Um kit de ferramentas para permitir a conversão de hidrocarbonetos em ambientes aquosos

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

A auto sustentável regulação sistema bacteriano para a remediação de contaminações de óleo foi desenhado usando o padrão partes do DNA intercambiáveis ​​(BioBricks). Uma engenharia

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Brinkman, E. K., Schipper, K., Bongaerts, N., Voges, M. J., Abate, A., Wahl, S. A. A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments. J. Vis. Exp. (68), e4182, doi:10.3791/4182 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Este trabalho apresenta um conjunto de ferramentas que permite a conversão de alcanos por Escherichia coli e apresenta uma prova de princípio de sua aplicabilidade. O kit de ferramentas padrão consiste em várias peças intercambiáveis ​​(BioBricks) 9 abordando a conversão de alcanos, a regulação da expressão gênica e de sobrevivência em tóxicos hidrocarbonetos ambientes ricos.

Um percurso de três passos para a degradação alcano foi implementada em E. coli para permitir a conversão de alcanos de média e de cadeia longa para as suas respectivas alcanois, e, finalmente, alkanals alcanóico-ácidos. Este último foi metabolizada pela via β-oxidação nativa. Para facilitar a oxidação de alcanos de cadeia média (C5-C13) e os cicloalcanos (C5-C8), quatro genes (alkB2, rubA3, rubA4 e Rubb) do sistema de alcano-hidroxilase a partir de Gordonia sp. TF6 8,21 foram transformados em E. coli. Para a conversão dealcanos de cadeia longa (C15-C36), o gene a partir de Lada Geobacillus thermodenitrificans foi implementada. Para os passos necessários adicionais do processo de degradação, ADH e ALDH (proveniente G. thermodenitrificans) foram introduzidos 10,11. A actividade foi medida por ensaios de células em repouso. Para cada passo de oxidação, a actividade da enzima foi observada.

Para optimizar a eficiência do processo, a expressão foi induzida somente em condições de glucose baixa: um promotor de substrato-regulado, pCaiF, foi usado. pCaiF está presente em E. coli K12 e regula a expressão dos genes envolvidos na degradação de fontes não-glicose de carbono.

A última parte do kit de ferramentas - visando a sobrevivência - foi implementado usando genes de tolerância de solventes, PhPFDα e β, ambos da Pyrococcus horikoshii OT3. Os solventes orgânicos podem induzir stress celular e diminuição da capacidade de sobrevivência por negativamente affecting enovelamento de proteínas. Como chaperones, PhPFDα e β melhorar o processo de dobragem de proteínas, por exemplo sob a presença de alcanos. A expressão destes genes conduziu a uma tolerância de hidrocarboneto melhorado mostrado por um aumento da taxa de crescimento (até 50%) na presença de 10% de n-hexano no meio de cultura foram observados.

Resumindo, os resultados indicam que o kit de ferramentas permite E. coli para converter e tolerar hidrocarbonetos em ambientes aquosos. Como tal, representa um primeiro passo para uma solução sustentável para o óleo-remediação utilizando uma abordagem de biologia sintética.

Protocol

1. Biotijolo Assembléia

  1. BioBricks do Registro de Standard partes biológicas são fornecidos pela sede iGEM. Para construir um novo a partir de biotijolo BioBricks existentes, digerir o doador biotijolo (até 1,0 ug) com as enzimas EcoRI e SpeI para posicionar os doadores jusante parte da parte de aceitador. Digest com Xbal e PstI para colocar a parte do doador a montante da parte aceitador. Adicionar uma enzima de restrição apropriada terceiro que corta na espinha dorsal do doador. Realizar as digestões num volume total de 20-25 ml com o tampão apropriado, de acordo com o fornecedor (concentração final de 1 x). Use 5 unidades / ug de ADN para as enzimas de restrição.
  2. Digerir o biotijolo aceitador com um EcoRI e XbaI ou SpeI e PstI.
  3. Incubar as digestões de (pelo menos) uma hora a 37 ° C. Inactivar as endonucleases de restrição por calor, a incubação a 80 ° C durante 10 min e centrifuga-se brevemente.
  4. Ligar o biotijolo digeridopartes (dador e do aceitador) em conjunto. Desde XbaI e SpeI gerar extremidades de ADN compatíveis, um site misto é criado que não pode ser cortado com qualquer enzima de restrição resultando num novo biotijolo "combinado", que flanqueado por os 4 sítios de restrição padrão. Na mistura de ligação à concentração final de ADN é de preferência ~ 100 ng / uL. Realizar a reacção de ligação num volume total de 10-15 ml com o tampão de ligação T4 (concentração final de 1 x) e ligase de T4 (1 unidade / ug de ADN).
  5. Incubar a mistura de ligação a 16 ° C durante pelo menos 3 horas.
  6. Realizar a reacção de transformação de cerca de meia da mistura de ligação.
  7. Confirme o biotijolo ser correto com o sequenciamento.
  8. Para construir um novo biotijolo de ADN sintetizado, modificar os genes para a síntese para a expressão óptima em E. coli, por meio da ferramenta de website JCat ( http://www.jcat.de/ ). Fazer modificações adicionais, em conformidade com os requisitos da B ioBrick padrão. Esta padronização implica que cada biotijolo é composta de uma sequência de ADN de interesse precedido por um prefixo e seguido por um sufixo. O prefixo e sufixo são seqüências que contêm sítios de restrição predefinidos, que estão ausentes na sequência restante plasmídeo. Estes sítios de restrição padrão tornam possível trocar e estender as inserções biotijolo flexível 9. O prefixo e sufixo têm as seguintes seqüências:
Nome Seqüência Comentário
Prefixo 5 'GAATTCGCGGCCGCTTCTAG3'
5 'GAATTCGCGGCCGCTTCTAGAG 3' Se a parte que se segue é uma sequência de codificação ou de qualquer parte que começa com "ATG"
Sufixo 5 'TACTAGTAGCGGCCGCTGCAG 3'
ove_title "> 2. Conversão Alkane ensaio de células em repouso, In Vivo

Este ensaio foi realizado com base no método descrito por Fujii et al. (2004).

  1. Cultura E. As células de E. coli que expressam o sistema Hidroxilase alcano ( BBa_K398014 ) e células transportando um vector vazio ( BBa_J13002 ) em 5 ml de meio LB com antibióticos apropriados durante a noite.
  2. Transferir 500 uL da cultura durante a noite em 50 ml de LB fresco (com antibiótico) e incubar até a turbidez celular atingiu uma DO (densidade óptica) de 0,3 a 600 nm.
  3. Centrifugar durante 10 minutos a 4.000 rpm e ressuspender o sedimento em 5 ml de tampão de fosfato 0,1 M (pH 7,4).
  4. Centrifugar novamente durante 10 min a 4.000 rpm e ressuspender o sedimento em 5 ml de tampão fosfato 0,1 M contendo agora sais de E2 e 0,66% de glicerol v / v (azoto-defit médio).
  5. Medir a turbidez da célula (OD 600).
  6. Prepare célula mistura-se alíquotas de 6 ml em frascos de 25 ml fechado de tampão de vidro e não de células controles (sais de E2 + 0,66% de glicerol v / v).
  7. Adicionar 100 nmol de alcano a cada frasco.
  8. Incubar as misturas a 37 ° C durante 24 horas (quando diminuir as taxas mais elevadas obtêm-se).
  9. Medir a OD 600 após incubação.
  10. Extrair os hidrocarbonetos no meio de cultura com acetato de etilo e determinar a concentração de hidrocarboneto em cultura celular por cromatografia gasosa (ver protocolo 3).
  11. Calcula-se a degradação por unidade de biomassa através da divisão da quantidade total de alcano convertido pela biomassa total presente em cada frasco (converter OD 600 de peso seco). Dividindo o resultado pela duração experimental produz a actividade de degradação por unidade de biomassa por unidade de tempo. A média é calculada a partir de três experiências individuais.

3. Alcano Ensaio Enzima de conversão, emVitro

Este ensaio foi efectuado essencialmente de acordo com o método descrito por Li et al. (2008).

  1. Cultura E. As células de E. coli que expressam o gene Lada ( BBa_K398017 ) e células portadoras de um vector vazio ( BBa_J13002 ) em 50 ml de meio LB com antibióticos apropriados durante a noite.
  2. Transferir 500 uL da cultura durante a noite em 50 ml de LB fresco (com antibiótico) e incubar até a turbidez celular atingiu uma densidade óptica de 0,6 a 600 nm.
  3. Centrifugar 10 min a 4000 rpm (4 ° C) e ressuspender o sedimento em 5 ml de tampão Tris 50 mM.
  4. Sonicado (disruptor celular, LA Biosystems), as células no ciclo de trabalho de 40%, com um controlo de saída de 4, manter a solução em gelo durante todo o período.
  5. Centrifugar a mistura resultante durante 5 min a 4000 rpm a 4 & dpor exemplo, C para remover os restos celulares. Transferir o sobrenadante para um tubo fresco.
  6. Determinar a concentração de proteína total dos extractos de células por ensaio de Bradford. Nota: Utilizar frascos de vidro para evitar o crescimento de fundo e / ou a perda de proteínas.
  7. Prepara-se uma mistura de 100 ml contendo 0,1% v / v de alcano e 50 mM de tampão Tris-HCl.
  8. Aquecer a mistura a 100 ° C durante 5 min. Nota: Realize esta etapa apenas para alcanos médio de cadeia longa, com alto ponto de ebulição. (Por exemplo, C 16: 287 ° C).
  9. Para alcançar uma solubilidade óptima do alcano, sonicar durante 1 min, enquanto ainda quente, até uma mistura viscosa homogénea é obtida.
  10. Adicionar 1 mM de NADH, 1 mM de FMN, 1 mM de MgSO 4 e 0,01 v / v de Triton X-100.
  11. Prepare 6 alíquotas ml em 25 ml-tampão fechado frascos.
  12. Adicionar a quantidade adequada de extracto de células (dependendo do ensaio de Bradford, à concentração final de 5 mg de proteína / l). Prepare um controle não-proteína.
  13. Incubar a 60 ° C (para e óptimanzymatic actividade) durante 24 h.
  14. Extrair os hidrocarbonetos no meio de cultura com acetato de etilo e determinar a concentração de hidrocarboneto em cultura celular por cromatografia gasosa (ver protocolo 3).
  15. Calcula-se a degradação por unidade de biomassa através da divisão da quantidade total de alcano convertido por proteína total adicionado a cada frasco (por Bradford curva de calibração). Além disso dividindo por a duração da experiência produz a actividade de degradação por unidade de proteína celular por unidade de tempo. A média é calculada a partir de três experiências individuais.

4. Extração de hidrocarbonetos e acetato de medições de concentração

  1. Alcanos são extraídos a partir da solução aquosa por adição de 2,5 ml de acetato de etilo (Solvant apolar) a 6 ml de solução experimental. Um padrão interno é adicionado ao solvente, a uma concentração de 0,1% (v / v). O padrão (por exemplo, ciclo-decan) pode variar dependendo da gama esperada dos picos de interesse.
  2. Opcional: Adicionar TritonX-100 à mistura aquosa e centrifugar as amostras durante 10 min a 4000 rpm a fim de obter um sistema bi-fásico adequado.
  3. Vortex a mistura durante 5 seg (1.500 rpm) e incuba-se à temperatura ambiente até as duas fases separadas.
  4. Remover uma quantidade máxima da camada orgânica (superior) e secar-se o solvente sobre sulfato de magnésio anidro.
  5. Remover MgSO4 por filtração (0,2 um) e transferir o filtrado para frascos cromatógrafo de gás para as medições, ou armazenar a -20 ° C.
  6. Determinar a concentração por meio de cromatografia gasosa utilizando uma coluna CP-SIL 5CB (comprimento = 5 m). Injectam-se 10 ul de amostra no modo de divisão (1:10, 230 ° C). Definir o fluxo de gás de coluna a 1 ml / min (hélio). O seguinte programa de temperaturas do forno é usado:
    Taxa Temperatura [° C] Tempo [min]
    0 50 7,5
    50 90 1,0
    50 110 2,0
    50 130 2,0
    50 145 2,0
    50 160 2,0
    50 170 2,0
    50 185 2,0
    50 210 2,0
    50 250 2,0
    50 320 2,0
  7. Integrar os picos e corrigir as concentrações em relação ao padrão interno.

5. Álcool / aldeído desidrogenase Ensaio

Este ensaio foi efectuado essencialmente de acordo com o método descrito por Kato et al.(2010).

  1. Cultura E. As células de E. coli que expressam o ADH ( BBa_K398018 ) ou ALDH ( BBa_K398030 gene) e células portadoras de um vector vazio ( BBa_J13002 ) em 50 ml de meio LB com antibióticos apropriados durante a noite.
  2. Transferir 500 uL da cultura durante a noite em 50 ml de LB fresco (com antibiótico) e incubar até a turbidez celular atingiu uma densidade óptica de 0,6 a 600 nm.
  3. Centrifugar 10 min a 4.000 rpm a 4 ° C e ressuspender o sedimento em 5 ml de 50 mM de tampão Tris.
  4. Sonicar a solução de células no ciclo de trabalho de 40% com um controlo de saída de 4 (manter a solução em gelo durante a sonicação).
  5. Centrifugar a mistura resultante durante 5 min a 4000 rpm a 4 ° C para remover os restos celulares.
  6. Para determinar oconcentração de proteína tal dos extractos celulares pelo ensaio de Bradford (Nota: utilizar um frasco de vidro para prevenir a ligação da proteína).
  7. Carregar uma placa de 96 poços com 180 ul de 57 mM de tampão de glicina contendo NAD (concentração final 1 mM, pH 9,5) em cada poço.
  8. Adicionam-se 5 ul de álcool (aldeído) a ser testado para os poços. Nota: os álcoois de cadeia longa de calor antes do início do ensaio, para ter um líquido. Para cada álcool (aldeído) um controlo sem substrato deve ser adicionado (controlo negativo). Além disso, preparar um branco contendo uma mistura de solução tampão e do substrato, sem extracto celular.
  9. Pré-aqueça o prato de o leitor de placas (Tecan Magellan v7.0) durante 15 min a 37 ° C para permitir o equilíbrio do sistema.
  10. Adicionar a quantidade adequada de extracto de células (dependendo do ensaio de Bradford, à concentração final de 5 mg de proteína / l). Prepare um controle não-proteína.
  11. Medir a produção de NADH utilizando um espectrofotómetro a um comprimento de onda de 340 nm a cada 2-3 min durante 1 hora a 37 ° C. </ Li>
  12. Calcula-se a taxa de produção de NADH a partir do declive da DO (340 nm). Leve em conta o comprimento do caminho de luz e coeficiente de extinção do NADH de 6220 M -1 cm -1. Dividir a taxa de produção de NADH com a quantidade total de proteína adicionada para expressar a actividade da reacção de desidrogenase no extracto celular (U / mg de proteína celular total). Calcula-se a média e o desvio padrão de três experiências independentes.

6. Caracterização pCaiF

  1. Cultura E. As células de E. coli que expressam a construção pCaiF-GFP ( BBa_K398331 ) e as células que transportam o promotor sozinho ( BBa_K398326 ) durante a noite em 5 ml de meio LB durante a noite os antibióticos apropriados.
  2. Inocular 5 ml M9 contendo glicose a 10 g / l e os antibióticos, com 50 uL da cultura durante a noite e crescer durante a noite. Ul subcultura 50 da excrescência durante a noite em 5 ml de fresco M9 with10 g / l e incubado até a turbidez celular atingiu uma densidade óptica de 0,2 a 600 nm.
  3. Carregar uma placa de 96 poços com 100 ul de meio M9 fresco contendo a quantidade desejada de fonte de carbono para testar em cada poço. Realizar ensaios em triplicado para a avaliação estatística e adicionar os respectivos controlos negativos (de tipo selvagem de E. coli K12).
  4. Adicionam-se 5 ul da cultura durante a noite para os poços contendo meio.
  5. Medir a curva de crescimento (DO 600) e GFP de fluorescência (485 nm de excitação e de emissão de 520), utilizando um leitor de placas a cada 10 min durante 18 horas a 37 ° C com agitação constante.
  6. Calcula-se a taxa de crescimento e o teor de GFP específica a partir das medições respectivas e comparar com o controlo. Calcula-se a média e o desvio padrão de pelo menos três experiências independentes.

7. Ensaio de tolerância

  1. CulturaE. coli expressando o gene PhPFDα e β ( BBa_K398406 ) durante a noite em 5 ml de meio LB e os antibióticos apropriados. E. coli que expressam Lada gene ( BBa_K398017 ) é utilizado como controlo negativo.
  2. Ul subcultura 10 da excrescência durante a noite em 5 ml de LB fresco (com antibiótico) e incuba-se até que a turbidez celular atingiu uma densidade óptica de 0,3 a 0,4 a 600 nm.
  3. Diluir as culturas com meio fresco até uma OD 600 de 0,1 seja alcançado.
  4. Carregar uma placa de 96 poços com 180 ul de meio M9 contendo os antibióticos adequados e a concentração final apropriada do composto tóxico (por exemplo, 0, 4, 8, 10% de n-hexano), em triplicado. Porque alcano-misturas de água pode levar a sistemas de duas fases é essencial ter controlos apropriados na placa (por exemplo, dcepas iferentes e as experiências respectivas em branco).
  5. Adicionar 20 ul da cultura (controlo) nos poços.
  6. Medir a concentração da biomassa (OD 600), utilizando um leitor de placas a cada 10 min durante 24 h, a 37 ° C com agitação constante.
  7. Calcular as taxas de crescimento a partir das medições para as respectivas concentrações de agentes diferentes e comparar com o controlo negativo. Calcula-se a média e o desvio padrão de pelo menos três experiências independentes.

8. Mapeamento de Interação homólogo

  1. O aplicativo foi desenvolvido ELE para realizar consultas de proteína em um servidor de banco de dados PostgreSQL executando a STRING (grátis para uso acadêmico) 20. O homólogo aplicativo de mapeamento interação identifica proteínas interagem no organismo hospedeiro original, usando o banco de dados STRING. As sequências dos genes respectivos que interagem são utilizadas numa pesquisa BLAST para encontrar genes homólogos no organismo alvo. Cytoscape 4 https://github.com/jcnossen/InteractionHomologMapping.
  2. Para realizar um mapeamento, (1) inserir a ID biotijolo ea aplicação irá baixar automaticamente os dados das peças de seqüência do registro de Standard Partes Biológicas 9, ou (2) entrar (colar) os dados de seqüência na aplicação.
  3. Use o site banco de dados STRING para encontrar o ID de proteínas STRING para a seqüência de ácido amino entrou.
  4. Uma proteína com alta homologia é determinada utilizando BLAST. Subsequentemente, a aplicação relaciona cada proteína interagindo conhecida no organismo fonte e procura por homólogos no organismo hospedeiro (por exemplo, E. coli).
  5. Exportar lista interação resultante putativo de texto ou Cytoscape.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

O princípio biotijolo é utilizado para construir um chassis para a degradação dos alcanos e uma prova de princípio para os componentes individuais da caixa de ferramentas foi obtido. Os ensaios são propostas diversas para medir a in vivo e in vitro a actividade de enzimas da via de alcano degradantes. O trabalho apresentado demonstra com sucesso um número de métodos que podem ser usados ​​para determinar as actividades enzimáticas e de expressão do organismo hospedeiro E. coli após a implementação do BioBricks adequados. Além disso, mostra-se que o princípio biotijolo pode ser utilizado para desenhar um organismo que expressa as proteínas necessárias para a degradação dos alcanos, fornece um sistema de regulação que produz estas enzimas apenas quando for necessário e aumenta a tolerância do organismo hospedeiro na presença de hidrocarbonetos . Uma vez mais desenvolvida, este chassis pode ser utilizado para a degradação biológica de óleo residual, por exemplo, em águas de rejeito areias betuminosas, ou para o tratamentode águas residuais da indústria do petróleo.

No que diz respeito à degradação dos alcanos, os ensaios foram realizados para a caracterização das enzimas envolvidas na primeira etapa de degradação alcano (AH-sistema e LADA). Foi demonstrado que uma E. coli carregando o AH-sistema de Gordonia sp. TF6 foi capaz de converter octano in vivo. Esta descoberta está de acordo com os resultados de Fujii et. al. 8, em que a biotransformação de n-alcanos usando E. coli que expressam os genes de componentes mínimos da AH-sistema foi alcançado. A actividade foi medida por conversão de um estudo comparativo (do tipo selvagem versus mutante) após um dado tempo. Para uma caracterização completa, estudos adicionais devem ser realizados sobre a actividade da AH-sistema ao longo do tempo e a cinética do sistema.

Para a conversão de alcanos de cadeia longa (C 15-C 36), o gene a partir de Lada Geobathermodenitrificans cillus foi implementada. A actividade da enzima foi testada in vitro usando o hexadecano como fonte de cadeia longa de hidrocarboneto. Este E. modificado coli apresentava uma actividade de enzima aumentada em comparação com a estirpe de controlo, demonstrando a proteína recombinante Lada permite a conversão de hexadecano por E. coli. Além da propriedade de alcanos de conversão para alcanóis, E. coli foram desenvolvidas com um processo aperfeiçoado para a degradação dos álcoois e aldeídos por a aplicação da ADH e genes ALDH respectivamente. A actividade da enzima em extractos celulares foi testada in vitro medindo-se a produção de NADH a partir de NAD +. O E. coli estirpe expressando ADH mostraram um aumento de duas vezes na actividade de desidrogenase de álcool em relação à actividade do tipo selvagem. Em comparação com a estirpe de controlo, a expressão de proteína ALDH aumentou a actividade de desidrogenase de E. dodecanal cel colil extrai três vezes. Dado que estes ensaios demonstraram claramente o aumento da actividade da enzima in vitro, pode-se especular que a transformada E. coli têm níveis elevados de actividade in vivo, bem.

Para explorar a possibilidade de hospedeiro induzida pela expressão (por exemplo: não-dependência de produtos químicos de indução e do fardo durante o crescimento baixo), a via de degradação foi expressa sob o controlo do promotor de pCaiF. Este promotor activa a expressão do gene, quando os níveis de glucose são baixos, por exemplo. no final de uma fase de crescimento de lote. Como prova de princípio, este promotor foi testado através da produção de GFP sob regimes de glicose diferença. Foi demonstrado que a GFP-pCaiF transformada E. coli produziu mais GFP durante a fase (glucose-limitada) estacionário do que na fase exponencial (níveis elevados de glicose). Na presença de uma fonte de carbono secundário (por exemplo. Ácido láurico), a taxa de produção de GFP reduzida again devido ao catabolismo do secundário da fonte de carbono.

A experiência demonstrou que este promotor pode ser usado eficazmente para permitir deslocamentos catabólicos de glicose para novas vias de degradação. Isto permite a crescer rapidamente uma grande quantidade de organismos no meio rico antes da via de degradação é activado. Propomo-nos utilizar o promotor pCaiF montante regulador ALKS transcricional. Em Pseudomonas putida, ALKS reconhece C 5-C 10 n-alcanos como efectores. Os níveis subsequentemente altos de ALKS-alcano complexo activar o promotor PalkB resultando na expressão das proteínas de codificação do operão alkBFGHJKL envolvidos na conversão de n-alcanos de ácidos gordos 19.

Detecção e conversão de hidrocarbonetos não é suficiente para que a célula seja viável. Em níveis crescentes de hidrocarbonetos no meio ambiente, o crescimento de tipo selvagem de E. coli é inibida pela presença de hidroátomos de carbono na membrana e na célula, o que pode causar misfolding proteína. P. horikoshii prefoldin é uma chaperona auxiliando a dobragem correcta da proteína na presença de alcanos 17. Usando ele, era previsto que esta proteína interage com homólogo E. coli proteínas chaperones, sugerindo que a sobre-expressão de prefoldin em E. coli pode melhorar a tolerância do solvente. Com a biotijolo BBa_K398406 (consistindo de genes e phPFDα phPFDβ), a capacidade de sobrevivência de E. coli na presença de alcanos foi melhorado até 50%. HIM é uma ferramenta adequada para selecionar potenciais homólogos funcionais.

Considerando-se a caixa de ferramentas, como um todo, pode-se concluir que proporciona um primeiro passo na construção de um chassis para a biorremediação de hidrocarbonetos em ambientes aquosos. Isso representa um pequeno, autônomo, auto-replicantes e relatively método barato. Os resultados foram principalmente adquirido através de ensaios enzimáticos e agitar culturas flash e, portanto, precisa ser validado em uma escala maior. Investigação adicional sobre este sistema deverá centrar-se no acoplamento de enzimas diferentes, que foram mostrados aqui para trabalhar individualmente, a fim de gerar o sistema previsto para a degradação de hidrocarbonetos. Além disso, a adição de vias alternativas para a degradação de outros poluentes podem também aumentar a utilização deste chassis além biorremediação de hidrocarbonetos sozinho a um âmbito mais amplo de poluentes, e, possivelmente, a aplicação de produtos de vias pode ainda utilizar este sistema para a produção de químicos valiosos. Os resultados obtidos demonstram a adequabilidade da estratégia de montagem BioBricks em biologia sintética para a construção de novos organismos que podem lidar com a poluição por hidrocarbonetos, e pode, adicionalmente, ser útil para o desenvolvimento de uma grande variedade de outras aplicações.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Não há conflitos de interesse declarados.

Acknowledgments

Os experimentos realizados neste vídeo-artigo foram desenvolvidos para a competição internacional Máquina Genetically Engineered 9. Os autores gostariam de agradecer aos membros da equipe iGEM Lucas Bergwerff, Pieter van TM Boheemen, Jelmer Cnossen, Hugo F. Cueto Rojas e Ramon van der Valk para a assistência na pesquisa. Agradecemos Han de Winde, Stefan de Kok e Esengül Yıldırım para discussões úteis e hospedagem desta pesquisa. Este trabalho foi financiado pela TU Delft University Departamento de Biotecnologia, a Delft Bioinformática laboratório, TU Delft Departamento de Bionanoscience, areias petrolíferas Leadership Initiative (OSLI), Stud studentenuitzendbureau, Iniciativa Holanda Genomics, Centro Kluyver, Biotechnologische Nederlandse Vereniging (Stichting Biotecnologia Nederland) , DSM, Geneart, Greiner Bio-One e Genencor.

Materials

Name Company Catalog Number Comments
E. coli K12 New England Biolabs C2523H
Octane Fluka 74822
Hexadecane Fluka 52209
octanol-1 Fluka 95446
dodecanol-1 Sigma-Aldrich 126799
Hexane Sigma-Aldrich 296090
NADH Sigma-Aldrich N4505
FMN Sigma-Aldrich F2253
MgSO4 J.T. Baker Casno 7487 889
Triton X-100 Sigma-Aldrich T8787
T4 ligase New England Biolabs M0202L
Gas chromatograph
Cell disrupter LA Biosystems CD-019
Spectrophotometer Amersham pharmacia spec 2000
Plate reader Tecan Group Ltd. Magellan v7.0
Incubator Innova, 44
BioBrickTM K398014: BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398014 Alkane Hydroxylase System
Resistance: Chloramphenicol
BioBrickTM K398027: BBa_R0040-BBa_B0034-ladA Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398027 ladA Protein Generator
Resistance: Chloramphenicol
BioBrickTM K398018: BBa_J23100-BBa_J61101-ADH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398018 ADH generator
Resistance: Chloramphenicol
BioBrickTM K398030: BBa_R0040-BBa_B0034-ALDH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398030 ALDH generator
Resistance: Chloramphenicol
BioBrickTM K398326: pCaiF Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398326 pCaiF promoter
Resistance: Chloramphenicol
BioBrickTM K398331: pCaiF-BBa_B0032-BBa_I13401 Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398331 pCaiF measurement device
Resistance: Chloramphenicol
BioBrickTM K398406: BBa_J23002-BBa_J61107-phPFDα-BBa_J61107- Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398406 Solvent tolerance cluster
Resistance: Chloramphenicol

DOWNLOAD MATERIALS LIST

References

  1. Allen, E. W. Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives. J. Environ. Eng. Sci. 7, 123-138 (2008).
  2. Alon, U. An Introduction to Systems Biology: Design Principles of Biological Circuits. CRC Press. (2007).
  3. Center, O. P. Understanding Oil Spills and Oil Spill Response. (1999).
  4. Cytoscape. An Open Source Platform for Complex Network Analysis and Visualization [Internet]. Available from: http://www.cytoscape.org (2012).
  5. Non-Invasive Biomass Monitor with Wide Linear Range [Internet]. Available from: http://www.buglab.com/docs/OnLineODMeasurement.pdf (2012).
  6. Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli. J. Bacteriol. 178, 1248-1257 (1995).
  7. Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir. Proc. Natl. Acad. Sci. U.S.A. 104, (13), 5602-5607 (2007).
  8. Fujii, T., Narikawa, T., Takeda, K., Kato, J. Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6. Biosci. Biotechnol. Biochem. 68, (10), 2171-2177 (2004).
  9. iGEM. Registry of Standard Biological Parts [Internet]. Available from: http://partsregistry.org/Main_Page (2012).
  10. Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23. J. Biosci. Bioeng. 91, (1), 100-102 (2001).
  11. Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23. Extremophiles. 14, 33-39 (2010).
  12. Kieboom, J., De Bont, J. aM. Bacterial Stress Responses. ASM Press. Washington, D.C. (2000).
  13. Kotte, O., Zaugg, J. B., Heinemann, M. Bacterial adaptation through distributed sensing of metabolic fluxes. Mol Syst Biol. 6, 355 (2010).
  14. Kremling, A., Bettenbrock, K., Gilles, E. D. Analysis of global control of Escherichia coli carbohydrate uptake. BMC Syst. Biol. 1, (2007).
  15. Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase. J. Mol. Biol. 376, (2), 453-465 (2008).
  16. Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli. Biotechnol. Bioeng. 73, (5), 347-357 (2001).
  17. Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance. Appl. Microbiol. Biotechnol. 79, (3), 443-449 (2008).
  18. Rehm, H. J., Reiff, I. Mechanisms and occurrence of microbial oxidation of long-chain alkanes. Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).
  19. Rojo, F. Degradation of alkanes by bacteria. Environ. Microbiol. 11, (10), 2477-2490 (2009).
  20. STRING 9.0 Known and Predicted Protein-Protein Interactions [Internet]. Available from: http://string-db.org/newstring_cgi/show_download_page.pl (2012).
  21. Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes. Microbiology. 147, 1621-1630 (2001).
  22. Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes. Extremophiles. 10, (4), 347-356 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics