فلوري

Immunology and Infection
 

Summary

أجناس البعوض بين الثلاثة، وهي

Cite this Article

Copy Citation | Download Citations

Timoshevskiy, V. A., Sharma, A., Sharakhov, I. V., Sharakhova, M. V. Fluorescent in situ Hybridization on Mitotic Chromosomes of Mosquitoes. J. Vis. Exp. (67), e4215, doi:10.3791/4215 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

الفلورسنت في الموقع التهجين (FISH) هو أسلوب يستخدم بشكل روتيني من قبل العديد من المختبرات لتحديد موقف من تحقيقات الكروموسومات الحمض النووي RNA و. طلب واحد مهم من هذا الأسلوب هو تطوير عالية الجودة وخرائط البدنية مفيدة لتحسين الجمعيات الجينوم للكائنات المختلفة. نمط النطاقات الطبيعية من الكروموسومات البوليتينية والإنقسامية توجيهات لترتيب دقيق والتوجه للsupercontigs الجيني. أجناس البعوض بين الثلاثة، وهي الأنوفيلة، الزاعجة، والكيولكس، وقد وضعت راسخة تقنية رسم الخرائط القائمة على كروموسوم فقط لالأنوفيلة، التي تمتلك أعضاء الكروموسومات البوليتينية قراءة 1. نتيجة لجهود رسم خرائط الجينوم، 88٪ من ف. وقد وضعت في مناصب الغامبية الجينوم الكروموسوم دقيقة 2،3. لقد اثنين من أجناس البعوض polytenized أخرى، والزاعجة الكيولكس، سيئة الكروموسومات بecause من كثرة كبيرة من العناصر القابلة للنقل والتي في الجينوم 4، 5، 6. وقد تم تعيين فقط 31 و 9٪ من الجينوم supercontings دون أمر أو توجيه لالكروموسومات من AE. بعوض 7 و معادل. الخماسية على التوالي. سبق الإنقسامية إعداد الصبغي لهذين النوعين يقتصر على الدماغ والعقد العصبية خطوط الخلايا. ومع ذلك، والشرائح كروموسوم أعدت من العقد العصبية للدماغ البعوض عادة ما تحتوي على أعداد قليلة من لوحات الطورية 9. أيضا، على الرغم من تطوير تقنية FISH للالكروموسومات الإنقسامية من خط الخلية من AE. بعوض 10، تراكم إعادة ترتيب الكروموسومات الكروموسومات متعددة في خط خلية عديمة الفائدة 11 يجعل لهم لرسم خرائط الجينوم. نحن هنا وصف بسيط، تقنية قوية للحصول على نوعية عالية من الاستعدادات كروموسوم الإنقسامية أقراص تخيلي (معرفات) من 4 ال يرقات الطور الذي جيمكن استخدام لجميع الأجناس الثلاثة من البعوض. هو الأمثل بروتوكول قياسي 12 FISH لاستخدام الحيوانات المستنسخة من الحمض النووي الجيني BAC كما دقق في الكروموسومات الإنقسامية من AE. بعوض و Cx. الخماسية، وللاستفادة من التبادل بين الجينات (IGS) منطقة DNA الريباسي (rDNA) وذلك على التحقيق. الكروموسومات الغامبية. بالإضافة إلى رسم الخرائط المادية، يمكن تطبيق هذه التقنية المتقدمة لعلم الوراثة الخلوية السكان والتصنيف كروموسوم / النظاميات من البعوض والحشرات الأخرى الجماعات.

Protocol

1. كروموسوم إعداد

وتربى يرقات البعوض باستخدام بروتوكول قياسي وصفها في طرق البحث العلمي في الأنوفيلة متاحة على الموقع الإلكتروني لمركز بحوث الملاريا ومرجع الموارد الكاشف (MR4) 13. تم تعديل درجات الحرارة لتربية البعوض لتوفير أكبر عدد من الكروموسومات في أقراص تخيلي وفيات أقل من اليرقات. تم تحديد مراحل التنمية يرقات البعوض على أساس أحجام كبسولات رؤوسهم 13.

  1. يفقس بيض البعوض في 28 ° C، وبعد 2-3 أيام، الثانية 2 أو 3 نقل اليرقات طور مرحلي الثالثة لC ° 16 ل AE. بعوض و Cx. الخماسية وC ° 22 لآن. الغامبية.
  2. مكان يرقات العمر ال 4 على الجليد لعدة دقائق لتجميد.
  3. نقل اليرقة إلى شريحة مع قطرة من حل ناقص التوتر الباردة (0.5٪ حتىسيترات أو المتوسط ​​أبعد 0،075 كلوريد البوتاسيوم M)، ووضعه تحت المجهر ستيريو.
  4. حدد يرقة مع معرفات البيضاوي (1B الشكل) لتشريح أخرى.
  5. قطع رأس يرقة، وقطع إهاب من الجانب البطنية من الصدر اليرقات باستخدام مقص تشريح (الشكل 2A). جعل خفض إضافي في الجزء الثاني أو الثالث في البطن لتشريح القناة الهضمية من اليرقة. وتظهر اتجاهات الخفض الذي تعهدت به السهام.
  6. فتح بشرة، وإزالة الدهون في الجسم والقناة الهضمية من اليرقة. إزالة الحل ناقص التوتر من الشريحة باستخدام ورق الترشيح، وإضافة قطرة جديدة من حل ناقص التوتر مباشرة إلى معرفات (الشكل 2B). إبقاء اليرقة في حل ناقص التوتر لمدة 10 دقيقة في RT.
  7. إزالة حل ناقص التوتر على استعمال ورق الترشيح، وتطبيق حل Carnoy ل(الايثانول / حامض الخليك في نسبة 3:1). بعد إضافة محلول مثبت، معرفات بدوره على الفور الأبيض وتصبح مرئية بسهولة تحت المجهر (الشكل 2C
  8. استخدام الإبر تشريح، وإزالة معرفات من يرقة (الشكل 2D)، ونقلها إلى قطرة من حمض البروبيونيك 50٪. إزالة أي أنسجة أخرى مثل القناة الهضمية والدهون في الجسم، من الشريحة. تغطية معرفات مع زلة غطاء 22x22 unsiliconized، والحفاظ على لمدة 10 دقيقة في RT.
  9. تغطية الشريحة مع ورق الترشيح، والاسكواش الأنسجة من خلال الاستفادة من ممحاة قلم الرصاص في محيط من الانزلاق الغطاء.
  10. تحليل لفترة وجيزة نوعية الشريحة باستخدام المجهر مرحلة التباين في 100X 200X أو التكبير (الشكل 3). ويمكن اعتبار الاستعدادات مع> 50 كروموسوم ينتشر مناسبة للأسماك.
  11. تراجع مع الاستمرار على الشريحة في النيتروجين السائل حتى يتوقف محتدما. إزالة الغطاء زلة من الشريحة باستخدام شفرة حلاقة، ونقل على الفور إلى الشريحة وعاء يحتوي على 70٪ إيثانول برود في -20 ° C. المحل في 4 درجات مئوية لمدة لا تقل عن 1 ساعة نتيجة أفضل الجفاف (إذا لزم الأمر، يمكن تخزين الشرائح في رله خطوة من عدة دقائق إلى عدة أيام).
  12. يذوى الشرائح في سلسلة من الايثانول (70٪، 80٪، 100٪) في 4 درجات مئوية لمدة 5 دقائق لكل منهما، والهواء الجاف في RT.
  13. تخزين الشرائح الجافة في -20 ° C قبل الاستفادة منها للأسماك.

2. استخراج الحمض النووي المتكررة الكسور

أداء FISH من DNA BAC التحقيق استنساخ على الكروموسومات من AE. بعوض و Cx. الخماسية يتطلب استخدام غير المسماة الكسور المتكررة DNA لمنع التهجين غير محددة من الحمض النووي لتكرار الكروموسومات. وإعادة الترابط للمنفردة الجديلة DNA مجزأة إلى قطع عدة مئات من بي بي يلي منحنى C 0 ر حيث C 0 هو تركيز الأولي من احد الذين تقطعت بهم السبل الحمض النووي ور هي المرة reannealing. تعتبر كسور DNA مع القيم C0t يساوي 10 -1 -10 -4 -10 ° أو 10 (2)، ومعتدلة للغاية المتكررة، على التوالي.

  1. يستخرج 400-500 ميكروغرام من الحمض النووي الجيني من البعوض الكبار بأكملها باستخدام QIAGEN الدم والخلايا Maxikit الثقافة، وإعداد 100-1،000 نانوغرام / ميكرولتر الحمض النووي في حل SSC 1.2x.
  2. prewarmed DNA تفسد عن طريق وضع أنبوب آمنة للانغلاق مع الحمض النووي الجيني في كتلة التدفئة إلى 120 درجة مئوية لمدة 2 دقيقة. ارتفاع في درجة الحرارة يساعد على DNA إلى أجزاء تتراوح بي بي 200-500.
  3. اعتمادا على تركيز الحمض النووي، reassociate DNA عن طريق وضع أنبوب في C ° 60 دقيقة ل15-150 للحصول على C DNA T 0 الكسور تصل إلى T3 0 C (الجدول 1).
  4. وضع أنبوب مع DNA على الجليد لمدة 2 دقيقة.
  5. نقل DNA إلى 42 ° C، إضافة محمى 10X العازلة وS1 نوكلياز نوكلياز S1 إلى تركيز النهائي من 100 U لكل 1 ملغ من الحمض النووي، واحتضان لمدة 1 ساعة.
  6. DNA راسب بإضافة 0،1 حجم من 3 خلات الصوديوم و 1 M حجم الأيزوبروبانول في RT.
  7. أجهزة الطرد المركزي في 14000 دورة في الدقيقة لمدة 20 دقيقة في C. ° 4
  8. غسل DNA في الايثانول 70٪، وأجهزة الطرد المركزي في 14،000 دورة في الدقيقة مرة أخرى لمدة 10 دقيقةعند 4 ° C.
  9. الهواء الجاف وحل DNA بيليه في المخزن المؤقت TE.
  10. قياس تركيز الحمض النووي، وتصور من قبل الكهربائي للهلام. عادة كمية من جزيئات DNA النهائية المتكررة يمثل 35-50٪ من المبلغ الأصلي DNA.

3. دقق DNA وصفها

واستخدمت اثنين من بروتوكولات مختلفة لوضع العلامات BAC التحقيق DNA استنساخ وIGS التحقيق rDNA.

3.1 وضع العلامات استنساخ باستخدام نيك BAC-ترجمة

  1. استخراج الحمض النووي BAC استنساخ من مكتبة BAC باستخدام QIAGEN كيت تعبيد كبيرة.
  2. إعداد خليط التفاعل لوضع العلامات نيك الترجمة على الجليد مع الحجم النهائي من 50 ميكرولتر: 1 ميكروغرام معزولة BAC استنساخ DNA، 0.05 ملي كل من dATP الخالي من الملصقات، dCTP، وdGTP و 0.015 ملم dTTP، 1 ميكرولتر من dUTP-Cy3 (أو لآخر ملون تألقي)؛ 0.05 مغ / مل من BSA، 5 ميكرولتر من العازلة 10X نيك الترجمة، 20 U-DNA بوليميراز من الأول، و0،0012 U من الدناز.
  3. احتضان في C ° 15 لمدة 20.5 ساعة.
  4. وقف رد فعل من خلال إضافة 1 ميكرولتر من EDTA M 0.5.
  5. متجر التحقيق في -20 درجة مئوية في مكان مظلم.

3.2 IGS rDNA وضع العلامات باستخدام PCR

  1. إعداد خليط التفاعل على الجليد مع الحجم النهائي من 50 ميكرولتر: 200 نانوغرام من الحمض النووي الجيني؛ 0.05 مم كل من dATP الخالي من الملصقات، dCTP، وdGTP؛ 0،015 ملم dTTP، 1 ميكرولتر من dUTP-Cy3 (أو آخر ملون تألقي) و 5 ميكرولتر من 10X العازلة PCR-و 50 بمول من الأمام؛ الامم المتحدة (GTGTGCCCCTTCCTCGATGT) والعكس؛ GA (CTGGTTTGGTCGGCACGTTT) الاشعال لتضخيم IGS؛ و 10 من البلمرة DNA U طق 14.
  2. أداء PCR تفاعل PCR باستخدام معيار المعلمات لتضخيم IGS: 95 ° C / 5 × 1 دقيقة دورة؛ (95 ° C / 30 ثانية، 50 ° C / 30 ثانية، 72 ° C / 30 ثانية) × 30 دورات، 72 ° C / 5 × 1 دقيقة دورة، و 4 ° C عقد 14.
  3. متجر التحقيق في -20 درجة مئوية في مكان مظلم.

4. الفلورسنت في الموقع التهجين

و Cx. الخماسية والثاني لاستخدام IGS rDNA على الكروموسومات الإنقسامية ل. الغامبية. إذا باستخدام مجسات DNA BAC استنساخ، تخطي الخطوات ريبونوكلياز العلاج 4.3، 4.4، في وقت واحد وخطوة تمسخ الشريحة / 4،19 التحقيق. في حالة استخدام جهاز ضبط انقباضات المعدة rDNA التحقيق، وإعداد خليط التهجين بدون 0 الكسور C DNA ر، وتخطي شريحة منفصلة / التحقيق يبدل طبيعة الخطوات 4.10، 4.11، 4.16، و 4.17.

  1. احتضان الشرائح في SSC 2X لمدة 30 دقيقة عند 37 ° C.
  2. يذوى الشرائح في سلسلة من 70٪، 80٪، 100٪ والإيثانول لمدة 5 دقائق كل في RT، والهواء الجاف. إذا FISH مع أداء BAC استنساخ الحمض النووي، والانتقال مباشرة إلى الخطوة 4.5.
  3. احتضان إعداد كروموسوم في 0.1 ملغ / مل حل ريبونوكلياز تحت parafilm لمدة 30 دقيقة عند 37 درجة مئوية.
  4. يغسل مرتين في SSC 2X لمدة 5 دقائق كل في 37 ° C.
  5. وضع الشرائح طNA جرة مع البيبسين 0.01٪ و 0.037٪ حل حمض الهيدروكلوريك، واحتضان لمدة 5 دقائق عند 37 ° C.
  6. غسل الشرائح في برنامج تلفزيوني 1X لمدة 5 دقائق في RT.
  7. إصلاح إعداد كروموسوم في جرة مع الفورمالين 1٪ في برنامج تلفزيوني 1X المحضرة من 10٪ محايدة مخزنة الفورمالين لمدة 10 دقيقة في RT.
  8. غسل الشرائح في برنامج تلفزيوني 1X لمدة 5 دقائق في RT.
  9. يذوى الشرائح في سلسلة من 70٪، 80٪، 100٪ والإيثانول لمدة 5 دقائق كل في RT، والاستعدادات الهواء الجاف في 37 ° C. إذا FISH مع أداء IGS، تابع مباشرة إلى الخطوة 4،12
  10. تفسد الشرائح في وعاء مع prewarmed الفورماميد 70٪ لمدة 2 دقيقة في 72 ° C.
  11. يذوى في سلسلة من الشرائح الباردة (-20 ° C) 70٪، 80٪، 100٪ والإيثانول لمدة 5 دقائق لكل منهما، والهواء الجاف في 37 ° C.
  12. إعداد خليط التهجين: 5 ميكرولتر من الحمض النووي المسمى التحقيق من الخطوة 3 و 10 ميكرولتر من الحمض النووي ر C 0 من الخطوة 2 مع تركيز النهائي من 0.5 ميكرولتر نانوغرام / ميكرولتر، و 5 من 1 ميكروغرام / ميكرولتر الحمض النووي الحيوانات المنوية السلمون sonicated للأسماك مع IGS rDNA، وإعدادخليط التهجين بدون 0 الكسور C DNA ر.
  13. DNA راسب بإضافة 0،1 حجم من 3 خلات الصوديوم M و 2 مجلدات من الايثانول. تبقي في -20 درجة مئوية لمدة ساعة 1-3.
  14. الطرد المركزي في 14000 دورة في الدقيقة عند 4 درجة مئوية لمدة 20 دقيقة، وإزالة الايثانول، والهواء الجاف بيليه في RT.
  15. حل شامل لبيليه في 10 ميكرولتر من العازلة التهجين: 50٪ الفورماميد، كبريتات ديكستران 20٪، 2X SSC إذا FISH مع أداء IGS، تابع مباشرة إلى الخطوة 4،18
  16. تفسد خليط التهجين لمدة 7 دقائق عند 97 ° C، وعلى الفور وضعت على الثلج لمدة 1 دقيقة.
  17. Prehybridize خليط في C ° 37 لمدة 30 دقيقة لمنع التهجين غير محددة من الحمض النووي المتكررة إلى الكروموسومات.
  18. وضع 10 ميكرولتر من خليط التهجين على الشريحة، وتغطي مع غطاء 22x22 زلة. منع تشكيل فقاعة - يجب إزالة فقاعات الهواء مع ضغط لطيف على ساترة إذا FISH مع أداء DNA استنساخ BAC، تابع مباشرة إلى الخطوة 4،20 <./ م>
  19. تفسد التحقيق وDNA كروموسوم وقت واحد باستخدام كتلة التدفئة بنسبة 75 درجة مئوية لمدة 5 دقائق.
  20. زلة غطاء الغراء حول محيط باستخدام الاسمنت والمطاط.
  21. أداء التهجين بين عشية وضحاها في غرفة الرطبة في 37 ° C.
  22. إزالة الاسمنت والمطاط ساترة من الشريحة.
  23. غسل الشريحة 2 دقيقة في محلول prewarmed 1 (0.4x SSC، 0.3٪ Nonidet-P40) في C. ° 73
  24. غسل الشرائح في الحل 2 (2X SSC، 0.1٪ Nonidet-P40) لمدة 5 دقائق في RT.
  25. ملون مباين الشريحة باستخدام 0.001 ملم YOYO-1 في برنامج تلفزيوني 1X لمدة 10 دقيقة في غرفة الرطبة في RT.
  26. جبل في كمية صغيرة من الذهب إطالة كاشف antifade مع زلة غطاء.
  27. تحليل المستحضرات تحت المجهر الفلورسنت باستخدام مجموعات التصفية المناسبة في التكبير X 1،000 (الشكل 4).

5. ممثل النتائج

وتقع الحشرات معرفات في كل جزء من اليرقة. اعتمادا على الموقف، الإرنست و يونغ تتحول إلى أنسجة مختلفة في مرحلة الكبار من الحشرات. معرفات، والتي تستخدم لإعداد كروموسوم في هذا البروتوكول، تتطور إلى الساقين في مرحلة الكبار من البعوض. وتقع هذه المعرفات في الجانب البطنية من الصدر واليرقات هي واضحة للعيان من خلال بشرة تحت المجهر (الشكل 1). في المرحلة المبكرة ال 4 الطور اليرقي، معرفات لها شكل دائري (الشكل 1A). أكبر عدد من الانقسام، وتراكمت ~ 175 في هوية واحدة في مرحلة "بيضاوية الشكل" في وقت لاحق (1B الشكل)، والتي يجب أن يتم النظر في المرحلة المثلى لإعداد الشرائح. في هذا الوقت، معرف المتوسطة تنقسم إلى اثنين: واحد يتحول إلى الساق وبعضها البعض يتحول إلى الجناح. نحن نفضل استخدام معرفات الساق كبيرة في مرحلة "بيضاوية الشكل" لكروموسوم إعداد الشرائح. الشكل 1C يمثل معرفات في المرحلة الأخيرة من 4 اليرقة الطور التنمية ال. في هذه المرحلة، علىوضعت بالفعل معرفات في الأرجل والأجنحة، وتحتوي على كمية كبيرة من الأنسجة المتمايزة وعدد قليل من الانقسام. وينبغي تجنب هذه المرحلة من التنمية ID لإعداد الشريحة كروموسوم. نوصي أيضا تربية يرقات البعوض في درجات حرارة منخفضة: 16 ° C لالزاعجة والكيولكس C و 22 ° لالأنوفيلة وهذا يساعد على زيادة كمية الانقسام في معرفات 9.

الشكل 2 يوضح تشريح ID من القفص الصدري من 4 ال اليرقة الطور. لأن بشرة من الحشرات الحية من الصعب تشريح، نوصي باستخدام مقص تشريح بدلا من الإبر تستخدم عادة لإعداد اليرقة. الإجراء الأكثر أهمية للحصول على نوعية عالية إعداد كروموسوم هو العلاج الحل ناقص التوتر. للحصول على أفضل النتائج، ونحن إزالة الأمعاء والدهون في الجسم من الصدر اليرقات قبل هذا العلاج. تورم في خلايا ID خلال هذا الإجراء يساعد على انتشار كروموسومق على شريحة (الشكل 3A). يمكن نوعية مناسبة من العلاج المعترف بها حل ناقص التوتر بسهولة من قبل شكل دائري من الخلايا في الأعمال التحضيرية (الشكل 3A، B). الخلايا شكل بيضاوي مع عدم كفاية العلاج تشير إلى حل ناقص التوتر (الشكل 3C). التي سيتم اختيارها للأسماك، وينبغي أن تحتوي على كروموسوم إعداد لا يقل عن 50 كروموسوم ينتشر عالية الجودة. عادة، ~ 90٪ من الشرائح إعدادها باستخدام هذا البروتوكول ذات جودة كافية للأسماك 9.

نقدم بروتوكولين FISH مختلفة قليلا: بروتوكول المتقدمة للأسماك باستخدام DNA الجيني استنساخ BAC التحقيق في الكروموسومات الإنقسامية من الزاعجة والكيولكس وبروتوكول FISH بسيطة لIGS rDNA التحقيق في الكروموسومات الإنقسامية من الأنوفيلة. والجينوم من الزاعجة والكيولكس هي تكرار للغاية بسبب كثرة عدد العناصر القابلة للنقل و7،8. وهكذا، FISH أداء، والذي التحريرilizes الجيني DNA استنساخ BAC باعتباره التحقيق، يتطلب إضافة الكسور غير المسماة DNA المتكررة إلى التحقيق لمنع التهجين غير محددة من الحمض النووي لتكرار الكروموسومات. لاستخراج DNA الكسور المتكررة، والتشويه والتحريف الحمض النووي الجيني في 120 درجة مئوية لمدة 2 دقيقة. DNA الغليان عند درجة حرارة عالية كما يساعد على الحصول على الحمض النووي في أجزاء تصل إلى 200-500 سنة مضت. يسمح DNA لreassociate بعد هذا العلاج. شظايا الحمض النووي المتكررة للغاية للعثور على رفيقة تميل من أجل إعادة الترابط أسرع من الحمض النووي مع تسلسل فريد لا. ونتيجة لذلك، فإن إعادة الترابط من الحمض النووي يتبع منحنى C 0 ر X C 0 حيث هو تركيز الأولي من احد الذين تقطعت بهم السبل الحمض النووي، وهذه هي المرة ر reannealing. وتعتبر 10-1 أو 100-102 معتدل للغاية والمتكررة، على التوالي - كسور DNA مع القيم C 0 ر يساوي 10-4. ويمكن حساب وقت إعادة الترابط لمختلف أجزاء DNA C 0 ر باستخدام اله الصيغة T = C 0 ر X × 4،98 / C حيث t - وقت الحضانة، C 0 ر X - C جزء ر 0 (C0t 1 = 1، C 0 ر 2 = 2، الخ) وC 0 - الأولي في تركيز الحمض النووي ميكروغرام / ميكرولتر 15 (الجدول 1). بعد إعادة الترابط، هضم الحمض النووي واحد الذين تقطعت بهم السبل باستخدام نوكلياز S1. نحن نفضل استخدام جميع DNA C T 0 الكسور تصل إلى C 0 ر 3 معا بدلا من يشيع استخدامها C 0 ر DNA جزء 1. هذه الكسور ر 0 C وتشمل بعض تسلسل الحمض النووي المتكررة معتدلة وسوية تمثل عادة 35-50٪ من المبلغ الأصلي للالحمض النووي الجيني في AE. بعوض. نسبة الصحيح بين التحقيق DNA المسمى DNA والخالي من الملصقات C ر 0 جزء يعتمد على عنصر DNA المتكررة في كل استنساخ BAC معينة. في المتوسط، ونحن نستخدم 1:20 التحقيق لC 0 رDNA نسبة الكسر للحصول على إشارات مقبولة / نسبة خلفية نتيجة FISH. Prehybridization من التحقيق مع 0 كسور DNA DNA C ر في أنبوب لمدة 30 دقيقة قبل التهجين الفعلية على الشريحة يساعد أيضا على تقليل الخلفية. يتم تنفيذ وضع العلامات، التهجين في حد ذاته، والغسيل في هذا البروتوكول باستخدام الظروف القياسية 12.

نتائج FISH اثنين من مختلف المسمى DNA استنساخ تحقيقات BAC على الكروموسومات الإنقسامية من AE. وتظهر بعوض والخماسية معادل. 4A في الأرقام وB على التوالي. وDNA استنساخ تحقيقات BAC إنتاج إشارات قوية في موقف واحد على الكروموسومات. وcounterstained الكروموسومات هو موضح في الشكل 1 مع يوديد-1 YOYO. هذه الصبغة تنتج أنماط أفضل النطاقات على AE. الكروموسومات بعوض 9. وبدلا من ذلك، يمكن أن تستخدم الأصباغ الفلورية الأخرى، مثل يوديد أو دابي propidium، لاله كروموسوم counterstaining. لقمع photobleaching من الشرائح، ونحن نستخدم الذهب إطالة المتوسطة antifade المتزايدة. هذا كاشف له قدرات جيدة والحفاظ إشارة أيضا يمكن إزالتها بسهولة من الشريحة وذلك بدهن في برنامج تلفزيوني 1X إذا كان من الضروري استخدام نفس الشريحة لعدة التهجين.

تم تصميم نسخة بسيطة من البروتوكول FISH لتهجين من IGS rDNA التحقيق في الكروموسومات الإنقسامية من الأنوفيلة. يتم تمثيل الجينات الريباسي في الأنوفيلة كمجموعة متعددة الأشكال من الجينات الموجودة على الكروموسومات الجنسية 16. هو المسمى DNA A التحقيق في هذا البروتوكول باستخدام معيار PCR تفاعل بإضافة fluorescently المسمى Cy3 أو Cy5 dNTPs. لأن منع التهجين غير محددة من الحمض النووي المتكررة في كروماتين حقيقي ليست هناك حاجة، يتم حذف جميع الخطوات المتعلقة باستخدام C DNA T 0 الكسور. بدلا من ذلك، يتم التحضير كروموسوم سابقة التجهيز مع ريبونوكلياز لمنع التهجين لجنة التحقيق rDNA IGS إلىالنوية. والتشويه والتحريف الكروموسومات والحمض النووي التحقيق في وقت واحد عن طريق تسخين الشريحة جنبا إلى جنب مع تحقيق في نظام التهجين في C ° 75 لل5 دقائق. كما يتم تنفيذ التهجين والغسيل في هذا البروتوكول باستخدام الظروف القياسية للأسماك 12. وأظهرت نتيجة FISH في الشكل 4C: تعدد الأشكال من التهجين بين rDNA IGS اثنين من الكروموزومات العاشر مرئيا بوضوح.

0 ر 3
تركيز الحمض النووي ميكروغرام / ميكرولتر Reannealing الوقت، دقيقة
C 0 ر 2 0.1 100
0.3 33
0.5 20
0.7 14
0.9 11
1 10
0.1 150
0.3 50
0.5 30
0.7 21
0.9 17
1 15

الجدول تركيز الحمض النووي 1. والأوقات reannealing لإعداد C 0 C 0 T2 والكسور T3.

الشكل 1
الشكل 1 مراحل تطور ID في 4 الطور عشر يرقة: أ) "الشكل مستدير" المرحلة المبكرة؛ ب) "بيضاوية الشكل" وسيطة المرحلة - الأمثل لإعداد كروموسوم؛ C) مرحلة متأخرة - غير لائق للتحضير كروموسوم. . يشار إلى مواقف معرفات من الأسهم على الجانب البطنية من الصدر اليرقات.

الشكل 2
الشكل 2 خطوات تشريح ID: A يرقة) مقطوعة الرأس (يشار إلى اتجاه تخفيضات من السهام)؛ B) يرقات مع القناة الهضمية تشريح تحت العلاج الحل ناقص التوتر (معرفات تنتفخ وتصبح غير مرئية تقريبا)؛ C) يرقة بعد تطبيق الحل Carnoy ل(. معرفات تصبح بيضاء واضحة للعيان)؛ D) تشريح معرفات في حل Carnoy ل. يشار إلى مواقف معرفات في يرقة من العلامات النجمية.

الشكل 3
الشكل 3 نوعيات مختلفة من الكروموسوم ينتشر: A) انتشار كروموسوم الكمال - شكل دائري من الخلايا يوضح العلاج الكافي للمعرفات في حل ناقص التوتر، B) لعلاج الكمال ناقص التوتر - الكروموسومات هي undersquashed قليلا؛ C) انتشار كروموسوم الفقراء. - نتيجةيشار إلى العلاج ناقص التوتر غير كافية بيضاوية الشكل من الخلايا.

الشكل 4
الشكل 4. مثال على FISH مع الحيوانات المستنسخة BAC (A، B) وIGS rDNA (C) في الكروموزومات من AE. بعوض (A)، CX. الخماسية (B)، و. الغامبية (C). 1 و 2 و 3 - أعداد من الكروموسومات؛ X - أنثى كروموسوم الجنس في آن. الغامبية.

Discussion

تم إجراء Nonfluorescent في الموقع التهجين على الكروموسومات الإنقسامية من البعوض للمرة الأولى في عام 1990 من قبل A. كومار وK. راي 17. في تلك الدراسة، 18S 28S والجينات DNA الريباسي، المستنسخة البلازميد معا في واحدة، وضعت إلى الكروموسومات من 20 نوعا من البعوض. وصفت بالإشعاع التحقيق DNA والكروموسومات إلى تهجين من العقد الدماغ. بين أجناس البعوض الثلاثة، وقد تم تطوير تقنية FISH فقط للكروموسومات الإنقسامية من خط الخلية من AE. لم يكن بعوض 10،18،19 والتي أجريت على الكروموسومات الإنقسامية من البعوض الحية. في الآونة الأخيرة، وضعنا بسيطة، تقنية قوية للحصول على التحضير كروموسوم عالية الجودة من معرفات من 4 ال يرقات الطور 9. هذا الأسلوب يسمح حصل على عدد كبير من الصبغيات (الكروموسومات) في شريحة واحدة، ويمكن استخدامها عالميا لجميع الأنواع من البعوض. ضرورة استخدام اليرقات ستا فقط، وليس العذراء أو الكبارغيس من البعوض، لإعداد الشريحة وربما كان القيد الوحيد للأسلوب. تم تحسين طريقة FISH باستخدام معيار 12 لاستنساخ الجينوم BAC وrDNA IGS كما تحقيقات لمن الكروموسومات الإنقسامية الزاعجة، الكيولكس، والأنوفيلة.

وبالإضافة إلى هذه تطبيقات محددة، ويمكن أيضا البروتوكولات FISH موضح هنا أن تستخدم لأغراض أخرى. ويمكن أيضا للبروتوكول FISH المتقدمة، والتي تستخدم C DNA T 0 كسور غير محددة من أجل الحيلولة دون التهجين، يمكن تطبيق لتهجين الحيوانات المستنسخة من BAC أو أي شظايا الحمض النووي في مناطق واسعة من heterochromatic الأنوفيلة. يتم إثراء المناطق القابلة للنقل وHeterochromatic مع عناصر أخرى ويكرر، وتحقيقات من هذه المناطق تنتج عادة خلفية قوية على الكروموسومات 3. وباستخدام DNA غير المسماة C T 0 الكسور يساعد على الحد من التهجين غير محدد من التحقيق إلى الكروموسومات. النسخة البسيطة من العلاقات العامة FISHويمكن استخدام otocol لأي تحقيقات أو rDNA DNA المتكررة على الكروموسومات الإنقسامية من البعوض والحشرات الأخرى. وبالإضافة إلى ذلك، فإنه يمكن أيضا أن تطبق لتهجين الحمض النووي استنساخ BAC في الأنواع ذات المحتوى المنخفض من DNA المتكررة في مناطق الكروماتين الحقيقي مثل ذبابة الفاكهة أو الأنوفيلة. والبروتوكول المقترح هنا للحصول على مساعدة للغاية، أنصاف جمعيات الجينوم الكروموسوم القائم للبعوض، ويمكن استخدامها على نطاق واسع لتطبيقات مختلفة في خلوي مجموعات أخرى من الحشرات.

Disclosures

الإعلان عن أي تضارب في المصالح.

Acknowledgments

نشكر سيرجي ديمين وKaramysheva تاتيانا لمساعدتهم في إعداد كروموسوم FISH وعلى الأنوفيلة. كما نشكر ديفيد سيفرسون لتزويدنا الزاعجة والكيولكس الجيني DNA BAC استنساخ وواد ميليسا لتحرير النص. وأيد هذا العمل من قبل اثنين من المنح المقدمة من المعاهد الوطنية للصحة: ​​1R21-01 AI88035 لماريا V. Sharakhova و1R21 AI094289-01 لايجور V. Sharakhov.

Materials

Name Company Catalog Number Comments
MZ6 Leica stereomicroscope Leica VA-OM-E194-354 A different stereomicroscope can be used
Olympus CX41 phase microscope Olympus CX41 A different phase microscope can be used
Olympus BX61 fluorescent microscope Olympus BX61 A different fluorescent microscope can be used
ThermoBrite Slide Denaturation/Hybridization System Abbott Molecular 30-144110 Serves as a heating block and a humid chamber
Dissecting needles Fine ScienceTools 10130-10
Needle holders Fine Science Tools 26018-17
Dissecting scissors Fine Science Tools 15000-03
75x25 double frosted micro slides Corning 2949-75x25
22x22 mm microscope coverslips Fisher Scientific 12-544-10
Parafilm Fisher Scientific 13-374-10
Rubber Cement Fisher Scientific 50-949-105
Acetic acid Fisher Scientific A491-212
Alcohol 200 Proof Decon Laboratories 2701
Propionic acid Sigma-Aldrich 402907
Hydrochloric acid Fisher Scientific A144-500
Sodium citrate dihydrate Fisher Scientific S279-500
Sodium acetate trihydrate Fisher Scientific BP334-500
Potassium chloride Fisher Scientific BP366-500
EDTA Fisher Scientific S311-500
Tris base Fisher Scientific BP152-1
10x PBS Invitrogen P5493
10% NBF (neutral buffered formalin) Sigma-Aldrich HT501128
99% formamide Fisher Scientific BP227500
Dextran sulfate sodium salt Sigma-Aldrich D8906
20x SSC buffer Invitrogen AM9765
1 mM YOYO-1 iodide (491/509) solution Invitrogen Y3601
Antifade Prolong Gold reagent Invitrogen P36930
dATP, dCTP, dGTP, dTTP Fermentas R0141, R0151, R0161, R0171
Cy3-dUTP, Cy5-dUTP GE Healthcare PA53022, PA55022
BSA Sigma-Aldrich A3294
DNA Polymerase I Fermentas EP0041
DNase I Fermentas EN0521
S1 Nuclease Fermentas EN0321
Taq DNA Polymerase Invitrogen 18038-042
RNase Sigma-Aldrich 9001-99-4
Pepsin USB 9001-75-6
Salmon sperm DNA Sigma-Aldrich D7656
Nonidet-P40 (NP40) US Biological NC9375914
Qiagen Blood and Cell Culture Maxikit Qiagen 13362
Qiagen Large Construct Kit Qiagen 12462

DOWNLOAD MATERIALS LIST

References

  1. Sharakhov, I. V., Sharakhova, M. V. Chromosome Mapping Research Developments. Verrity, J. F., Abbington, L. E. Nova Science Publishers, Inc. (2008).
  2. Holt, R. A., et al. The genome sequence of the malaria mosquito Anopheles gambiae. Science. 298, 129-149 (2002).
  3. Sharakhova, M. V., et al. Update of the Anopheles gambiae PEST genome assembly. Genome biology. 8, R5 (2007).
  4. Campos, J., Andrade, C. F., Recco-Pimentel, S. M. A technique for preparing polytene chromosomes from Aedes aegypti (Diptera, Culicinae). Memorias do Instituto Oswaldo Cruz. 98, 387-390 (2003).
  5. Campos, J., Andrade, C. F., Recco-Pimentel, S. M. Malpighian tubule polytene chromosomes of Culex quinquefasciatus (Diptera, Culicinae). Memorias do Instituto Oswaldo Cruz. 98, 383-386 (2003).
  6. McAbee, R. D., Christiansen, J. A., Cornel, A. J. A detailed larval salivary gland polytene chromosome photomap for Culex quinquefasciatus (Diptera: Culicidae) from Johannesburg, South Africa. J. Med. Entomol. 44, 229-237 (2007).
  7. Nene, V., et al. Genome sequence of Aedes aegypti, a major arbovirus vector. Science. 316, 1718-1723 (2007).
  8. Arensburger, P., et al. Sequencing of Culex quinquefasciatus establishes a platform for mosquito comparative genomics. Science. 330, 86-88 (2010).
  9. Sharakhova, M. V., et al. Imaginal discs--a new source of chromosomes for genome mapping of the yellow fever mosquito Aedes aegypti. PLoS neglected tropical diseases. 5, e1335 (2011).
  10. Brown, S. E., et al. Toward a physical map of Aedes aegypti. Insect Mol. Biol. 4, 161-167 (1995).
  11. Steiniger, G. E., Mukherjee, A. B. Insect chromosome banding: technique for G- and Q-banding pattern in the mosquito Aedes albopictus. Can. J. Genet. Cytol. 17, 241-244 (1975).
  12. Garimberti, E., Tosi, S. Fluorescence in situ hybridization (FISH). Bridger, J. M., Volpi, E. V. Springer Science and Business Media. (2010).
  13. Methods in Anopheles Research [Internet]. The Malaria Research and Reference Reagent Resource Center. Atlanta, GA. Available from: http://www.mr4.org/Portals/3/Pdfs/ProtocolBook/MethodsAnophelesResearchV4c.pdf (2007).
  14. Scott, J. A., Brogdon, W. G., Collins, F. H. Identification of single specimens of the Anopheles gambiae complex by the polymerase chain reaction. The American journal of tropical medicine and hygiene. 49, 520-529 (1993).
  15. Trifonov, V. A., Vorobyeva, N. N., Rens, W. Fluorescence in situ hybridization (FISH). Leiehr, T. Spriger-Verlag. (2009).
  16. Collins, F. H., et al. A ribosomal RNA gene probe differentiates member species of the Anopheles gambiae complex. The American journal of tropical medicine and hygiene. 37, 37-41 (1987).
  17. Kumar, A., Rai, K. S. Chromosomal localization and copy number of 18S+28S ribosomal RNA genes in evolutionary diverse mosquitoes (Diptera, Culicidae). Hereditas. 113, 277-289 (1990).
  18. Brown, S. E., Knudson, D. L. FISH landmarks for Aedes aegypti chromosomes. Insect Mol. Biol. 6, 197-202 (1997).
  19. Brown, S. E., Severson, D. W., Smith, L. A., Knudson, D. L. Integration of the Aedes aegypti mosquito genetic linkage and physical maps. Genetics. 157, 1299-1305 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics