekstinktionskoefficienten for NADH af 6220 m -1 cm -1. Opdele NADH produktionshastighed af den totale mængde af protein tilsat til udtryk aktiviteten af ​​dehydrogenase reaktionen i celleekstrakten (U / mg helcelle protein). Beregne middelværdien og standardafvigelsen fra tre uafhængige kørsler.

6. pCaiF Karakterisering

  1. Kultur E. coli-celler, der udtrykker pCaiF-GFP-konstruktion ( BBa_K398331 ) og celler, der bærer promotoren alene ( BBa_K398326 ) natten over i 5 ml LB-medium de passende antibiotika natten over.
  2. Inokulere 5 ml M9 indeholdende 10 g / l glucose og antibiotika med 50 pi af den natgamle kultur og vokse natten over. Subkultur 50 pi af overnatskulturen udvækst i 5 ml frisk M9 with10 g / l og inkuberes indtil cellen turbiditet nåede en optisk densitet på 0,2 ved 600 nm.
  3. Indlæse en plade med 96 brønde med 100 gl frisk M9 medium indeholdende den ønskede mængde carbonkilde til test i hver brønd. Udføre tredobbelte eksperimenter for statistisk evaluering og tilføje de respektive negative kontroller (vildtype E. coli K12).
  4. Der tilsættes 5 pi af overnatskulturen til mediet indeholdende brønde.
  5. Måle vækstkurve (OD600) og GFP-fluorescens (485 nm excitation og 520 emission) ved anvendelse af en pladelæser hver 10 min i 18 timer ved 37 ° C under konstant omrystning.
  6. Beregn vækstrate og den specifikke GFP indhold fra de respektive målinger og sammenligne med kontrollen. Beregne middelværdien og standardafvigelsen af ​​mindst tre uafhængige forsøg.

7. Tolerance Assay

  1. KulturE. coli ekspression PhPFDα og β-genet ( BBa_K398406 ) natten over i 5 ml LB-medium, og de ​​passende antibiotika. E. coli, der udtrykker LADA genet ( BBa_K398017 ) anvendes som negativ kontrol.
  2. Subkultur 10 pi af overnatskulturen udvækst i frisk 5 ml LB (med antibiotika), og der inkuberes indtil cellen turbiditet nåede en optisk densitet på 0,3-0,4 ved 600 nm.
  3. Fortyndes kulturerne med frisk medium, indtil en OD600 på 0,1 er nået.
  4. Indlæse en plade med 96 brønde med 180 gl M9 medium indeholdende passende antibiotika og den korrekte slutkoncentration af den toksiske forbindelse (fx 0, 4, 8, 10% n-hexan) in triplo. Fordi alkan-vand-blandinger kunne føre til tofasesystemer er det vigtigt at have passende kontrol på pladen (f.eks different stammer og de respektive tomme eksperimenter).
  5. Der tilsættes 20 ul af kulturen (kontrol) i brøndene.
  6. Måle biomassekoncentration (OD600) ved anvendelse af en pladelæser hver 10 min i 24 timer ved 37 ° C med konstant omrystning.
  7. Beregn vækstrater fra de respektive målinger for de forskellige agent koncentrationer og sammenligne med den negative kontrol. Beregne middelværdien og standardafvigelsen af ​​mindst tre uafhængige kørsler.

8. Homolog Interaction Mapping

  1. Ansøgningen HIM blev udviklet til at udføre protein forespørgsler på en PostgreSQL server, der kører STRING database (gratis for akademisk brug) 20. Homologen interaktion kort applikation identificerer interagerende proteiner i den oprindelige værtsorganisme med STRING databasen. Sekvenserne af de respektive interagerende gener anvendes i en BLAST søgning for at finde homologe gener i målorganismen. Cytoscape 4 https://github.com/jcnossen/InteractionHomologMapping.
  2. For at udføre en kortlægning, (1) ind i BioBrick ID og programmet vil automatisk downloade del sekvensdata fra Registry of Standard biologiske dele 9, eller (2) Indtast (pasta) sekvensen data i applikationen.
  3. Brug STRING Database hjemmeside for at finde strengen protein-ID for den indtastede aminosyresekvens.
  4. Et protein med høj homologi bestemmes under anvendelse af BLAST. Efterfølgende anvendelse indeholder hver kendt interagerende protein i kildeorganismen og søger efter homologer i værtsorganismen (f.eks E. coli).
  5. Eksport deraf formodet interaktion liste til tekst eller Cytoscape.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

The BioBrick princip anvendes til at konstruere et chassis for nedbrydningen af ​​alkaner og en proof of principle for de enkelte komponenter i materialet blev opnået. Adskillige assays er foreslået at måle in vivo og in vitro-aktiviteten af alkan nedbrydende vej-enzymer. Den præsenterede arbejde med succes viser en række metoder, som kan anvendes til at bestemme enzymaktiviteter og ekspression i værtsorganismen E. coli efter implementering af egnede BioBricks. Det er endvidere vist, at BioBrick princip kan anvendes til at designe en organisme, der udtrykker proteiner nødvendige for nedbrydningen af ​​alkaner, tilvejebringer et reguleringssystem, der producerer disse enzymer kun når det er nødvendigt, og forøger tolerancen af ​​værtsorganismen i nærvær af carbonhydrider . Når yderligere udviklet, kunne dette chassis anvendes til den biologiske nedbrydning af restolie, f.eks tjæresand tailing vand, eller til behandlingaf spildevand fra olieindustrien.

Med hensyn til alkan nedbrydning blev assays udført for karakteriseringen af ​​de enzymer, der er involveret i det første trin af alkan nedbrydning (AH-system og LADA). Det blev påvist, at en E. coli-stamme, der bærer AH-system Gordonia sp. TF6 var i stand til at konvertere oktan in vivo. Dette resultat er i overensstemmelse med resultaterne af Fujii et. al. 8, hvor biotransformationen af n-alkaner med E. coli, der udtrykker de minimale komponent gener af AH-systemet blev opnået. Omdannelsen aktivitet blev målt ved en sammenlignende undersøgelse (vildtype vs mutant) efter et givet tidsrum. For en fuld karakterisering, har yderligere undersøgelser skal udføres på aktiviteten af ​​AH-systemet over tid og kinetikken for systemet.

Til omdannelsen af langkædede alkaner (C 15-C 36), den Lada-gen fra GeobaCillus thermodenitrificans blev gennemført. Enzymaktiviteten blev testet in vitro under anvendelse hexadecan som langkædet carbonhydrid kilde. Denne modificeret E. coli-stamme viste en forøget enzymaktivitet sammenlignet med kontrolstammen, hvilket viser den rekombinante LADA protein fremmer ændringen af hexadecan af E. coli. Ud over den egenskab omdannende alkaner til alkanoler, E. coli-stammer blev udviklet med en forbedret nedbrydning proces for alkoholer og aldehyder ved gennemførelsen af ADH og ALDH generne hhv. Enzymaktiviteten i celleekstrakter blev undersøgt in vitro ved måling af produktion af NADH fra NAD +. E. coli-stamme der udtrykker ADH udviste en to gange stigning i alkohol-dehydrogenase-aktivitet sammenlignet med vildtype-aktivitet. Sammenlignet med kontrollen stamme, ekspressionen af ALDH protein øgede dodecanal dehydrogenase-aktivitet i E. coli cell ekstraherer tre gange. Da disse assays klart påviste forøget enzymaktivitet in vitro, kan det spekuleres, at den transformerede E. coli-stammer har forhøjede niveauer af aktivitet in vivo så godt.

At undersøge muligheden for værts-induceret ekspression (for eksempel: ikke-afhængighed af induktion kemikalier og lav belastning under vækst), blev nedbrydningsvej udtrykt under kontrol af pCaiF promotoren. Denne promotor aktiverer genekspression, når blodsukkerniveauet er lavt, f.eks. ved afslutningen af ​​en batch vækstfase. Som et bevis på princippet var denne promotor testet via produktion af GFP under forskel glukose regimer. Det blev påvist, at pCaiF-GFP transformerede E. coli-produceret mere GFP under stationær (glucose-begrænset) fase end i den eksponentielle fase (høje blodsukkerniveauer). I nærvær af en sekundær carbonkilde (f.eks. Laurinsyre), GFP-produktionen faldt again grund af katabolismen af ​​det sekundære carbon-kilde.

Forsøget viste, at denne promotor kan anvendes effektivt til at aktivere kataboliske skift fra glucose til nye nedbrydningsveje. Dette gør det muligt hurtigt at vokse en enorm mængde af organismer i rigt medium, før nedbrydningsvej aktiveres. Vi foreslår at bruge pCaiF promotor opstrøms den AlkS transkriptionel regulator. I Pseudomonas putida, genkender AlkS C 5-C 10 n-alkaner som effektorer. Efterfølgende høje niveauer af AlkS-alkan komplekset aktiverer PalkB promotoren resulterer i ekspression af de alkBFGHJKL operon, der koder proteiner involveret i omdannelsen af n-alkaner på fedtsyrer 19.

Sensing og omdannelse af kulbrinter er ikke nok for at cellen kan være rentabel. Ved stigende kulbrinte i miljøet, væksten af vildtype E. coli inhiberes ved tilstedeværelsen af hydrocarbonatomer i membranen og i cellen, hvilket kan forårsage protein misfoldning. P. horikoshii prefoldin er en chaperone medvirken den korrekte foldning af proteinet i nærvær af alkaner 17. Bruger ham, blev det forudsagt, at dette protein interagerer med homolog E. coli chaperone-proteiner, hvilket antyder, at overekspression af prefoldin i E. coli kunne forbedre solvent tolerance. Med BioBrick BBa_K398406 (bestående af phPFDα og phPFDβ gener), overlevelsesevne E. coli i nærvær af alkaner blev forbedret op til 50%. HIM er et velegnet redskab til at vælge potentielle funktionelle homologer.

I betragtning af værktøjskassen som helhed, kan det konkluderes, at det giver et første skridt i opbygningen af ​​et chassis til bioremediering af kulbrinter i vandige miljøer. Dette udgør en lille, selvstændig, selvreplikerende og relatively billig fremgangsmåde. Resultaterne blev primært opnået gennem enzymassays og ryst flash kulturer og derfor skal godkendes på en større skala. Yderligere forskning i dette system bør fokusere på koblingen af ​​de forskellige enzymer, som er blevet vist her til at arbejde individuelt med henblik på at generere den forestillede system til nedbrydning af kulbrinter. Desuden kan tilsætning af alternative veje til nedbrydningen af ​​andre forurenende stoffer samt udvide brugen af ​​dette chassis uden for bioudbedring af kulbrinter alene til en bredere vifte af forurenende stoffer, og eventuelt gennemførelse af produkt veje kan endda benytte dette system til produktion af værdifulde kemikalier. Vores resultater understreger egnethed BioBricks samling strategi i syntetisk biologi til at konstruere nye organismer, der kan håndtere olieforurening, og kan desuden være nyttigt at udvikle en bred vifte af andre programmer.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Ingen interessekonflikter erklæret.

Acknowledgments

Eksperimenterne er udført i denne video-artikel blev udviklet til international gensplejsede Machine konkurrence 9. Forfatterne vil gerne takke IGEM teammedlemmer Luke Bergwerff, Pieter TM van Boheemen, Jelmer Cnossen, Hugo F. Cueto Rojas og Ramon van der Valk for bistanden i forskningen. Vi takker Han de Winde, Stefan de Kok og Esengül Yildirim for personer diskussioner og hosting denne forskning. Dette arbejde blev støttet af TU Delft Universitet Institut for Bioteknologi, The Delft Bioinformatics lab, TU Delft Institut for Bionanoscience, Oil Sands Leadership Initiative (OSLI), stud studentenuitzendbureau, Holland Genomics Initiative, Kluyver Centre, Nederlandse Biotechnologische Vereniging (Stichting Biotechnology Nederland) , DSM, Geneart, Greiner bio-one og Genencor.

Materials

Name Company Catalog Number Comments
E. coli K12 New England Biolabs C2523H
Octane Fluka 74822
Hexadecane Fluka 52209
octanol-1 Fluka 95446
dodecanol-1 Sigma-Aldrich 126799
Hexane Sigma-Aldrich 296090
NADH Sigma-Aldrich N4505
FMN Sigma-Aldrich F2253
MgSO4 J.T. Baker Casno 7487 889
Triton X-100 Sigma-Aldrich T8787
T4 ligase New England Biolabs M0202L
Gas chromatograph
Cell disrupter LA Biosystems CD-019
Spectrophotometer Amersham pharmacia spec 2000
Plate reader Tecan Group Ltd. Magellan v7.0
Incubator Innova, 44
BioBrickTM K398014: BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398014 Alkane Hydroxylase System
Resistance: Chloramphenicol
BioBrickTM K398027: BBa_R0040-BBa_B0034-ladA Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398027 ladA Protein Generator
Resistance: Chloramphenicol
BioBrickTM K398018: BBa_J23100-BBa_J61101-ADH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398018 ADH generator
Resistance: Chloramphenicol
BioBrickTM K398030: BBa_R0040-BBa_B0034-ALDH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398030 ALDH generator
Resistance: Chloramphenicol
BioBrickTM K398326: pCaiF Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398326 pCaiF promoter
Resistance: Chloramphenicol
BioBrickTM K398331: pCaiF-BBa_B0032-BBa_I13401 Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398331 pCaiF measurement device
Resistance: Chloramphenicol
BioBrickTM K398406: BBa_J23002-BBa_J61107-phPFDα-BBa_J61107- Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398406 Solvent tolerance cluster
Resistance: Chloramphenicol

DOWNLOAD MATERIALS LIST

References

  1. Allen, E. W. Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives. J. Environ. Eng. Sci. 7, 123-138 (2008).
  2. Alon, U. An Introduction to Systems Biology: Design Principles of Biological Circuits. CRC Press. (2007).
  3. Center, O. P. Understanding Oil Spills and Oil Spill Response. (1999).
  4. Cytoscape. An Open Source Platform for Complex Network Analysis and Visualization [Internet]. Available from: http://www.cytoscape.org (2012).
  5. Non-Invasive Biomass Monitor with Wide Linear Range [Internet]. Available from: http://www.buglab.com/docs/OnLineODMeasurement.pdf (2012).
  6. Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli. J. Bacteriol. 178, 1248-1257 (1995).
  7. Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir. Proc. Natl. Acad. Sci. U.S.A. 104, (13), 5602-5607 (2007).
  8. Fujii, T., Narikawa, T., Takeda, K., Kato, J. Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6. Biosci. Biotechnol. Biochem. 68, (10), 2171-2177 (2004).
  9. iGEM. Registry of Standard Biological Parts [Internet]. Available from: http://partsregistry.org/Main_Page (2012).
  10. Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23. J. Biosci. Bioeng. 91, (1), 100-102 (2001).
  11. Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23. Extremophiles. 14, 33-39 (2010).
  12. Kieboom, J., De Bont, J. aM. Bacterial Stress Responses. ASM Press. Washington, D.C. (2000).
  13. Kotte, O., Zaugg, J. B., Heinemann, M. Bacterial adaptation through distributed sensing of metabolic fluxes. Mol Syst Biol. 6, 355 (2010).
  14. Kremling, A., Bettenbrock, K., Gilles, E. D. Analysis of global control of Escherichia coli carbohydrate uptake. BMC Syst. Biol. 1, (2007).
  15. Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase. J. Mol. Biol. 376, (2), 453-465 (2008).
  16. Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli. Biotechnol. Bioeng. 73, (5), 347-357 (2001).
  17. Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance. Appl. Microbiol. Biotechnol. 79, (3), 443-449 (2008).
  18. Rehm, H. J., Reiff, I. Mechanisms and occurrence of microbial oxidation of long-chain alkanes. Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).
  19. Rojo, F. Degradation of alkanes by bacteria. Environ. Microbiol. 11, (10), 2477-2490 (2009).
  20. STRING 9.0 Known and Predicted Protein-Protein Interactions [Internet]. Available from: http://string-db.org/newstring_cgi/show_download_page.pl (2012).
  21. Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes. Microbiology. 147, 1621-1630 (2001).
  22. Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes. Extremophiles. 10, (4), 347-356 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics