Sulu Ortamlarda Hidrokarbon Dönüşüm Enable A Toolkit

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Petrol kirliliğinin iyileştirilmesi için bakteriyel sistemini düzenleyen sürdürülebilir bir otomatik standart değiştirilebilir DNA parçalarının (BioBricks) kullanılarak tasarlanmıştır. Bir mühendislik

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Brinkman, E. K., Schipper, K., Bongaerts, N., Voges, M. J., Abate, A., Wahl, S. A. A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments. J. Vis. Exp. (68), e4182, doi:10.3791/4182 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Bu çalışma ileriye Escherichia coli alkan dönüşüm sağlayan ve uygulanabilirlik ilkesinin bir kanıtı sunan bir araç koyar. Toolkit çoklu standart değiştirilebilir parçalar (BioBricks) 9 alkan dönüşüm, toksik hidrokarbon zengini ortamlarda gen ekspresyonu ve sağkalım düzenlenmesi ele oluşur.

Alkan bozulması için üç aşamalı yolun E. uygulanmıştır kendi alkanoller, alkanals ve sonuçta alkanoik asitler, orta ve uzun zincirli alkanlar dönüşümü sağlamak için coli. Ikincisi doğal β-oksidasyon yol üzerinden metabolize edildi. Orta-zincirli alkanlar (C5-C13) sikloalkanlar ve (C5-C8), Gordonia sp alkan hidroksilaz sistemi dört gen (alkB2, rubA3, rubA4 ve kolla) 'nin oksidasyonu kolaylaştırmak için. TF6 8,21 E. dönüştü coli. Ve dönüşüm içinUzun zincirli alkanlar (C15-C36), Geobacillus thermodenitrificans dan Lada gen uygulanmıştır. Bozulması sürecinin gerekli ileri adımlar için, ADH ve ALDH (G. thermodenitrificans menşeli) 10,11 tanıtıldı. Istirahat etkinlik hücrelerin analizi ile ölçülmüştür. Her oksidatif adım için, enzim aktivitesi gözlendi.

Süreci etkinliği optimize etmek için, ifade sadece düşük glikoz koşullar altında uyarılmıştır: bir alt-tabaka ile düzenlenen promotör, pCaiF kullanılmıştır. pCaiF E. mevcut coli K12 ve non-glikoz karbon kaynaklarının bozulma içerdiği genlerin ekspresyonunu düzenlemektedir.

Setinin son bölümü - yaşama hedefleme - PhPFDα ve β çözücü dayanıklılık genlerinin, Pyrococcus horikoshii OT3 hem kullanılarak uygulanmıştır. Organik solventler olumsuz affectin tarafından hücrenin stres neden ve beka azalmış olabilirg protein katlanması. Şaperonlar olarak, PhPFDα ve β alkan varlığı altında protein katlama işlemi örneğin arttırır. Kültür ortamı içinde% 10 n-heksan suretin artan bir büyüme oranı (% 50'ye kadar) ile gösterilen bir hidrokarbon iyileştirilmiş tolerans yol açmıştır, bu genlerin ekspresyonu görülmüştür.

Özetleme, sonuç seti E. sağlar belirtmek Sulu ortamlarda hidrokarbon dönüştürmek ve tolere coli. Bu nedenle, bir sentetik biyoloji yaklaşım kullanarak petrol iyileştirme için sürdürülebilir bir çözüm bulunması yönünde bir ilk adımdır.

Protocol

1. BioBrick Meclisi

  1. Standart Biyolojik parçaları Sicilinden BioBricks iGEM merkez tarafından sağlanmaktadır. Mevcut BioBricks yeni bir BioBrick oluşturmak için, alıcı kısmın verici parça aşağı konumlandırılması için enzimler EcoRI ve SpeI ile verici BioBrick (en fazla 1.0 ug) sindirimi. Alıcı kısmının yukan verici parça konumlandırılması için Xbal ve PstI ile Digest. Donör omurgasında kesen bir üçüncü uygun restriksiyon enzimi ekleyin. Satıcı (nihai konsantrasyon 1 x) 'ye göre, uygun bir tampon ile 20-25 ml'lik bir toplam hacim içinde sindirimler gerçekleştirin. Restriksiyon enzimleri için 5 adet / mg DNA kullanın.
  2. EcoRI ve Xbal ya da SpeI ve PstI ile ya da alıcı BioBrick özet.
  3. 37. az bir saat (en az) için sindirimler inkübe ° C. Kısıtlama ısı endonükleazları Inactivate, 80 inkübasyon süre 10 dakika ve santrifüj ° C.
  4. Sindirilmiş BioBrick Arterbirlikte parçaları (verici ve alıcı). Xbal ve SpeI uyumlu DNA uçları oluşturur yana, bir karma site 4 standart kısıtlama siteleri ile çevrili yeni bir 'birleşik' BioBrick sonuçlanan herhangi bir restriksiyon enzimi ile kesilmiş olamaz oluşturulur. Ligasyon karışımı, bir son DNA konsantrasyonu, tercihen ~ 100 ng / ml 'den. T4 ligasyon tampon (nihai konsantrasyon 1 x) ve T4 ligaz (1 ünite / ug DNA) birlikte 10-15 ml'lik toplam hacim içinde ligasyon reaksiyonu gerçekleştirin.
  5. En azından 3 saat için 16 ° C 'de ligasyon karışımı inkübe edin.
  6. Ligasyon karışımı yaklaşık yarısı dönüşüm reaksiyonu gerçekleştirin.
  7. Sıralama ile doğru olmak BioBrick onaylayın.
  8. Sentezlenen DNA 'sından yeni BioBrick inşa etmek için, E. optimum ifade için sentez genleri için değiştirmek JCat web sitesi aracının (vasıtasıyla coli http://www.jcat.de/ ). B gereklerine uygun olarak daha fazla değişiklik yapın ioBrick standart. Bu standardizasyon her BioBrick bir önek öncesinde ve sonek ardından ilgi DNA dizisi oluşur anlamına gelir. Önek ve sonek kalan plazmid sırayla bulunmadığına önceden tanımlanmış kısıtlama siteleri içeren dizileri vardır. Bunlar standart kısıtlama siteleri değiştokuşu ve 9 esnek BioBrick ekler uzatmak mümkün kılar. Önek ve sonek aşağıdaki dizileri var:
Isim Sıra Yorumlamak
Önek 5 'GAATTCGCGGCCGCTTCTAG3'
5 'GAATTCGCGGCCGCTTCTAGAG 3' Aşağıdaki parçası kodlama sırası veya "ATG" ile başlayan herhangi bir bölümü ise
Sonek 5 'TACTAGTAGCGGCCGCTGCAG 3'
In Vivo ove_title "> 2. Alkan Dönüşüm Dinlenme Hücre Deneyi,

Bu tahlil, Fujii ve diğ. (2004) tarafından tarif edilen yönteme göre yapıldı.

  1. Kültür E. Alkan Hidroksilaz sistemi (eksprese coli hücreleri BBa_K398014 bir boş vektör (taşıma) ve hücreler BBa_J13002 gece boyunca uygun antibiyotikler ile 5 ml LB ortam içinde).
  2. Taze LB 50 ml (antibiyotik) ile gece boyunca kültür içine 500 ul aktarın ve hücre bulanıklık 600 nm'de 0.3 bir OD (optik yoğunluk) ulaşana kadar inkübe edilir.
  3. 4,000 rpm'de 10 dakika boyunca santrifüje ve 5 ml 0.1 M fosfat tampon maddesi (pH 7.4) içinde tekrar süspansiyon pelet.
  4. 4,000 rpm'de 10 dakika boyunca tekrar santrifüje ve artık E2 edilebilir tuzları ve% 0.66 hacim / hacim gliserol (nitrojen-ihtiva eden yetersizliklerin 5 ml 0.1 M fosfat tampon içinde tekrar süspansiyon pelett orta).
  5. Hücre bulanıklık (OD 600) ölçün.
  6. 25 ml kapalı bir kap cam şişeler ve herhangi bir hücre kontrol (E2 tuzları +% 0.66 hacim / hacim gliserol) içinde 6 ml hücre-alikotları karışım hazırlayın.
  7. Her şişeye alkan 100 nmol ekleyin.
  8. 24 saat (daha yüksek oranlar elde edildiği takdirde kısaltmak) için 37 ° C 'de karışımlarını.
  9. Inkübasyondan sonra OD 600 ölçün.
  10. Etil asetat ile kültür ortamı içinde hidrokarbon ayıklamak ve gaz kromatografisi (protokol 3'e bakınız) ile, hücre kültürü içinde hidrokarbon konsantrasyonu belirlenir.
  11. Her balona toplam biyokütle bugünkü (kuru ağırlık OD 600 dönüştürmek) tarafından dönüştürülmüş alkan toplam miktarı bölerek biyokütle birim bozulması hesaplayın. Deney süresi sonucu bölerek birim zamanda birim biyokütle başına degradasyon aktivitesinin verir. Ortalama üç ayrı çalışır alınır.

3. Alkan Dönüşüm Enzim Testi, Inİn Vitro

Bu tahlil, Li ve diğ. (2008) tarafından tarif edilen metoda göre esasen yapıldı.

  1. Kültür E. Lada gen (eksprese coli hücreleri BBa_K398017 ) ve boş vektör (taşıyan hücreler BBa_J13002 gece boyunca uygun antibiyotikler ile 50 mL LB ortam içinde).
  2. Taze LB 50 ml (antibiyotik) ile gece boyunca kültür içine 500 ul aktarın ve hücre bulanıklık 600 nm'de 0.6 bir optik yoğunluğa ulaşıncaya kadar inkübe edilir.
  3. 4000 rpm (4 ° C) de 10 dakika santrifüjlenir ve 50 mM Tris tamponu, 5 ml içinde pelet tekrar süspansiyon.
  4. 4 bir çıkış kontrolü ile% 40 görev devresi sonikasyon (Hücre bölücü, LA Biyosistem) hücreler, süresi boyunca buz üzerinde çözüm tutmak.
  5. 4 ve d az 4000 rpm'de 5 dakika için elde edilen karışım santrifüjlenirörneğin, C hücre enkaz kaldırmak için. Taze bir flakon süpernatant aktarın.
  6. Bradford tahlili ile hücre özlerinin toplam protein konsantrasyonu belirlenir. Not: Arka plan artış ve / veya protein kaybını önlemek için cam şişe kullanın.
  7. % 0.1 v / v alkan ve 50 mM Tris-HCl tampon içeren 100 ml'lik bir karışım hazırlayın.
  8. 5 dakika boyunca 100 ° C'de karışım ısıtılır. Not: Sadece yüksek kaynama noktasına sahip orta-uzun zincirli alkanlar için bu adımı gerçekleştirin. (Örneğin C 16: 287 ° C).
  9. Alkan optimal bir çözünürlük elde etmek için, 1 dak hala sıcak iken homojen, viskoz karışım elde edilinceye kadar için sonikasyon.
  10. 1 mM NADH, 1 mM FMN, 1 mM MgSO4 ve 0.01 h / h Triton X-100 ilave edin.
  11. 25 ml kapalı kap şişeleri içinde 6 ml alikotları hazırlayın.
  12. Hücre ekstresi yeterli miktarda (Bradford deneyleri, 5 mg protein / l son konsantrasyon bağlıdır) ekleyin. No-proteini kontrol hazırlayın.
  13. Optimal e 60 ° C (inkübe24 saat süre ile) aktivitesi nzymatic.
  14. Etil asetat ile kültür ortamı içinde hidrokarbon ayıklamak ve gaz kromatografisi (protokol 3'e bakınız) ile, hücre kültürü içinde hidrokarbon konsantrasyonu belirlenir.
  15. Toplam protein tarafından dönüştürülmüş alkan toplam miktarı bölerek biyokütle birim bozulması hesaplayın Her balona (Bradford kalibrasyon eğrisi ile) eklendi. Ayrıca deneme süresi bölünerek birim zamanda hücresel protein birim degradasyon aktivitesinin verir. Ortalama üç ayrı çalışır alınır.

4. Etil Asetat Hidrokarbon Ekstraksiyon ve Konsantrasyon Ölçümleri

  1. Alkanların 6 ml deney için 2.5 ml çözelti, etil asetat (apolar çözücü) ilave edilerek sulu bir çözelti elde edilir. Dahili bir standart% 0.1 'lik bir konsantrasyonda (v / v) de çözücü ilave edilir. Standart (örn. siklo-dekan) ilgi doruklarına beklenen aralığına bağlı olarak değişmektedir.
  2. Opsiyonel: Add TritonSulu karışım, X-100 ve uygun bir iki faz sistemi elde etmek için 4000 rpm'de 10 dakika için numune santrifüjlenir.
  3. Girdap iki faz ayrı kadar 5 saniye (1,500 rpm) ile, oda sıcaklığında inkübe edin karışımı.
  4. Organik katman (üst) arasında bir maksimum miktarda kaldırma ve susuz magnezyum sülfat ile çözücü kurutun.
  5. Filtrasyon (0.2 mikron) tarafından MgSO4 çıkarın ve -20 ° C'de ölçümleri için gaz kromatografisi şişeleri içine süzülen veya mağaza aktarmak
  6. CP-SIL 5CB kolon (uzunluk = 5 kg) kullanılarak gaz kromatografisi ile konsantrasyonunun belirlenmesi. (1:10, 230 ° C) bölünmüş modda numune 10 ml enjekte edilir. 1 ml / dk (helyum) ile kolon gaz akış ayarlayın. Aşağıdaki fırın sıcaklık programı kullanılmıştır:
    Oran Sıcaklık [° C] Zaman [dk]
    0 50 7.5
    50 90 1.0
    50 110 2.0
    50 130 2.0
    50 145 2.0
    50 160 2.0
    50 170 2.0
    50 185 2.0
    50 210 2.0
    50 250 2.0
    50 320 2.0
  7. Zirveleri entegre ve iç standart ile ilgili olarak konsantrasyonları düzeltin.

5. Alkol / Aldehit Dehidrogenaz Aktivitesi Testi

Bu tahlil, Kato ve diğerleri tarafından tarif edilen metoda göre esasen yapıldı.(2010).

  1. Kültür E. ADH (eksprese coli hücreleri BBa_K398018 ) ya da ALDH ( BBa_K398030 ) geni ve bir boş vektör (taşıyan hücreler BBa_J13002 gece boyunca uygun antibiyotikler ile 50 mL LB ortam içinde).
  2. Taze LB 50 ml (antibiyotik) ile gece boyunca kültür içine 500 ul aktarın ve hücre bulanıklık 600 nm'de 0.6 bir optik yoğunluğa ulaşıncaya kadar inkübe edilir.
  3. 4 ° C'de 4,000 rpm'de 10 dakika santrifüjlenir ve 50 mM Tris tamponu, 5 ml içinde pelet tekrar süspansiyon.
  4. 4 bir çıkış kontrolü (sonication sırasında buz üzerinde çözüm tutmak) ile% 40 görev devresi hücre çözümü sonikasyon.
  5. ° C hücre tortularını çıkarmak üzere 4 az 4000 rpm'de 5 dakika için elde edilen karışım santrifüjleyin.
  6. Göre belirlenir(: Protein bağlama önlemek için bir cam şişe kullanın Not) Bradford yöntemi ile hücre ekstreleri tal protein konsantrasyonu.
  7. 180 ul 57 mM glisin tampon her bir kuyu içinde NAD (nihai konsantrasyon 1 mM, pH 9.5) ihtiva eden 96 oyuklu bir plaka yerleştirin.
  8. Kuyular için test edilecek olan alkol (aldehit) 5 ul ekle. Not: bir sıvı olması testin başlamasından önce ısı uzun zincirli alkoller. Her bir alkol (aldehit) alt tabaka olmadan bir kontrol (negatif kontrol) ilave edilmelidir. Buna ek olarak, hücre özütü olmaksızın substrat tampon ve bir karışımını içeren bir boş hazırlanır.
  9. Ön ısıtma 37 'de 15 dakika için plaka okuyucu (Tecan Macellan v7.0) ve plaka ° C sisteminin denge sağlamak için.
  10. Hücre ekstresi yeterli miktarda (Bradford deneyleri, 5 mg protein / l son konsantrasyon bağlıdır) ekleyin. No-proteini kontrol hazırlayın.
  11. 340 nm dalga boyunda 37 1 saat için her 2-3 dakikada ° C <bir spektrofotometre kullanılarak NADH üretimi ölçün/ Li>
  12. OD (340 nm) eğiminden NADH üretim hızını hesaplayın. Dikkate ışık yolu uzunluğu ve 6220 M -1 cm -1 NADH sönüm katsayısı atın. Protein toplam miktarına göre NADH üretim hızı bölme hücre özütü olarak dehidrogenaz reaksiyonu (U / mg tam hücre protein) aktivitesinin eklendi. Ortalama ve üç bağımsız çalışır gelen standart sapmayı hesaplayın.

6. pCaiF Karakterizasyonu

  1. Kültür E. pCaiF-GFP construct (ifade coli hücreleri BBa_K398331 ) ve yalnız organizatörü (taşıyan hücreler BBa_K398326 uygun antibiyotik gecede 5 ml LB orta gecede).
  2. 5 ml M9 gece boyunca kültürün 50 ul ile 10 g / l glukoz ve antibiyotik içeren inoküle ve gece boyunca büyümeye. Gecede akıbet alt kültürünün 50 ul taze M9 with10 g / l ve inkübe 5 ml içine hücre bulanıklık 600 nm'de 0.2 optik yoğunluk ulaşana kadar.
  3. Her bir kuyudaki test için karbon kaynağı, istenen miktarda içeren taze M9 ortam 100 ul ile bir 96 kuyulu plakanın yerleştirin. İstatistiksel değerlendirme için üç nüsha deneyler gerçekleştirin ve ilgili negatif kontroller (yabani tip E. coli K12) ekleyin.
  4. Sıvısı içeren kuyucuklara gece boyunca kültür 5 ul ekle.
  5. Büyüme eğrisi (OD 600) ve bir plaka okuyucu kullanarak GFP floresan (485 nm eksitasyon ve emisyon 520) 37 18 saat süreyle her 10 dakikada ° C sabit sallama ile ölçün.
  6. Büyüme hızı ve ilgili ölçümlerden özel GFP miktarı hesaplanır ve kontrol karşılaştırın. Ortalama, en az üç bağımsız deneyin standart sapma hesaplanır.

7. Tolerans Testi

  1. KültürE. coli PhPFDα ve β gen (eksprese BBa_K398406 5 ml LB ortamı ve uygun antibiyotikler de ertesi sabaha kadar). E. Lada geni (eksprese coli BBa_K398017 ) negatif kontrol olarak kullanılmıştır.
  2. Taze 5 LB ml (antibiyotik) ve inkübe içine gecede akıbet alt kültürünün 10 ul hücre bulanıklık 600 nm az 0,4 ile 0,3 arasındaki bir optik yoğunluk ulaşana kadar.
  3. Bir 0,1 OD 600 ulaşılıncaya kadar taze besiyeri ile kültürleri seyreltin.
  4. Uygun antibiyotik ve üç kopya halinde toksik bileşik (örneğin, 0, 4, 8, n-heksan ve% 10) uygun bir şekilde nihai konsantrasyon ihtiva eden 180 ul M9 ortam ile bir 96 oyuklu plaka yerleştirin. Alkan-su karışımları iki fazlı sistemlerde yol açabilecek Çünkü (örneğin d plaka üzerinde uygun kontrollerin olması esastırifferent suşları ile ilgili boş deneyler).
  5. Kuyulara kültürün 20 ul (kontrol) ilave edilir.
  6. Sabit sallama bir plaka okuyucu 37 24 saat boyunca her 10 dakikada ° C kullanarak biyokütle konsantrasyonu (OD 600) ölçün.
  7. Farklı bir ajan konsantrasyonları için ilgili ölçümlerden büyüme oranları hesaplayın ve negatif kontrol ile karşılaştırıldığında. Ortalama ve en az üç bağımsız ishal standart sapmayı hesaplayın.

8. Homolog Etkileşim Haritalama

  1. Uygulama HIM STRING veritabanı (akademik kullanım için ücretsiz) 20 çalıştıran bir PostgreSQL sunucu üzerinde protein sorguları gerçekleştirmek için geliştirilmiştir. Homolog etkileşimi haritalama uygulaması STRING veritabanı kullanarak orijinal konak organizma etkileşen proteinleri tanımlar. Söz konusu etkileşim gen dizileri hedef organizma içinde homolog genlerin bulmak için bir patlama arama kullanılır. Cytoscape 4 https://github.com/jcnossen/InteractionHomologMapping.
  2. Bir eşleme gerçekleştirmek için, (1) BioBrick kimliği girin ve uygulama otomatik olarak Standart Biyolojik parçaları 9, veya uygulama (2) enter (macun) dizisi verilerin kayıt defterinden parçası dizisi veri indirecektir.
  3. Girilen amino asit dizisi için STRING proteinin kimliğini bulmak için STRING Veritabanı web sitesini kullanın.
  4. Yüksek bir homolojiye sahip bir protein BLAST kullanılarak tespit edilir. Daha sonra uygulama konak organizma içinde homologları (örn. E. coli) için kaynak organizma ve arama içinde bilinen her etkileşimli protein listeler.
  5. Metin veya Cytoscape için oluşabilecek olası etkileşimi listesini verin.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

BioBrick prensibi alkan bozulması için bir şase oluşturmak için kullanılan ve araç setinin tek bileşenleri için ilkesinin bir kanıtı elde edildi. Bazı deneyler, in vivo ve alkan alçaltıcı enzimler yolu in vitro aktivite ölçmek için önerilmiştir. Sunulan çalışmalar başarılı bir konak organizma içinde E. enzim aktiviteleri ile ifade belirlemek için kullanılabilecek bir dizi yöntem göstermektedir Uygun BioBricks uygulanmasından sonra coli. Üstelik, BioBrick prensip alkan bozulması için gerekli protein ifade eden bir organizma tasarlamak için kullanılabileceğini göstermiştir, bu enzimler, bir düzenleyici sistem sağlar sadece gerekli olduğunda ve artırmaktadır hidrokarbon varlığında, konak organizma bir tolerans . Bir kez daha da geliştirilmesi, bu şasi atık suların yağ kumları, örneğin, kalıntı yağ biyolojik bozunma için kullanılabilir, ya da tedavi içinpetrol endüstrisi kaynaklanan atıksuların.

Alkan bozulması ile ilgili olarak, tahliller alkan bozulma ilk adım (AH-sistem ve LADA) içinde yer alan enzim karakterizasyonu için yapılmıştır. Bu gösterilmiştir ki bir E. coli Gordonia sp AH-sistemin taşıma süzün. TF6 in vivo oktan dönüştürmek başardı. Bu bulgu Fujii et sonuçları ile uyum içindedir. ark. 8, n-alkanlar biyotransformasyonu ile E. AH-sistemin en az bileşen genlerini eksprese coli elde edildi. Dönüşüm etkinliği belirli bir süre sonra karşılaştırmalı bir çalışmada (yabani-tip vs mutant) ile ölçüldü. Tam bir karakterizasyon için, ek çalışmalar zaman ve sistemin kinetikleri üzerinde AH-sisteminin aktivitesi üzerinde yapılması gerekir.

Uzun zincirli alkanlar (C 15-C 36), Geoba dan Lada geninin dönüşüm içincillus thermodenitrificans uygulanmıştır. Enzim aktivitesi, uzun zincirli bir hidrokarbon kaynağı olarak heksadekan kullanılarak in vitro olarak test edildi. Bu modifiye E. coli suşu kontrol suşu kıyasla artmış enzim aktivitesi gösterdi, rekombinant Lada proteini göstererek E. heksadekan dönüşüm sağlar E.coli. dönüştürme alkan özelliğine ek olarak alkanoller, E. coli suşlarının sırasıyla ADH ve ALDH genlerin uygulanması ile alkoller ve aldehitler için geliştirilmiş bir bozulma süreci ile geliştirilmiştir. Hücre ekstreleri içinde enzim aktivitesi NAD + 'dan NADH üretimi ölçülmesi ile in vitro olarak test edildi. E. ADH ifade coli suşu vahşi tip etkinliğe kıyasla alkol dehidrogenaz aktivitesini bir iki kat artış gösterdi. Kontrol suşu ile karşılaştırıldığında, ALDH protein ekspresyonu E. dodecanal dehidrojenaz aktivitesinin artmış coli cell üç kat ayıklar. Bu deneyler açıkça göstermiştir, in vitro enzim aktivitesinin artmış olduğu için, speküle edilebilir dönüştürülmüş E. coli suşlarının yanı sıra in vivo aktivite yüksekliğidir var.

Host-indüklenen ifadesi (örneğin: indüksiyon kimyasallar ve büyüme sırasında düşük yükü olmayan bağımlılık) olasılığını araştırmak için, bozulmanın yol pCaiF promotör kontrolü altında ifade edildi. Glikoz düzeyleri düşük, örneğin olduğunda bu promotor gen ekspresyonu etkinleştirir. Bir yığın büyüme fazının sonunda. Prensibin bir kanıtı olarak, bu promotör fark glikoz rejimleri altında GFP üretimi ile test edilmiştir. Bu pCaiF-GFP E. dönüştürülmüş olduğu gösterilmiştir coli üstel faz (yüksek glikoz düzeyleri) göre sabit (glikoz-sınırlı) aşamasında daha GFP üretti. Ikincil bir karbon kaynağı varlığında (örn.. Laurik asit), GFP üretim hızı g düşmüştürikincil karbon kaynağının katabolizma dolayı Ayn.

Bu deney, bu promotör etkili yeni degradasyon yollarının için glikoz katabolik kaymalar sağlamak için kullanılabileceğini gösterdi. Bu bozulmaya yol aktive edilmeden önce hızla zengin ortamda organizmalar büyük bir miktar büyüme sağlar. Biz pCaiF organizatörü memba ALKS transkripsiyonel regülatör kullanmayı öneriyoruz. Pseudomonas putida yılında ALKS 5-C 10 n-alkanlar etkileyiciler olarak C tanır. ALKS-alkan kompleks Daha sonra yüksek yağ asitleri, 19 ila n-alkanlar ve dönüşüm dahil alkBFGHJKL operon'u şifreleyen proteinlerin ekspresyonu ile sonuçlanan PalkB promotör etkinleştirir.

Hücre yaşayabilir olması için Algılama ve hidrokarbonların dönüşümü yeterli değildir. Ortamda artan hidrokarbon seviyelerde, vahşi tip E'nin büyüme coli hidro varlığı ile inhibe edilirprotein misfolding neden olabilir zar içinde ve hücre içinde karbonlar. S. horikoshii prefoldin alkanlar 17 varlığında proteinin doğru katlanır yardım bir koruyucuya olup. HIM kullanarak, bu proteinin homolog E. ile etkileşim tahmin edilmiştir E. prefoldin bu aşırı ekspresyonu gösteren coli şaperon proteinler, coli solvent toleransı artırabilir. BioBrick ile BBa_K398406 (phPFDα ve phPFDβ genlerini içeren), E. beka alkan varlığında coli en az% 50 kadar geliştirildi. HIM potansiyel fonksiyonel homologları seçmek için uygun bir araçtır.

Bir bütün olarak araç göz önüne alındığında, bu sulu ortamlarda hidrokarbonların Biyoremediasyon için bir şasi yapı içinde bir ilk adım sağladığı sonucuna varılabilir. Bu temsil eden bir küçük özerk, kendini kopyalayan ve relatively pahalı olmayan bir yöntem. Sonuçlar özellikle enzim testleri yoluyla edinilen ve flash kültürleri sallamak ve dolayısıyla daha büyük ölçekte valide edilmesi gerekir edildi. Bu sistem üzerinde daha fazla araştırma hidrokarbon bozulması için öngörülen sistem oluşturmak için ayrı ayrı çalışmak için burada gösterilmiştir farklı enzimleri, kaplin odaklanmalıdır. Ayrıca, diğer kirletici maddelerin bozulması için alternatif yollar ayrıca de kirletici maddelerin daha geniş bir kapsam için tek başına hidrokarbon bioremediation ötesinde bu şasi kullanımını genişletmek olabilir, ve muhtemelen ürün yollarının uygulanması bile üretimi için bu sistem faydalanabilirler değerli kimyasallar. Bizim sonuçlar petrol kirliliği ile başa çıkabilirim, ve ayrıca diğer uygulamalar geniş bir yelpazede geliştirmek için yararlı olabilecek yeni organizmalar oluşturmak için sentetik biyoloji BioBricks montaj stratejisinin uygunluğu vurgulamaktadır.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Çıkar çatışması ilan etti.

Acknowledgments

Bu video-makale yapılan deneyler uluslararası Genetik Makinesi rekabete 9 için geliştirilmiştir. Yazarlar için iGEM ekip üyeleri Luke Bergwerff, Pieter van TM Boheemen, Jelmer Cnossen, Hugo F. Cueto Rojas ve Ramon van der Valk teşekkür etmek istiyorum araştırma yardımı. Biz yararlı tartışmalar ve bu araştırma barındırma için Han de Winde, Stefan de Kok ve Esengül Yıldırım ederim. Bu çalışma Biyoteknoloji TU Delft Üniversitesi, Delft Biyoinformatik laboratuar, Bionanoscience TU Delft Bölümü, Oil Sands Liderlik İnisiyatifi (OSLI), damızlık studentenuitzendbureau, Hollanda Genomik Girişimi, Kluyver Merkezi, Nederlandse Biotechnologische Vereniging (Stichting Biyoteknoloji Nederland) tarafından desteklenmiştir DSM, Geneart, Greiner Bio-one ve Genencor.

Materials

Name Company Catalog Number Comments
E. coli K12 New England Biolabs C2523H
Octane Fluka 74822
Hexadecane Fluka 52209
octanol-1 Fluka 95446
dodecanol-1 Sigma-Aldrich 126799
Hexane Sigma-Aldrich 296090
NADH Sigma-Aldrich N4505
FMN Sigma-Aldrich F2253
MgSO4 J.T. Baker Casno 7487 889
Triton X-100 Sigma-Aldrich T8787
T4 ligase New England Biolabs M0202L
Gas chromatograph
Cell disrupter LA Biosystems CD-019
Spectrophotometer Amersham pharmacia spec 2000
Plate reader Tecan Group Ltd. Magellan v7.0
Incubator Innova, 44
BioBrickTM K398014: BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398014 Alkane Hydroxylase System
Resistance: Chloramphenicol
BioBrickTM K398027: BBa_R0040-BBa_B0034-ladA Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398027 ladA Protein Generator
Resistance: Chloramphenicol
BioBrickTM K398018: BBa_J23100-BBa_J61101-ADH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398018 ADH generator
Resistance: Chloramphenicol
BioBrickTM K398030: BBa_R0040-BBa_B0034-ALDH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398030 ALDH generator
Resistance: Chloramphenicol
BioBrickTM K398326: pCaiF Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398326 pCaiF promoter
Resistance: Chloramphenicol
BioBrickTM K398331: pCaiF-BBa_B0032-BBa_I13401 Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398331 pCaiF measurement device
Resistance: Chloramphenicol
BioBrickTM K398406: BBa_J23002-BBa_J61107-phPFDα-BBa_J61107- Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398406 Solvent tolerance cluster
Resistance: Chloramphenicol

DOWNLOAD MATERIALS LIST

References

  1. Allen, E. W. Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives. J. Environ. Eng. Sci. 7, 123-138 (2008).
  2. Alon, U. An Introduction to Systems Biology: Design Principles of Biological Circuits. CRC Press. (2007).
  3. Center, O. P. Understanding Oil Spills and Oil Spill Response. (1999).
  4. Cytoscape. An Open Source Platform for Complex Network Analysis and Visualization [Internet]. Available from: http://www.cytoscape.org (2012).
  5. Non-Invasive Biomass Monitor with Wide Linear Range [Internet]. Available from: http://www.buglab.com/docs/OnLineODMeasurement.pdf (2012).
  6. Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli. J. Bacteriol. 178, 1248-1257 (1995).
  7. Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir. Proc. Natl. Acad. Sci. U.S.A. 104, (13), 5602-5607 (2007).
  8. Fujii, T., Narikawa, T., Takeda, K., Kato, J. Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6. Biosci. Biotechnol. Biochem. 68, (10), 2171-2177 (2004).
  9. iGEM. Registry of Standard Biological Parts [Internet]. Available from: http://partsregistry.org/Main_Page (2012).
  10. Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23. J. Biosci. Bioeng. 91, (1), 100-102 (2001).
  11. Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23. Extremophiles. 14, 33-39 (2010).
  12. Kieboom, J., De Bont, J. aM. Bacterial Stress Responses. ASM Press. Washington, D.C. (2000).
  13. Kotte, O., Zaugg, J. B., Heinemann, M. Bacterial adaptation through distributed sensing of metabolic fluxes. Mol Syst Biol. 6, 355 (2010).
  14. Kremling, A., Bettenbrock, K., Gilles, E. D. Analysis of global control of Escherichia coli carbohydrate uptake. BMC Syst. Biol. 1, (2007).
  15. Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase. J. Mol. Biol. 376, (2), 453-465 (2008).
  16. Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli. Biotechnol. Bioeng. 73, (5), 347-357 (2001).
  17. Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance. Appl. Microbiol. Biotechnol. 79, (3), 443-449 (2008).
  18. Rehm, H. J., Reiff, I. Mechanisms and occurrence of microbial oxidation of long-chain alkanes. Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).
  19. Rojo, F. Degradation of alkanes by bacteria. Environ. Microbiol. 11, (10), 2477-2490 (2009).
  20. STRING 9.0 Known and Predicted Protein-Protein Interactions [Internet]. Available from: http://string-db.org/newstring_cgi/show_download_page.pl (2012).
  21. Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes. Microbiology. 147, 1621-1630 (2001).
  22. Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes. Extremophiles. 10, (4), 347-356 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics