Fluorescent

Immunology and Infection
 

Summary

Parmi les trois genres de moustiques, à savoir

Cite this Article

Copy Citation | Download Citations

Timoshevskiy, V. A., Sharma, A., Sharakhov, I. V., Sharakhova, M. V. Fluorescent in situ Hybridization on Mitotic Chromosomes of Mosquitoes. J. Vis. Exp. (67), e4215, doi:10.3791/4215 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Hybridation fluorescente in situ (FISH) est une technique couramment utilisée par de nombreux laboratoires pour déterminer la position chromosomique de sondes d'ADN et d'ARN. Une application importante de cette méthode est le développement de la haute qualité des cartes physiques utiles pour améliorer les assemblages génome pour divers organismes. La tendance naturelle des bandes des chromosomes polytènes et mitotique fournit des indications pour la commande précise et l'orientation des supercontigs génomiques. Parmi les trois genres de moustiques anophèles, à savoir, Aedes, et Culex, une technique bien établie basée sur la cartographie de chromosomes a été développé uniquement pour les Anopheles, dont les membres possèdent des chromosomes polytènes lisibles 1. En raison de travaux de cartographie du génome, 88% de l'An. gambiae génome a été placé à des postes précis du chromosome 2,3. Deux genres de moustiques du genre Aedes, autres et Culex, ont mal polytenized b chromosomesarce que la surreprésentation significative des éléments transposables dans leurs génomes 4, 5, 6. Seulement 31 et 9% des supercontings génomiques ont été attribués sans ordre ou l'orientation des chromosomes de Ae. aegypti 7 et Cx. quinquefasciatus 8, respectivement. Préparation des chromosomes mitotiques pour ces deux espèces avaient déjà été limitée aux ganglions du cerveau et des lignées cellulaires. Toutefois, des lames de chromosomes préparés à partir des ganglions du cerveau de moustiques contiennent généralement un faible nombre de plaques métaphasiques 9. En outre, même si une technique FISH a été développé pour les chromosomes mitotiques provenant d'une lignée cellulaire d'Ae. aegypti 10, l'accumulation de multiples réarrangements chromosomiques dans les chromosomes de lignées cellulaires 11 rend inutiles pour la cartographie du génome. Nous décrivons ici une technique simple et robuste pour obtenir de haute qualité des préparations de chromosomes mitotiques de disques imaginaux (ID) de 4 e stade larvaire qui cPeut être utilisé pour les trois genres de moustiques. Un protocole standard de 12 FISH est optimisé pour l'utilisation de clones BAC de l'ADN génomique comme une sonde sur les chromosomes mitotiques de Ae. aegypti et Culex. quinquefasciatus, et d'utiliser un espaceur intergénique (IGS) de l'ADN ribosomique (ADNr) comme sonde sur un. chromosomes gambiae. Outre la cartographie physique, la technique développée peut être appliquée à la cytogénétique populations et la taxonomie des chromosomes / systématique de moustiques ou d'autres insectes et les groupes.

Protocol

1. Préparation des chromosomes

Les larves de moustiques ont été élevés en utilisant un protocole standard décrit dans Methods in Anopheles de recherche disponible sur le site Web de la recherche sur le paludisme et le Centre de ressources de référence Réactif (MR4) 13. Les températures de l'élevage de moustiques ont été modifiés afin de fournir le plus grand nombre de chromosomes dans les disques imaginaux et le plus bas de mortalité des larves. Les stades de développement des larves de moustiques ont été déterminés sur la base des tailles de leurs capsules céphaliques 13.

  1. Hatch oeufs de moustiques à 28 ° C, et après 2-3 jours, le transfert de 2 ème ou 3 ème stade larvaire à 16 ° C pour Ae. aegypti et Culex. quinquefasciatus et à 22 ° C pour un. gambiae.
  2. Lieu larves 4 e stade larvaire sur la glace pendant plusieurs minutes d'immobilisation.
  3. Transfert larve sur une lame avec une goutte de solution hypotonique froid (0,5% sicitrate dium ou 0,075 M de chlorure de potassium), et le placer sous le microscope stéréo.
  4. Sélectionnez larve avec des ID ovales (figure 1B) pour la dissection plus loin.
  5. Décapitez larve, et couper la cuticule de la face ventrale du thorax des larves avec des ciseaux à dissection (figure 2A). Assurez réduction supplémentaire de segment abdominal deuxième ou troisième à disséquer l'intestin de la larve. Les directions des coupes sont indiquées par des flèches.
  6. Ouvrez la cuticule, et enlever l'intestin et de graisse du corps de la larve. Retirer la solution hypotonique de la lame à l'aide de papier filtre, et ajoutez une nouvelle goutte de solution hypotonique directement à l'ID (figure 2B). Gardez larve dans une solution hypotonique pendant 10 min à température ambiante.
  7. Retirer solution hypotonique à l'aide de papier filtre, et appliquer la solution de Carnoy (éthanol / acide acétique dans un rapport 3:1). Après avoir ajouté la solution de fixation, tournez immédiatement identifiants blanc et deviennent facilement visibles au microscope (figure 2C
  8. Utilisation d'aiguilles de dissection, retirez les identifiants de la larve (figure 2D), et de les transférer à une goutte d'acide propionique à 50%. Retirez tous les autres tissus, tels que l'intestin et de graisse corporelle, de la diapositive. Couvrir avec un ID lamelle 22x22 unsiliconized, et gardez pendant 10 min à température ambiante.
  9. Recouvrir la lame avec du papier filtre, et de squash le tissu en appuyant sur la gomme d'un crayon sur le pourtour de la lamelle.
  10. Analyser brièvement la qualité de la lame à l'aide du microscope à contraste de phase 100x à 200x de grossissement ou (Figure 3). Préparations à> 50 étalements de chromosomes peut être considéré comme convenable pour les poissons.
  11. Trempez et maintenez la lame dans de l'azote liquide jusqu'à ce qu'il s'arrête bouillonnant. Retirer la lamelle de la lame à l'aide d'une lame de rasoir, et de transférer immédiatement la lame dans un conteneur de 70% d'éthanol refroidi à -20 ° C. Conserver à 4 ° C pendant au moins 1 heure pour le meilleur résultat déshydratation (si besoin, les lames peuvent être stockées à l'instant tsa démarche de quelques minutes à plusieurs jours).
  12. Déshydrater les lames dans une série d'éthanol (70%, 80%, 100%) à 4 ° C pendant 5 min chacun, et de l'air sec à température ambiante.
  13. Stockez lames sèches à -20 ° C avant de les utiliser pour les poissons.

2. Extraction des fractions d'ADN répétitives

Exécution de la sonde FISH ADN de BAC clone sur les chromosomes de Ae. aegypti et Culex. quinquefasciatus nécessite l'utilisation non étiquetés fractions d'ADN répétitives de bloquer l'hybridation non spécifique des répétitions d'ADN dans les chromosomes. La réassociation d'ADN simple brin fragmenté en morceaux de quelques centaines de paires de bases suit une courbe C 0 t où C 0 est la concentration initiale en ADN simple brin et t est le temps de ré-hybridation. Fractions d'ADN avec des valeurs C0T égale à 10 -4 -10 -1 ou 10 ° -10 2 sont considérées comme hautement et moyennement répétitif, respectivement.

  1. Extrait 400-500 pg de l'ADN génomique du moustique adulte entière à l'aide de sang Qiagen et Maxikit culture cellulaire, et de préparer 100-1000 ng / ul solution d'ADN dans 1,2 x SSC.
  2. ADN dénaturer en plaçant un tube en sécurité à verrouillage avec l'ADN génomique dans un bloc de chauffage préchauffé à 120 ° C pendant 2 min. À haute température permet de varier l'ADN en fragments pb 200-500.
  3. En fonction de la concentration d'ADN, l'ADN se réassocier en plaçant le tube à 60 ° C pendant 15-150 min pour obtenir des fractions d'ADN C 0 t 0 C jusqu'à t3 (tableau 1).
  4. Placer le tube avec de l'ADN sur de la glace pendant 2 min.
  5. Transfert de l'ADN à 42 ° C, ajouter préchauffé 10x nucléase S1 tampon et la nucléase S1 à une concentration finale de 100 U par 1 mg d'ADN, et incuber pendant 1 heure.
  6. ADN précipité par addition de 0,1 volume d'acétate de sodium 3 M et 1 volume d'isopropanol à température ambiante.
  7. Centrifuger à 14000 rpm pendant 20 min à 4 ° C.
  8. Laver l'ADN dans l'éthanol à 70%, et centrifuger à nouveau à 14000 rpm pendant 10 minà 4 ° C.
  9. Sécher à l'air et se dissolvent culot d'ADN dans un tampon TE.
  10. Mesurer la concentration de l'ADN, et de visualiser par électrophorèse sur gel. Habituellement, la quantité finale de fractions d'ADN répétitives représente 35-50% de la quantité d'ADN d'origine.

3. ADN sonde de marquage

Deux protocoles différents ont été utilisés pour l'étiquetage clone BAC sonde d'ADN et l'IGS ADNr sonde.

3,1 étiquetage clone BAC en utilisant nick-translation

  1. Extraire l'ADN clone BAC de la banque de BAC en utilisant le kit Qiagen Construct Grand.
  2. Préparez le mélange de réaction pour le pseudo-traduction étiquetage sur la glace avec un volume final de 50 ul: 1 pg d'ADN isolé clone BAC, 0,05 mM de chacun des unlabeled dATP, dCTP et dGTP et 0,015 mM de dTTP, 1 pl de Cy3-dUTP (ou un autre fluorochrome); 0,05 mg / ml de BSA, 5 ul de 10x nick-translation tampon, 20 U d'ADN-polymérase I, et 0,0012 U de DNase.
  3. Incuber à 15 ° C pendant 20,5 h.
  4. Arrêter la réaction en ajoutant 1 ul d'EDTA 0,5 M.
  5. Sonde Conserver à -20 ° C dans un endroit sombre.

IGS 3,2 ADNr étiquetage par PCR

  1. Préparez le mélange de réaction sur de la glace avec un volume final de 50 pl: 200 ng d'ADN génomique, 0,05 mM chacun des unlabeled dATP, dCTP et dGTP; 0,015 mm de dTTP, 1 pl de Cy3-dUTP (ou un autre fluorochrome), 5 pl d' 10x PCR-tampon; 50 pmol de l'avant; Nations Unies (GTGTGCCCCTTCCTCGATGT) et marche arrière, GA (CTGGTTTGGTCGGCACGTTT) des amorces pour l'amplification IGS et 10 U de Taq ADN polymérase 14.
  2. Effectuer réaction de PCR utilisant des paramètres de la PCR pour l'amplification IGS: 95 ° C / 5 min x 1 cycle; (95 ° C / 30 sec, 50 ° C / 30 sec, 72 ° C / 30 sec) x 30 cycles 72 ° C; / 5 min x 1 cycle, et 4 ° C détiennent 14.
  3. Sonde Conserver à -20 ° C dans un endroit sombre.

4. Hybridation in situ fluorescente

et Culex. quinquefasciatus et le second pour l'utilisation de l'IGS sur les chromosomes mitotiques ADNr d'An. gambiae. Si vous utilisez des sondes d'ADN clones BAC, sauter les étapes du traitement RNase 4.3, 4.4 et simultanée étape de dénaturation coulissant / sonde 4.19. Si vous utilisez IGS ADNr sonde, préparer le mélange d'hybridation sans C 0 t fractions d'ADN, et passez lame séparée / sonde dénaturation étapes 4.10, 4.11, 4.16, et 4.17.

  1. Incuber les lames dans du SSC 2X pendant 30 min à 37 ° C.
  2. Déshydrater les lames en série de 70%, 80%, et de l'éthanol à 100% pendant 5 min à chaque fois à température ambiante, et l'air sec. Si vous effectuez FISH avec le BAC clone d'ADN, passez directement à l'étape 4.5.
  3. Incuber préparation chromosomique de 0,1 mg / ml de RNase solution sous parafilm pendant 30 min à 37 ° C.
  4. Laver deux fois dans 2x SSC pendant 5 min chacune à 37 ° C.
  5. Mettez diapositives ina pot avec de la pepsine 0,01% et 0,037% d'une solution de HCl, et incuber pendant 5 minutes à 37 ° C.
  6. Laver les lames dans du 1x PBS pendant 5 min à température ambiante.
  7. Fixer préparation des chromosomes dans un bocal avec 1% de formol dans du PBS 1x préparé à partir de 10% du formol tamponné neutre pendant 10 min à température ambiante.
  8. Laver les lames dans du 1x PBS pendant 5 min à température ambiante.
  9. Déshydrater les lames en série de 70%, 80%, et de l'éthanol à 100% pendant 5 min à chaque fois à température ambiante, et les préparatifs d'air sec à 37 ° C. Si vous effectuez FISH avec IGS, passez directement à l'étape 4.12
  10. Diapositives dénaturer dans un bocal avec du formamide 70% préchauffé pendant 2 min à 72 ° C.
  11. Déshydrater lames en série de froid (-20 ° C) 70%, 80%, et de l'éthanol 100% pendant 5 min chacun, et de l'air sec à 37 ° C.
  12. Préparer le mélange d'hybridation:. 5 pl de l'ADN sonde marquée à partir de l'étape 3, 10 ul d'ADN C 0 t à partir de l'étape 2 avec une concentration finale de 0,5 pi ng / pl et 5 de 1 pg / pl d'ADN de sperme de saumon soniqué pour les poissons IGS ADNr, préparersans mélange d'hybridation C 0 t fractions d'ADN.
  13. ADN précipité par addition de 0,1 volume d'acétate de sodium 3 M et 2 volumes d'éthanol. Conserver à -20 ° C pendant 1-3 heures.
  14. Centrifuger à 14000 rpm à 4 ° C pendant 20 min, retirer l'éthanol, et l'air sec de la pastille à température ambiante.
  15. Bien dissoudre le culot dans 10 ul de tampon d'hybridation:. 50% de formamide, le sulfate de dextran 20%, 2x SSC Si vous effectuez FISH avec IGS, passez directement à l'étape 4.18
  16. Mélange d'hybridation Dénaturer 7 min à 97 ° C, et immédiatement mis sur la glace pendant 1 min.
  17. Prehybridize mélange à 37 ° C pendant 30 min pour éviter une hybridation non spécifique de l'ADN répétitif pour les chromosomes.
  18. Introduire 10 ul du mélange d'hybridation sur la lame, et couvrir avec une lamelle 22x22. Éviter la formation de bulles - bulles d'air doivent être enlevés avec une légère pression sur la lamelle Si vous effectuez FISH avec le BAC clone d'ADN, passez directement à l'étape 4.20 <./ Em>
  19. Dénaturer la sonde et l'ADN chromosomique utilisant simultanément un bloc de chauffage à 75 ° C pendant 5 min.
  20. Lamelle colle sur le pourtour à l'aide de colle de caoutchouc.
  21. Effectuer hybridation pendant une nuit dans une chambre humide à 37 ° C.
  22. Enlever la colle de caoutchouc et la lamelle sur la lame.
  23. Laver la lame 2 min dans la solution préchauffée 1 (0,4 x SSC, 0,3% de Nonidet-P40) à 73 ° C.
  24. Laver les lames dans la solution 2 (2x SSC, 0,1% de Nonidet-P40) pendant 5 min à température ambiante.
  25. Contre-lame à l'aide 0,001 mM YOYO-1 dans PBS 1x pendant 10 min dans une chambre humide à température ambiante.
  26. Monter dans une petite quantité de réactif Prolongez antifade or avec une lamelle.
  27. Analyser les préparations au microscope à fluorescence avec filtres appropriés à 1000 x grossissement (figure 4).

5. Les résultats représentatifs

ID insectes se trouvent dans chaque segment de la larve. En fonction de la position, eey transformer en différents tissus au stade adulte de l'insecte. Les ID, qui sont utilisés pour la préparation des chromosomes dans ce protocole, se développer en jambes au stade adulte du moustique. Ces identifiants sont situés sur le côté ventral de la poitrine et des larves sont clairement visibles à travers la cuticule au microscope (Figure 1). Au début de 4 ème étape larvaire, les ID ont une forme ronde (figure 1A). Le plus grand nombre de mitose, ~ 175 dans un ID 9, sont accumulés à une date ultérieure "de forme ovale" étape (figure 1B), qui doit être considéré comme le stade optimal pour la préparation des lames. A cette époque, l'ID intermédiaire se divise en deux: l'un se transforme en une jambe et un autre se transforme en une aile. Nous préférons utiliser les identifiants de grandes jambes à la «forme ovale" scène pour la préparation des lames chromosome. Figure 1C représente ID lors de la dernière étape de 4 e stade larvaire développement. A ce stade, l'ID sont déjà développé dans les jambes et les ailes, et contiennent une quantité importante de tissus différenciés et un faible nombre de mitose. Ce stade de développement ID doit être évitée pendant la préparation des lames chromosome. Nous recommandons également l'élevage des larves de moustiques à basse température:. 16 ° C pour Aedes et Culex et 22 ° C pour Anopheles Cela contribue à augmenter la quantité de la mitose dans les ID 9.

La figure 2 illustre la dissection ID du thorax du 4 e stade larvaire. Parce que la cuticule d'un insecte vivant est difficile à disséquer, nous recommandons d'utiliser des ciseaux à dissection au lieu des aiguilles couramment utilisés pour la préparation de larve. La procédure la plus cruciale pour l'obtention de préparation chromosomique de haute qualité est le traitement solution hypotonique. Pour de meilleurs résultats, nous supprimons l'intestin et de graisse du corps du thorax des larves avant ce traitement. Le gonflement des cellules ID pendant cette procédure contribue à répandre le chromosomes sur une lame (figure 3A). La qualité du traitement approprié solution hypotonique peut être facilement reconnu par la forme ronde de cellules dans les préparations (figure 3A, B). Les cellules avec une forme ovale indiquer insuffisante traitement solution hypotonique (figure 3C). Pour être sélectionné pour les poissons, préparation des chromosomes doit contenir au moins 50 étalements de chromosomes de haute qualité. Normalement, ~ 90% des lames préparées en utilisant ce protocole de qualité suffisante pour FISH 9.

Nous présentons deux protocoles FISH légèrement différentes: un protocole de pointe pour FISH utilisant la sonde génomique d'ADN de BAC clone sur chromosomes mitotiques des genres Aedes et Culex et un protocole FISH simple pour IGS ADNr sonde sur les chromosomes mitotiques de l'anophèle. Les génomes de Aedes et Culex sont très répétitives en raison de la surreprésentation des éléments transposables 7,8. Ainsi, l'exécution FISH, qui utilizes ADN génomique clone BAC comme sonde, nécessite l'ajout d'ADN répétitives non marqués fractions de la sonde à bloquer une hybridation non spécifique des séquences répétées de chromosomes. Pour l'extraction des fractions d'ADN répétitives, l'ADN génomique est dénaturé à 120 ° C pendant 2 min. ADN d'ébullition à une température élevée permet également d'obtenir des fragments d'ADN dans de 200-500 pb. ADN est autorisé à se réassocier après ce traitement. Les fragments d'ADN hautement répétées ont tendance à trouver leur compagnon de réassociation rapide que l'ADN avec des séquences uniques fait. En conséquence, la réassociation d'ADN suit une courbe C 0 x tC 0 est la concentration initiale de l'ADN simple brin, et t est le temps de ré-hybridation. Fractions d'ADN avec des valeurs t 0 C égales à 10-4 - 10-1 ou 100-102 sont considérés comme hautement et moyennement répétitif, respectivement. Le temps de la réassociation des différentes fractions d'ADN C 0 t peut être calculé à l'aide èmee formule t = 0 t C × 4,98 X / C 0,t - le temps d'incubation, C 0 t X - C 0 t fraction (C0T 1 = 1, C 0 t 2 = 2, etc) et C 0 - concentration initiale en ADN pg / pl 15 (Tableau 1). Après ré-association, l'ADN simple brin est digéré en utilisant la nucléase S1. Nous préférons utiliser les 0 C fractions d'ADN T à C 0 t 3, ainsi que la place du couramment utilisé C 0 t fraction d'ADN 1. Ces fractions 0 C t sont quelques-unes des séquences d'ADN répétitives modérément et, ensemble, représentent habituellement 35-50% du montant initial de l'ADN génomique chez Ae. aegypti. La proportion correcte de la sonde ADN marquée et non marquée C 0 t fraction d'ADN dépend de la composante ADN répétitif dans chaque clone BAC particulier. En moyenne, nous utilisons 1:20 sonde à C 0 tProportion fraction d'ADN pour obtenir un rapport signal / fond acceptables du résultat FISH. Préhybridation de la sonde ADN avec C 0 t fractions d'ADN dans un tube de 30 min avant l'hybridation proprement dite sur la lame permet également de réduire le fond. Marquage, hybridation elle-même, et le lavage dans ce protocole sont effectuées en utilisant des conditions standard 12.

Les résultats de FISH de deux sondes d'ADN marquées différemment BAC clones sur les chromosomes mitotiques de Ae. aegypti et Culex. quinquefasciatus sont présentés dans les figures 4A et B, respectivement. Les sondes d'ADN clones BAC produire des signaux forts dans une seule position sur les chromosomes. Les chromosomes de la figure 1 sont contre-YOYO-1 iodure. Ce colorant produit les modèles de meilleure bandes sur Ae. aegypti chromosomes 9. En variante, d'autres colorants fluorescents, tels que l'iodure de propidium ou DAPI, peuvent être utilisés pour eUne contre chromosome e. Pour photoblanchiment supprimer des diapositives, nous utilisons Prolongez moyen antifade d'or de montage. Ce réactif a de bonnes capacités de conservation de signal et peut également être facilement retiré de la lame d'un rinçage dans du PBS 1X s'il est nécessaire d'utiliser la même lame pour les hybridations plusieurs.

Une version simple du protocole FISH est conçu pour l'hybridation de la sonde ADNr IGS sur les chromosomes mitotiques de l'anophèle. Gènes ribosomiques chez Anopheles sont représentés comme un ensemble polymorphe de gènes situés sur 16 chromosomes sexuels. Une sonde d'ADN dans le présent protocole est étiqueté en utilisant la norme de réaction PCR en ajoutant marquées par fluorescence Cy3 ou Cy5 dNTP. Parce que le blocage hybridation non spécifique de l'ADN répétitif dans l'euchromatine n'est pas nécessaire, toutes les mesures liées à l'utilisation de C 0 fractions d'ADN t sont omis. Au contraire, les préparations chromosomiques sont prétraités avec de la RNase pour la prévention de l'hybridation de la sonde à ADN recombiné IGSle nucléole. Chromosomes et la sonde d'ADN sont dénaturés par chauffage simultané de l'ensemble coulissant avec une sonde dans un système d'hybridation à 75 ° C pendant 5 min. Hybridation et de lavage dans ce protocole sont également effectuées en utilisant des conditions standard pour FISH 12. Le résultat de FISH est démontré à la figure 4C: le polymorphisme de l'hybridation IGS ADNr entre deux chromosomes X est clairement visible.

0 t 3
Concentration d'ADN pg / pl Réhybridation temps, min
C t 0 2 0,1 100
0,3 33
0,5 20
0,7 14
0,9 11
1 10
0,1 150
0,3 50
0,5 30
0,7 21
0,9 17
1 15

Concentration d'ADN tableau 1. Renaturation et les temps de préparation de C 0 et C 0 t2 t3 fractions.

Figure 1
Figure 1 Étapes du développement d'identité en 4 e stade larvaire: A) un début de "forme ronde" scène; B) un intermédiaire "ovale" étape - optimal pour la préparation des chromosomes, C) un stade tardif - approprié pour des préparations de chromosomes. . Les positions des ID sont indiqués par des flèches sur la face ventrale du thorax larvaire.

Figure 2
Figure 2 Étapes de dissection ID: Une larve) décapitée (la direction de coupes sont indiquées par des flèches), B) larves intestin disséqué sous traitement solution hypotonique (ID gonflent et deviennent presque invisibles); C) larve après application de la solution de Carnoy (. ID deviennent blancs et clairement visible); D) disséqué ID dans une solution de Carnoy. Positions des identifiants de larves sont signalées par un astérisque.

Figure 3
Figure 3 qualités différentes des étalements de chromosomes: A) une propagation chromosome parfaite - forme ronde des cellules démontre un traitement suffisant des identifiants dans une solution hypotonique; B) un traitement hypotonique parfaite - chromosomes sont légèrement undersquashed; C) un écart chromosome pauvres. - le fait deinsuffisante traitement hypotonique est indiqué par la forme ovale des cellules.

Figure 4
Figure 4. Exemples de FISH avec des clones BAC (A, B) et l'IGS ADNr (C) dans les chromosomes de Ae. aegypti (A), Cx. quinquefasciatus (B), et une. gambiae (C). 1, 2 et 3 - sont des nombres de chromosomes, X - chromosome sexuel féminin dans un. gambiae.

Discussion

Non fluorescent hybridation in situ sur chromosomes mitotiques de moustiques a été réalisée pour la première fois en 1990 par A. Kumar et K. Rai 17. Dans cette étude, 18S et 28S des gènes d'ADN ribosomal, cloné dans un plasmide ensemble, ont été placés sur les chromosomes de 20 espèces de moustiques. La sonde d'ADN a été marqué radioactivement et hybridés aux chromosomes de ganglions du cerveau. Parmi les trois genres de moustiques, une technique FISH a été développé uniquement pour les chromosomes mitotiques de la lignée cellulaire d'Ae. aegypti 10,18,19 et n'a jamais été effectuée sur les chromosomes mitotiques de moustiques vivants. Récemment, nous avons développé une technique simple et robuste pour l'obtention des préparations chromosomiques de haute qualité des ID des 4 e stade larvaire 9. Cette méthode permet à un nombre élevé de chromosomes à obtenir dans une diapositive et peut être utilisé universellement pour toutes les espèces de moustiques. La nécessité d'utiliser sta seule larve, nymphe ou adulte neges de moustiques, pour la préparation des lames est probablement la seule limite de la méthode. La méthode FISH standard de 12 a été optimisé pour l'utilisation de la génomique clone BAC et l'IGS ADNr comme sondes pour les chromosomes mitotiques de Aedes, Culex, Anopheles et.

En plus de ces applications spécifiques, les protocoles FISH décrites ici peuvent également être utilisés à d'autres fins. Le protocole FISH avancé, qui utilise C 0 t fractions d'ADN pour bloquer l'hybridation non spécifique, peut également être appliquée pour l'hybridation de clones BAC ou d'autres fragments d'ADN grandes régions hétérochromatiques d'Anopheles. Régions hétérochromatiques sont enrichis en éléments transposables et répète autres, et les sondes de ces régions produisent normalement solide expérience sur les 3 chromosomes. Utilisation non marquées C 0 fractions d'ADN t aidera à réduire l'hybridation non spécifique de la sonde aux chromosomes. La version simple de la pr POISSONotocole peut être utilisé pour n'importe quel ADNr ou des sondes d'ADN répétitives sur les chromosomes mitotiques de moustiques et d'autres insectes. En outre, il peut également être appliquée pour l'hybridation de l'ADN clone BAC en espèces à faible teneur en ADN répétitif dans les régions euchromatiques comme Anopheles ou la drosophile. Le protocole proposé ici permettra d'obtenir très-finis assemblées du génome chromosomique base pour les moustiques et peut être largement utilisé pour des applications cytogénétiques différents autres groupes d'insectes.

Disclosures

Aucun conflit d'intérêt déclaré.

Acknowledgments

Nous remercions Sergei Demin et Tatyana Karamysheva pour leur aide dans la préparation des chromosomes et FISH sur Anopheles. Nous remercions également David Severson de nous donner Aedes et Culex ADN génomique des clones BAC et Melissa Wade pour éditer le texte. Ce travail a été soutenu par deux subventions du National Institutes of Health: 1R21 AI88035-01 à Maria V. Sharakhova et AI094289 1R21-01 à Igor V. Sharakhov.

Materials

Name Company Catalog Number Comments
MZ6 Leica stereomicroscope Leica VA-OM-E194-354 A different stereomicroscope can be used
Olympus CX41 phase microscope Olympus CX41 A different phase microscope can be used
Olympus BX61 fluorescent microscope Olympus BX61 A different fluorescent microscope can be used
ThermoBrite Slide Denaturation/Hybridization System Abbott Molecular 30-144110 Serves as a heating block and a humid chamber
Dissecting needles Fine ScienceTools 10130-10
Needle holders Fine Science Tools 26018-17
Dissecting scissors Fine Science Tools 15000-03
75x25 double frosted micro slides Corning 2949-75x25
22x22 mm microscope coverslips Fisher Scientific 12-544-10
Parafilm Fisher Scientific 13-374-10
Rubber Cement Fisher Scientific 50-949-105
Acetic acid Fisher Scientific A491-212
Alcohol 200 Proof Decon Laboratories 2701
Propionic acid Sigma-Aldrich 402907
Hydrochloric acid Fisher Scientific A144-500
Sodium citrate dihydrate Fisher Scientific S279-500
Sodium acetate trihydrate Fisher Scientific BP334-500
Potassium chloride Fisher Scientific BP366-500
EDTA Fisher Scientific S311-500
Tris base Fisher Scientific BP152-1
10x PBS Invitrogen P5493
10% NBF (neutral buffered formalin) Sigma-Aldrich HT501128
99% formamide Fisher Scientific BP227500
Dextran sulfate sodium salt Sigma-Aldrich D8906
20x SSC buffer Invitrogen AM9765
1 mM YOYO-1 iodide (491/509) solution Invitrogen Y3601
Antifade Prolong Gold reagent Invitrogen P36930
dATP, dCTP, dGTP, dTTP Fermentas R0141, R0151, R0161, R0171
Cy3-dUTP, Cy5-dUTP GE Healthcare PA53022, PA55022
BSA Sigma-Aldrich A3294
DNA Polymerase I Fermentas EP0041
DNase I Fermentas EN0521
S1 Nuclease Fermentas EN0321
Taq DNA Polymerase Invitrogen 18038-042
RNase Sigma-Aldrich 9001-99-4
Pepsin USB 9001-75-6
Salmon sperm DNA Sigma-Aldrich D7656
Nonidet-P40 (NP40) US Biological NC9375914
Qiagen Blood and Cell Culture Maxikit Qiagen 13362
Qiagen Large Construct Kit Qiagen 12462

DOWNLOAD MATERIALS LIST

References

  1. Sharakhov, I. V., Sharakhova, M. V. Chromosome Mapping Research Developments. Verrity, J. F., Abbington, L. E. Nova Science Publishers, Inc. (2008).
  2. Holt, R. A., et al. The genome sequence of the malaria mosquito Anopheles gambiae. Science. 298, 129-149 (2002).
  3. Sharakhova, M. V., et al. Update of the Anopheles gambiae PEST genome assembly. Genome biology. 8, R5 (2007).
  4. Campos, J., Andrade, C. F., Recco-Pimentel, S. M. A technique for preparing polytene chromosomes from Aedes aegypti (Diptera, Culicinae). Memorias do Instituto Oswaldo Cruz. 98, 387-390 (2003).
  5. Campos, J., Andrade, C. F., Recco-Pimentel, S. M. Malpighian tubule polytene chromosomes of Culex quinquefasciatus (Diptera, Culicinae). Memorias do Instituto Oswaldo Cruz. 98, 383-386 (2003).
  6. McAbee, R. D., Christiansen, J. A., Cornel, A. J. A detailed larval salivary gland polytene chromosome photomap for Culex quinquefasciatus (Diptera: Culicidae) from Johannesburg, South Africa. J. Med. Entomol. 44, 229-237 (2007).
  7. Nene, V., et al. Genome sequence of Aedes aegypti, a major arbovirus vector. Science. 316, 1718-1723 (2007).
  8. Arensburger, P., et al. Sequencing of Culex quinquefasciatus establishes a platform for mosquito comparative genomics. Science. 330, 86-88 (2010).
  9. Sharakhova, M. V., et al. Imaginal discs--a new source of chromosomes for genome mapping of the yellow fever mosquito Aedes aegypti. PLoS neglected tropical diseases. 5, e1335 (2011).
  10. Brown, S. E., et al. Toward a physical map of Aedes aegypti. Insect Mol. Biol. 4, 161-167 (1995).
  11. Steiniger, G. E., Mukherjee, A. B. Insect chromosome banding: technique for G- and Q-banding pattern in the mosquito Aedes albopictus. Can. J. Genet. Cytol. 17, 241-244 (1975).
  12. Garimberti, E., Tosi, S. Fluorescence in situ hybridization (FISH). Bridger, J. M., Volpi, E. V. Springer Science and Business Media. (2010).
  13. Methods in Anopheles Research [Internet]. The Malaria Research and Reference Reagent Resource Center. Atlanta, GA. Available from: http://www.mr4.org/Portals/3/Pdfs/ProtocolBook/MethodsAnophelesResearchV4c.pdf (2007).
  14. Scott, J. A., Brogdon, W. G., Collins, F. H. Identification of single specimens of the Anopheles gambiae complex by the polymerase chain reaction. The American journal of tropical medicine and hygiene. 49, 520-529 (1993).
  15. Trifonov, V. A., Vorobyeva, N. N., Rens, W. Fluorescence in situ hybridization (FISH). Leiehr, T. Spriger-Verlag. (2009).
  16. Collins, F. H., et al. A ribosomal RNA gene probe differentiates member species of the Anopheles gambiae complex. The American journal of tropical medicine and hygiene. 37, 37-41 (1987).
  17. Kumar, A., Rai, K. S. Chromosomal localization and copy number of 18S+28S ribosomal RNA genes in evolutionary diverse mosquitoes (Diptera, Culicidae). Hereditas. 113, 277-289 (1990).
  18. Brown, S. E., Knudson, D. L. FISH landmarks for Aedes aegypti chromosomes. Insect Mol. Biol. 6, 197-202 (1997).
  19. Brown, S. E., Severson, D. W., Smith, L. A., Knudson, D. L. Integration of the Aedes aegypti mosquito genetic linkage and physical maps. Genetics. 157, 1299-1305 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics